ID: 1097919103

View in Genome Browser
Species Human (GRCh38)
Location 12:65052590-65052612
Sequence GGGGGTTTATTTTGACTAGA CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 104
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 98}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1097919103_1097919110 21 Left 1097919103 12:65052590-65052612 CCGTCTAGTCAAAATAAACCCCC 0: 1
1: 0
2: 0
3: 5
4: 98
Right 1097919110 12:65052634-65052656 AGCTAATGTACAAAATGGCTGGG 0: 1
1: 0
2: 1
3: 16
4: 154
1097919103_1097919108 16 Left 1097919103 12:65052590-65052612 CCGTCTAGTCAAAATAAACCCCC 0: 1
1: 0
2: 0
3: 5
4: 98
Right 1097919108 12:65052629-65052651 ATTTTAGCTAATGTACAAAATGG 0: 1
1: 0
2: 3
3: 41
4: 376
1097919103_1097919109 20 Left 1097919103 12:65052590-65052612 CCGTCTAGTCAAAATAAACCCCC 0: 1
1: 0
2: 0
3: 5
4: 98
Right 1097919109 12:65052633-65052655 TAGCTAATGTACAAAATGGCTGG 0: 1
1: 0
2: 1
3: 16
4: 93

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1097919103 Original CRISPR GGGGGTTTATTTTGACTAGA CGG (reversed) Intronic