ID: 1097919616

View in Genome Browser
Species Human (GRCh38)
Location 12:65057368-65057390
Sequence AGAATTTTAGAGCTGGAGTA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 319
Summary {0: 1, 1: 0, 2: 1, 3: 32, 4: 285}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1097919614_1097919616 19 Left 1097919614 12:65057326-65057348 CCAATGAGTATTACGAATGCTTT 0: 1
1: 0
2: 0
3: 3
4: 101
Right 1097919616 12:65057368-65057390 AGAATTTTAGAGCTGGAGTAAGG 0: 1
1: 0
2: 1
3: 32
4: 285
1097919613_1097919616 20 Left 1097919613 12:65057325-65057347 CCCAATGAGTATTACGAATGCTT 0: 1
1: 0
2: 0
3: 5
4: 89
Right 1097919616 12:65057368-65057390 AGAATTTTAGAGCTGGAGTAAGG 0: 1
1: 0
2: 1
3: 32
4: 285

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1097919616 Original CRISPR AGAATTTTAGAGCTGGAGTA AGG Intronic
901328275 1:8383117-8383139 AGAATGTTAGAGATGGTGAATGG + Intronic
903455049 1:23481813-23481835 AGAATCTTAGAGCAGGAGAAGGG - Intronic
905634686 1:39542159-39542181 AGATTTGGAGAGCTGGAGTTTGG - Intergenic
906333759 1:44910207-44910229 GGAATTTTAGAGCTGGAGGGGGG + Intronic
907224539 1:52932687-52932709 AGTATATTAGAGTTGGAGTTAGG + Intronic
907892976 1:58653252-58653274 AGAATTTTAAAGCTGGAAAAAGG - Intergenic
907941364 1:59090958-59090980 AGAATTTGAAAGTTGGAGAATGG + Intergenic
909919544 1:81364110-81364132 TGAATTTTAGAGTGGGGGTAAGG - Intronic
911658881 1:100477005-100477027 TGCATTTTAAAGATGGAGTAAGG + Intronic
913024756 1:114826390-114826412 AAAATTTTAGAAATGGAGGACGG + Intergenic
913556366 1:119971319-119971341 AGAATTATATGGCTGGAGTTAGG - Intronic
914794854 1:150911380-150911402 AGAATTTTCTTGATGGAGTAAGG + Intergenic
915820490 1:159018104-159018126 AGATGTTTAGAGCTGGAGTCAGG - Intronic
916091270 1:161309566-161309588 TGAATTTTACAGATGGAGTCTGG + Intronic
916455826 1:164970065-164970087 AGAATTTGAGCCCTGGAGTCTGG - Intergenic
916588536 1:166167507-166167529 AGAGACTTAGTGCTGGAGTACGG - Intergenic
916834885 1:168533292-168533314 AGGATTTTAGAGCTCGAGGATGG + Intergenic
917426236 1:174917468-174917490 AGAATTTAACAGCTGGTGGAAGG + Intronic
919694140 1:200556353-200556375 ACAATTTTAAAGCTGGAGTCAGG - Intronic
919830068 1:201534416-201534438 AGACTTTTAGAGCTGGAAGTGGG - Intergenic
920265255 1:204716726-204716748 AGAGTTTTATGGCTGGAGTGAGG + Intergenic
922610771 1:226925464-226925486 AGCATTTAAGAACTGGAGAATGG + Intronic
1063790249 10:9436881-9436903 ACAATTTTATATCTGGAGTATGG + Intergenic
1064331046 10:14394537-14394559 AGAATTTTAAAAATGGAGGAAGG + Intronic
1064871543 10:19943154-19943176 AGGATTCTGGAGCTGAAGTATGG + Intronic
1065245062 10:23748292-23748314 AAAATTCTTGAGCTGGAGGAAGG - Intronic
1065908670 10:30282286-30282308 AGAATTTTAGAACTGGAATCAGG - Intergenic
1065978944 10:30871590-30871612 AGAATATTAGAACTCAAGTAAGG - Intronic
1069552095 10:69371473-69371495 AGAATTTTAGAGATGCAACAGGG - Intronic
1071680099 10:87696113-87696135 AGAATTTCATAGCTGAAGTTGGG - Intronic
1071829071 10:89353985-89354007 AAAGTTTTAGAGCAGGAATAAGG - Intronic
1072444075 10:95482774-95482796 AGAATGTCAGAGCTTGAGGAAGG + Intronic
1074626131 10:115188582-115188604 AGAATTTTGGAGGTGTAGTTGGG + Intronic
1076584234 10:131534263-131534285 GGAAAATTAGAGCTAGAGTAGGG - Intergenic
1079702162 11:23561829-23561851 ATAATTTTGGGGCTGCAGTAAGG + Intergenic
1080048504 11:27834885-27834907 AGAATCTTAGAACTGAAGTTTGG - Intergenic
1080302073 11:30795761-30795783 AGGATTATAGAGATGCAGTATGG - Intergenic
1080555223 11:33410081-33410103 AGAATGTTAGATTTGGAGTGTGG + Intergenic
1080626033 11:34031465-34031487 AGAATGTTAGAACTGCAGTAGGG - Intergenic
1080971114 11:37278517-37278539 AGAATCTCTGAGCTTGAGTAGGG - Intergenic
1081430192 11:42968250-42968272 CTAATTTTAGAGCTGGACTCTGG + Intergenic
1081514403 11:43811460-43811482 ACAATGTTAAAGCTGGAATAAGG - Intronic
1083059723 11:59857268-59857290 AGAAATTTAGAGGTGGAGCCTGG - Intronic
1083872299 11:65496572-65496594 AGAATTTTATCGCTGGATGAAGG - Intergenic
1084053075 11:66613823-66613845 AAAATTTTAGAGATGGATTTTGG + Intergenic
1084080444 11:66820211-66820233 AGGATTCTGGAGCTGGAGTCAGG - Intronic
1084110346 11:67010366-67010388 AGCATGTTAGAGCTGGAGCCTGG - Intronic
1084837998 11:71818823-71818845 ATAATTTTGCAGCTGGAGCAAGG - Intergenic
1086845280 11:91742318-91742340 AGAGTATTAGAGCAGGAGTCAGG + Intergenic
1087502941 11:98982279-98982301 AGAATATTATAAATGGAGTAAGG + Intergenic
1087733852 11:101809606-101809628 AGAAAGTTAAAGCTGGTGTAGGG + Intronic
1088644678 11:111908225-111908247 TTAATTTTAGAGATGCAGTAAGG + Intergenic
1089306142 11:117527542-117527564 GGAATTATAGAGCTGGCTTAGGG + Intronic
1089898415 11:121955892-121955914 AGCAGTGAAGAGCTGGAGTAAGG - Intergenic
1092400706 12:8175251-8175273 ATAATTTTGCAGCTGGAGCAAGG + Exonic
1097919616 12:65057368-65057390 AGAATTTTAGAGCTGGAGTAAGG + Intronic
1098413287 12:70204295-70204317 AAAATTTTACAGATGGAGGAAGG + Intergenic
1098658119 12:73058495-73058517 ATAATTTTAGAGTTGGTGCAGGG + Intergenic
1099723566 12:86396213-86396235 AGAATTTTTGAACTGGAGCCTGG - Intronic
1101115061 12:101523760-101523782 ATAATATTAGTGCAGGAGTATGG - Intergenic
1105882497 13:24616410-24616432 AGAAGTTTAGAGCTGGAAGAGGG + Intergenic
1106442105 13:29784663-29784685 AAAATTATAGAGATGGAGAATGG + Intronic
1107146673 13:37067783-37067805 AGGTTTTAAGAGCTGGAGTAGGG - Intergenic
1108372918 13:49788825-49788847 AGAAATTTGGAGCTTGGGTAGGG - Intronic
1110298394 13:73897070-73897092 ACAAATTTAGAGCTTAAGTATGG - Intronic
1111377837 13:87403725-87403747 AGCATGTTAGAACTGGAGAAGGG - Intergenic
1111607777 13:90563308-90563330 AGATTTTAAGAGCTGGTGTGGGG + Intergenic
1112046361 13:95602037-95602059 AGAATTGGAGAGCTGGGCTATGG - Intronic
1115302956 14:31904521-31904543 AGGATTTCAGAGCTAGAGCAGGG - Intergenic
1116262050 14:42642985-42643007 AGAATTTTGGAGATGGATGATGG - Intergenic
1116887277 14:50233124-50233146 AGTAGTTTATAGCTGGAGTCTGG - Intergenic
1118322046 14:64759019-64759041 AGAATTCTAGAGCTGGAAAGAGG + Intronic
1118729477 14:68656387-68656409 AGAATCTGAGAGCTGGACAAAGG - Intronic
1119211110 14:72832801-72832823 AGATTTTCAGGGCTGGATTATGG - Intronic
1120141780 14:80937865-80937887 AGAATTTTAGAGCTGGATGGGGG - Intronic
1120998987 14:90437734-90437756 AGAATGATAGACCTGGAGTTAGG - Intergenic
1122050162 14:99053353-99053375 GGTATTCAAGAGCTGGAGTAGGG - Intergenic
1122569200 14:102683447-102683469 AGAATTGGAGAGGTGGAGCACGG + Intronic
1123487354 15:20754131-20754153 AGAATTTAAGAAGTGGAGAAGGG - Intergenic
1123543845 15:21323185-21323207 AGAATTTAAGAAGTGGAGAAGGG - Intergenic
1123903502 15:24899517-24899539 AGAAATATAGTGCTGGAGAAAGG - Intronic
1125152590 15:36549954-36549976 AGAGATTCAGAGCTGGAGTTCGG - Intergenic
1127630215 15:60820963-60820985 AGAATTGCAGAGCTGGGGTGGGG - Intronic
1127899849 15:63333116-63333138 AGAATTTTCCAGATGGAGGAGGG + Intronic
1128593212 15:68921117-68921139 AGAATTTTTCAGGTGGAGTCTGG - Intronic
1129491644 15:75932261-75932283 AGAATTTGACAGCTGAAGTCGGG + Intronic
1130247926 15:82270441-82270463 TGAACTTTAGAGCTGTATTAGGG + Intronic
1130882123 15:88064398-88064420 TGAAGTTTGCAGCTGGAGTAAGG - Intronic
1131058864 15:89392210-89392232 AGGATTTGGGAGCTGGGGTAAGG - Intergenic
1131653303 15:94426450-94426472 AGAATTTGTGATTTGGAGTAGGG - Intronic
1202952161 15_KI270727v1_random:50312-50334 AGAATTTAAGAAGTGGAGAAGGG - Intergenic
1134174133 16:11992280-11992302 AAAATTTAAGAGATGGAGTCTGG - Intronic
1135644617 16:24150817-24150839 TGAATTCTAGAGCAGGAGTCAGG - Intronic
1139043030 16:63022428-63022450 AGAATTTAAGAAATGGATTAAGG - Intergenic
1140093113 16:71853130-71853152 AGAATCTTAGAGCTGGTGGTGGG - Exonic
1140881551 16:79202554-79202576 AGAAGGTCAGAGCTGGAGTGGGG + Intronic
1142404351 16:89878971-89878993 AGCATTTTAGAGCTGATGCATGG + Intronic
1142839499 17:2616275-2616297 AGAATACTACTGCTGGAGTATGG + Intronic
1143433351 17:6903166-6903188 AGAATTTGAAAGCTGGACTGAGG - Intronic
1144231118 17:13204873-13204895 GGAATGTTGGAGCTGGAGTCAGG + Intergenic
1144692493 17:17277308-17277330 TGTATTCTAGAGCTGGAGAAAGG - Intronic
1148169889 17:45510021-45510043 AGAATTTTAGAATTAGAGGAGGG - Intergenic
1148279320 17:46335791-46335813 AGAATTTTAGAATTAGAGGAGGG + Intronic
1148301537 17:46553646-46553668 AGAATTTTAGAATTAGAGGAGGG + Intronic
1149539536 17:57458618-57458640 AGAGTATTAGAGCTGGAGAGGGG - Intronic
1150256676 17:63751400-63751422 AAAAATTTAGAGCTGGACTATGG + Intronic
1150400970 17:64855619-64855641 AGAATTTTAGAATTAGAGGAGGG - Intronic
1153110730 18:1583333-1583355 AGAATTTTGGAAATGGATTATGG - Intergenic
1153361090 18:4197792-4197814 TGAATGTTAGAGATGAAGTAGGG + Intronic
1153638087 18:7130354-7130376 TGAACGTGAGAGCTGGAGTAGGG + Intergenic
1154439694 18:14377678-14377700 AGAATTTGAGATCTGGCGTGAGG - Intergenic
1155098180 18:22580220-22580242 AGAATTTTATAGCTTAAATACGG - Intergenic
1155534868 18:26806576-26806598 AGAATGTGAGATCTGGAGTGAGG + Intergenic
1155744623 18:29338495-29338517 ATAATATGAGAGCTGTAGTAGGG - Intergenic
1157176153 18:45454184-45454206 AGAAGCTTAGAGCTGGGGAAGGG + Intronic
1159519576 18:69500817-69500839 AGTATTTTAGAGTTTGTGTAAGG + Intronic
1162671422 19:12260698-12260720 GGAATTGGGGAGCTGGAGTATGG - Intronic
1163593099 19:18205147-18205169 AGGGTTTGAAAGCTGGAGTAGGG - Intergenic
1165039716 19:33060393-33060415 GGAATGATAGAGCTGGAGAAAGG - Intronic
1166341423 19:42139734-42139756 AGAATGTTAGAGCTGGGGCCGGG - Intronic
1166610725 19:44192692-44192714 AGTATTTTAAAGCTGGAATAAGG + Intergenic
1167651346 19:50731314-50731336 AGTATTATAGAGCTGGGGAATGG - Intergenic
925525552 2:4796775-4796797 AGAGATTTAGAGCTGGTGCAAGG + Intergenic
925695310 2:6571054-6571076 AGGGTTTTGGGGCTGGAGTAGGG - Intergenic
926300543 2:11599072-11599094 GGAATTTAAGGGCTGGAGAAGGG + Intronic
927806692 2:26153593-26153615 AAAATTTAAGATCTGGAATAAGG + Intergenic
930180066 2:48346622-48346644 AGAAATTTATAGCTGGATTCTGG + Exonic
931499172 2:62845234-62845256 TGAATTATATAGCTGGTGTAAGG - Intronic
931592654 2:63902096-63902118 AGAAGTTGAGAGCAGAAGTATGG + Intronic
932876031 2:75453448-75453470 AGAATTTGAGAGCTGTAGGCAGG + Intergenic
933159129 2:79005207-79005229 AGAATTTTACAGGTGGAAAAGGG + Intergenic
933679206 2:85084258-85084280 AGAATTATAGAAATGGAGAATGG + Intergenic
934489771 2:94754247-94754269 AGAGCTTTAGAGCTGTAGAAGGG - Intergenic
934907000 2:98213736-98213758 AGAAATATGGAGCTGGAGTTAGG + Intronic
935215182 2:100970280-100970302 AGGATTTGAGAGGTGGAGGATGG - Intronic
935323291 2:101909377-101909399 AGAATTTGAGAGGTGGAAAAGGG - Intergenic
936553105 2:113467760-113467782 AGGTTTTTACAGATGGAGTAGGG + Intronic
936920488 2:117683860-117683882 AGAATTATGGAGCTAGAATAAGG - Intergenic
938692114 2:133801206-133801228 AGAATTTTGGAGGAGGAGTGAGG - Intergenic
939531946 2:143374246-143374268 AGAATATTATAGGTGGATTATGG + Intronic
940120569 2:150260100-150260122 CGCAGTTAAGAGCTGGAGTAGGG - Intergenic
942497821 2:176558230-176558252 AAAATTATAGAGATGGAGTCTGG - Intergenic
943333655 2:186589305-186589327 ATAATTTCAGAGCTGGAAGAAGG - Intergenic
945968171 2:216210212-216210234 AGAGTTTTAGAGATGGAGGTGGG + Intergenic
1169609507 20:7363180-7363202 GGAAAGTAAGAGCTGGAGTAGGG + Intergenic
1171879635 20:30609002-30609024 AGAGCTTTAGAGCTGTAGAAAGG - Intergenic
1174101064 20:48126499-48126521 AGGGTTTTAGAGCTGGAGCCTGG - Intergenic
1174598867 20:51707875-51707897 TGTATTTTAGAGATGGAGTCTGG + Intronic
1175541854 20:59752875-59752897 GGAATGTGAGAGCTGGCGTAGGG - Intronic
1176689890 21:9893358-9893380 AAAATTTTAAAGATAGAGTAAGG - Intergenic
1177387116 21:20422992-20423014 ACAATTTCAGAGTTGGAGTGGGG - Intergenic
1177905982 21:26971778-26971800 AATATTTTAGAGCTTGAGAAAGG - Intergenic
1178023789 21:28441354-28441376 AGAATTTTAGAACTTGAGATCGG - Intergenic
1179171371 21:38975544-38975566 AGAATTCTAGAGCAGGAGTAAGG - Intergenic
1182380814 22:29885336-29885358 AGAATTTAAGAGGTGGAGAAGGG + Intronic
1184342028 22:43891395-43891417 AGAAATTCTGAGCTGGAGTGGGG - Intronic
1184598303 22:45527473-45527495 AGAACTTTGGAGCTGGTGCATGG + Intronic
1184907850 22:47501134-47501156 AGACTTTGAGAGCTGAACTACGG + Intergenic
949244081 3:1904972-1904994 AGAAGCTTGCAGCTGGAGTATGG - Intergenic
949405445 3:3709174-3709196 AGAATTTTGGAGGTAGAGTCTGG - Intronic
950117280 3:10459520-10459542 AGAATTTCAGTGCAGCAGTAGGG - Intronic
950126458 3:10512824-10512846 AGAGTTTGGGAGCTGGAGTCTGG + Intronic
950180111 3:10905911-10905933 AAAATTTTAGATCTGGAGTCAGG + Intronic
951272067 3:20638052-20638074 AGAAGATTAGAGAAGGAGTAAGG + Intergenic
951385645 3:22038714-22038736 AGAATTTTAGATCTTGATAATGG + Intronic
951422531 3:22504288-22504310 AGCATTTAAGAACTGGAGCAAGG + Intergenic
952754546 3:36855065-36855087 AGGTTTTTACAGCTGAAGTAAGG - Intronic
953899692 3:46833053-46833075 AGGATGTTGGAGCTGGAGAAGGG + Exonic
956268830 3:67428109-67428131 AGAGTTTGAGAACTGGAGAATGG + Intronic
956398789 3:68854089-68854111 AGAATTATAAAGCAGGAGTATGG + Intronic
957450888 3:80380540-80380562 ACACTTTTAGAGCTGCAGGAAGG + Intergenic
957514073 3:81228768-81228790 AGAATTTTGCAGCTGGGGAAAGG - Intergenic
957691558 3:83577292-83577314 AGAATTTTACTGGTGGAATATGG + Intergenic
957928361 3:86844230-86844252 AGCATTTAAGAGCTGGGGTACGG - Intergenic
958577727 3:95974098-95974120 AGAATTTTGCTGCTGGAGCAGGG + Intergenic
959930578 3:111977805-111977827 AGGTATTTAGAGCTGGAGTCCGG + Intergenic
961489120 3:127240304-127240326 AGAATTGTAGAGTTGGTGTCAGG - Intergenic
961869081 3:129975184-129975206 AGAATTTTAGCGTTGAAGTTAGG + Intronic
962373681 3:134841918-134841940 AGAGTTTGAGAGCTGGGGAAAGG + Intronic
963076907 3:141355561-141355583 TGACTTTGAGAGCCGGAGTAGGG - Intronic
963163085 3:142172768-142172790 AAAACTTTATAGCTGGAGAAGGG - Intronic
964841451 3:160997699-160997721 AGAATTTTAGAGCCAGAATGAGG - Intronic
965338282 3:167455139-167455161 ACAATTTTAGAGGAGGATTAAGG - Intronic
965860627 3:173145756-173145778 AGAATTAAAGAGCTTTAGTAGGG + Intergenic
966315687 3:178643205-178643227 ATAATTATGGAGCTGGAGAATGG + Intronic
966762643 3:183430892-183430914 AGGATTTCAGAGCTGGAAAAGGG - Intergenic
968146362 3:196302350-196302372 TGAATTGTAGGGCTGGGGTAGGG + Intronic
969779415 4:9386327-9386349 ATAATTTTGCAGCTGGAGCAAGG - Exonic
972129661 4:35816259-35816281 AAAACTTTGGAGATGGAGTAGGG - Intergenic
972499865 4:39667734-39667756 AGAATTTTAGGGAAGGAGTCAGG - Intergenic
975505952 4:75137749-75137771 AGAATCTTGCAGCTGGAGTGTGG - Intergenic
975972192 4:80053193-80053215 ATAATTTTATAGCTGGATTCAGG - Intronic
976656036 4:87489622-87489644 AGCATTCAAGAGCTGGGGTATGG - Intronic
977730704 4:100348141-100348163 TGCTTATTAGAGCTGGAGTATGG + Intergenic
978240605 4:106511434-106511456 AGATTTTTAGAGCTGAATGATGG + Intergenic
978722205 4:111923703-111923725 AGAATTTTTGAACTGGAAGAAGG + Intergenic
979687827 4:123530026-123530048 AGAACATAAGAGCTGGAGTATGG - Intergenic
980726493 4:136768278-136768300 AGAATTTTAGAGATAGAAAAAGG + Intergenic
981634367 4:146859246-146859268 AGAACTCTAGAGCTGAAGTATGG + Intronic
981991429 4:150925573-150925595 AGAATTTTAAAGTTGGAAAATGG - Intronic
982338127 4:154262876-154262898 GCAATTTTAGAGCTTGACTAAGG - Intronic
982854561 4:160364396-160364418 AGATTTTAAGAGCTGGAGTTGGG - Intergenic
982923019 4:161300233-161300255 ACAATTTTATAGCTGGGGTCAGG - Intergenic
982993826 4:162316044-162316066 AGAATTTTAGAGCTTTAAGACGG - Intergenic
984676390 4:182552941-182552963 AAAATTATAGAGCTTGACTAGGG + Intronic
985656474 5:1134129-1134151 AGAATTGCAGAGCTGGAGCTGGG - Intergenic
986247856 5:6027598-6027620 TGAATTTTAGATCTGAAGCAGGG - Intergenic
986557229 5:9023933-9023955 AGAATTTCAGAGCTTGAAGATGG - Intergenic
988402807 5:30783657-30783679 AGAAATTTAGAGCTAGAGCTGGG + Intergenic
990124789 5:52500989-52501011 AGTAATTTATAGTTGGAGTAAGG + Intergenic
991425642 5:66489183-66489205 AGAATTTTAGGTTGGGAGTAGGG - Intergenic
991433048 5:66568282-66568304 AGGGTTTAAGAGCTGGAATAGGG - Intergenic
993772144 5:91941970-91941992 AGACTTTAACAGCTAGAGTAGGG - Intergenic
994579478 5:101621180-101621202 ACAATTTTACAACCGGAGTATGG + Intergenic
994880526 5:105488202-105488224 GGAATTTTAGAGAATGAGTAGGG - Intergenic
995791025 5:115886840-115886862 AGAAATTAAGAGCTGAAGAAAGG - Intronic
997237477 5:132281658-132281680 AGAATATAAGAGCTGGGGAATGG - Intronic
998099275 5:139418466-139418488 AGAATTTTAGAGCAGGATAAAGG - Intronic
998137531 5:139682006-139682028 AGATTTTTGGGGCTGGGGTAAGG + Intronic
999361398 5:150989359-150989381 AGCTTTTAAGAGCTAGAGTAGGG + Intergenic
999655852 5:153809953-153809975 AGAATTTTTGAGGTGGGGTTTGG - Intronic
1000227005 5:159272617-159272639 AGTATTTTAAAACTGGAGTCAGG - Intronic
1003184067 6:3815343-3815365 AGACTTTCAGAGCTGGAGGGAGG + Intergenic
1003212636 6:4080595-4080617 TGTATTTTAGAGCAGCAGTATGG - Intronic
1003542880 6:7033492-7033514 AGAAATTTAGAGATGGAGAGAGG - Intergenic
1005901018 6:30216214-30216236 AGAAATGGAGAGCTGGAGGAAGG - Intergenic
1007293774 6:40805966-40805988 AGCATGTCAGAGCTGGGGTAGGG - Intergenic
1007868682 6:45006737-45006759 AAAAGTTTAGAGATGGAGAAGGG - Intronic
1008410143 6:51168070-51168092 AGACTTTTAGAGCTAGATTGAGG - Intergenic
1008614824 6:53216573-53216595 AGAAATTTATTTCTGGAGTATGG - Intergenic
1009449644 6:63786328-63786350 AGAATTTAATAGTTGGAGTAAGG - Intronic
1009625443 6:66134880-66134902 GGAATTTTAGAGAGGGAGAAAGG - Intergenic
1010106292 6:72172879-72172901 AGAAATTTCGAGCAGGAGGATGG - Intronic
1011372555 6:86652687-86652709 AAAATTTTAGAGATGGAAAACGG - Intergenic
1012234025 6:96791787-96791809 AGAATTTCAAAGCTGGTGTGGGG + Intergenic
1012318696 6:97814845-97814867 AGAATATTGGGGTTGGAGTAGGG + Intergenic
1012469590 6:99556263-99556285 AGAATGGTAGGGCTGGAGGAAGG - Intronic
1013398774 6:109770782-109770804 ACAATTTTGGAGATGGAGTCTGG - Intronic
1014333973 6:120108108-120108130 AGAATCTTTGAGGTGGAATATGG - Intergenic
1014565756 6:122945737-122945759 AGAAAATTGGGGCTGGAGTAAGG + Intergenic
1017301099 6:152858975-152858997 AGAAGTATAGAGCTGAAGTTTGG - Intergenic
1019322810 7:423282-423304 AGGATTTCAGAGCAGGAGTTTGG - Intergenic
1020145684 7:5640550-5640572 AGTATTTTAGAGGAGGAGCAAGG - Intronic
1020478381 7:8626418-8626440 AGAAAGTTAGATCTGGAGTAAGG - Intronic
1021456388 7:20833551-20833573 AAAATTATAGAGATGGAGAACGG + Intergenic
1022704719 7:32791498-32791520 AGAATTGAAGAGCTGGAATTGGG - Intergenic
1026226733 7:68448541-68448563 CCAGTTTTAGAGCTGGAGTCAGG - Intergenic
1027750237 7:82134400-82134422 ATAATTTTAGGGCTGGATTAGGG + Intronic
1028318701 7:89435355-89435377 AGTTTTTAAGAGCTGGAGTAGGG - Intergenic
1029871673 7:103700429-103700451 AGAATTTTAGAACTGGCCTTAGG + Intronic
1030369272 7:108678662-108678684 TGAATTTTAGAGTTGAAATATGG + Intergenic
1030624349 7:111827853-111827875 AGAGTTTTAAAGCTGGATTGGGG + Intronic
1030928411 7:115487461-115487483 AACATTTTAGAGCAGGAGTCAGG + Intergenic
1031835292 7:126674161-126674183 AGTACAGTAGAGCTGGAGTATGG - Intronic
1032357411 7:131223611-131223633 AGCATTTTAGAGATGGAGAATGG - Intronic
1032678299 7:134154135-134154157 AAAAGTTTAGAGCTGGAATGCGG + Intronic
1033636002 7:143211696-143211718 AAATTTGTAGAACTGGAGTAGGG + Intergenic
1036276848 8:7360287-7360309 ATAATTTTGCAGCTGGAGCAAGG - Exonic
1036344481 8:7950056-7950078 ATAATTTTGCAGCTGGAGCAAGG + Exonic
1036839823 8:12110823-12110845 ATAATTTTGCAGCTGGAGCAAGG + Exonic
1036861613 8:12357067-12357089 ATAATTTTGCAGCTGGAGCAAGG + Intergenic
1039390311 8:37175308-37175330 ACAACTTTAGAGCTGTTGTATGG + Intergenic
1039791608 8:40880486-40880508 ATAATTTTATAGCTGGAAAATGG + Intronic
1040634462 8:49255951-49255973 AGATTTTTAGTGCTGGAGTGTGG - Intergenic
1042557001 8:70042038-70042060 AGAGTTTTGGAGCTGGATAATGG - Intergenic
1042797828 8:72684037-72684059 AGAAGGTAAGAGCTGGAGTGAGG + Intronic
1042832402 8:73045983-73046005 AGAATTTGAGATCTGGCGTGAGG + Exonic
1043292181 8:78616725-78616747 AGAATGTTGGAGCTGGATAATGG - Intergenic
1043912306 8:85877154-85877176 AGAATTTTAGAGCTGAAAAGAGG - Intergenic
1049137209 8:140914144-140914166 ATAATTTTAGAGTTGGATTTAGG - Intronic
1049899895 9:149428-149450 AGGCTTTTACAGATGGAGTAGGG - Intronic
1050628318 9:7532181-7532203 AGAAATTGAGAGATGGAATAGGG - Intergenic
1050687914 9:8192054-8192076 AGAATTTCAGAGCTTGAAGATGG + Intergenic
1052263186 9:26541190-26541212 AGAATTTCAGAGCTTGAAGATGG + Intergenic
1052384551 9:27808093-27808115 AGTTTTTAAGAGCTGGAGTAGGG + Intergenic
1053742944 9:41159719-41159741 AGGTTTTTACAGATGGAGTAGGG - Intronic
1053779371 9:41588109-41588131 AAAATTTTAAAGATAGAGTAAGG + Intergenic
1054348221 9:63989543-63989565 AGGTTTTTACAGATGGAGTAGGG - Intergenic
1054445947 9:65315902-65315924 AGGTTTTTACAGATGGAGTAGGG - Intergenic
1054484323 9:65705608-65705630 AGGTTTTTACAGATGGAGTAGGG + Intronic
1054670215 9:67782550-67782572 AAAATTTTAAAGATAGAGTAAGG - Intergenic
1054685399 9:68271581-68271603 AGGTTTTTACAGATGGAGTAGGG + Intronic
1056409231 9:86309388-86309410 AGAATTTTAGAGGAGGAGAAAGG + Intronic
1056457342 9:86773156-86773178 ACAATTTTAGAGTTGGAATATGG - Intergenic
1056892495 9:90508969-90508991 AGAATTTTAGAGCAGGGCTGGGG + Intergenic
1058044757 9:100345262-100345284 AGCATTATAGAGTTGTAGTAAGG - Intronic
1058556573 9:106175079-106175101 AGAATGATGGTGCTGGAGTATGG + Intergenic
1058999853 9:110337165-110337187 AGAAGTCAAGAGCTGGAGGAGGG - Intronic
1059122489 9:111654618-111654640 ATAATTTTAGAGCTGCAAAAGGG - Intronic
1059195035 9:112363181-112363203 ATAATTTTTGAGATGGAGTCAGG + Intergenic
1060731157 9:126037877-126037899 ATCATTTTACAGATGGAGTACGG - Intergenic
1060877222 9:127092074-127092096 AGAGATTAAGAGGTGGAGTAGGG - Intronic
1185871419 X:3667905-3667927 AGAATTTTGCAGGAGGAGTAGGG - Intronic
1188259934 X:28010584-28010606 ACAATTTTTGAGCTTGAGAAAGG - Intergenic
1188587451 X:31795082-31795104 AGAATTTCAGAGTGGGTGTAGGG - Intronic
1188869262 X:35353541-35353563 AGAATTTCAGAGCTCAAATATGG + Intergenic
1189011184 X:37047188-37047210 AGAGTTTTGGAGAAGGAGTAGGG - Intergenic
1189645016 X:43118790-43118812 AGAATTTGAGAGATTGACTAAGG + Intergenic
1190932642 X:54962377-54962399 GGAATTCTAGAGCAGGAGCAGGG - Intronic
1191676357 X:63795872-63795894 TGAATTTTAGAGCTGGAAAGTGG - Intergenic
1191959351 X:66682992-66683014 GTACTTATAGAGCTGGAGTAAGG + Intergenic
1191991833 X:67046309-67046331 AGGATTTAAGGGCTGGGGTATGG + Intergenic
1192797963 X:74440159-74440181 AGGGTTTTAGAGAGGGAGTAGGG + Intronic
1192873490 X:75206465-75206487 AGTTTTTAAGAGCTGGAGTAGGG + Intergenic
1192884942 X:75326904-75326926 AGAATTTGAGATCTGGCGTGAGG - Intergenic
1193453910 X:81705558-81705580 AGAATGATAAAGATGGAGTAAGG + Intergenic
1194259835 X:91680494-91680516 ACAATTTTAGAAGTGGGGTAGGG + Intergenic
1195000691 X:100640595-100640617 AGAATTTCAGAGAAGGAGAATGG - Intergenic
1195317195 X:103690764-103690786 AGAATGTTAGAGCAAGAGTTAGG - Intergenic
1195842237 X:109186818-109186840 AGAAGTTTATAGATGGAGAAGGG + Intergenic
1196192874 X:112812825-112812847 AGAATTTTGGAGATGGAGGCGGG - Intronic
1196731448 X:118944892-118944914 AGAATTCTAGAGATGGAGGGTGG + Intergenic
1197390844 X:125861867-125861889 AGAATTTTAGAGCTTAAAAATGG + Intergenic
1199033712 X:143028894-143028916 AGCTTTTAAAAGCTGGAGTAGGG + Intronic
1199093733 X:143717651-143717673 AGTTTTTAAAAGCTGGAGTAGGG - Intronic
1199776420 X:151015760-151015782 AGAATGTTAGTGGTGGAGTTGGG + Intergenic
1200375800 X:155778754-155778776 AACATTTTATAGCTGGAGAAAGG + Exonic
1200578535 Y:4919684-4919706 ACAATTTTAGAAGTGGGGTAGGG + Intergenic
1200792692 Y:7313787-7313809 AGAATTTTGCAGGAGGAGTAGGG + Intergenic