ID: 1097920080

View in Genome Browser
Species Human (GRCh38)
Location 12:65062542-65062564
Sequence GGTCCCTCCATTAAAGCAGG TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 134
Summary {0: 1, 1: 0, 2: 1, 3: 16, 4: 116}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1097920073_1097920080 20 Left 1097920073 12:65062499-65062521 CCTCTAGTCCTGGAGGGCAAATA 0: 1
1: 0
2: 2
3: 13
4: 74
Right 1097920080 12:65062542-65062564 GGTCCCTCCATTAAAGCAGGTGG 0: 1
1: 0
2: 1
3: 16
4: 116
1097920078_1097920080 -9 Left 1097920078 12:65062528-65062550 CCAGGGTAGAAACAGGTCCCTCC 0: 1
1: 0
2: 0
3: 11
4: 100
Right 1097920080 12:65062542-65062564 GGTCCCTCCATTAAAGCAGGTGG 0: 1
1: 0
2: 1
3: 16
4: 116
1097920072_1097920080 21 Left 1097920072 12:65062498-65062520 CCCTCTAGTCCTGGAGGGCAAAT 0: 1
1: 0
2: 1
3: 8
4: 107
Right 1097920080 12:65062542-65062564 GGTCCCTCCATTAAAGCAGGTGG 0: 1
1: 0
2: 1
3: 16
4: 116
1097920074_1097920080 12 Left 1097920074 12:65062507-65062529 CCTGGAGGGCAAATACATTTTCC 0: 1
1: 0
2: 1
3: 11
4: 183
Right 1097920080 12:65062542-65062564 GGTCCCTCCATTAAAGCAGGTGG 0: 1
1: 0
2: 1
3: 16
4: 116

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1097920080 Original CRISPR GGTCCCTCCATTAAAGCAGG TGG Exonic
900092669 1:927238-927260 GTTCCCTCCTTTCAAGCAGCTGG + Intronic
901617405 1:10552822-10552844 GGTGCCTCCATTCATGGAGGAGG + Intronic
902575935 1:17377593-17377615 AGTCCCTCCATCACAGTAGGCGG + Intronic
903883910 1:26530290-26530312 GCTTCCTCCATTAATGCAGACGG + Intronic
905912488 1:41663638-41663660 GTTCCCTCCATTAAAGCTGGGGG - Intronic
907584322 1:55603175-55603197 GGTCCAGCCAGTAAAGCAGGAGG + Intergenic
912174329 1:107139231-107139253 TGTCCCACAATTAAGGCAGGAGG - Intergenic
917894660 1:179475856-179475878 GGTCCCTCCCTTAACACATGAGG - Intronic
919212712 1:194509436-194509458 GGTCCCTCCCTTGAAACATGGGG - Intergenic
919539099 1:198827346-198827368 TGTCCTTCCAATAAGGCAGGGGG - Intergenic
920141793 1:203821063-203821085 GGTCCCTCCCTTAACACATGGGG - Intronic
923054700 1:230417275-230417297 GGTCCTTCCTTTAAGGAAGGAGG - Intronic
923065073 1:230510073-230510095 TGTCTCTCCATTAAACCAGGTGG - Intergenic
1064647410 10:17473695-17473717 GGTCCCTCCCTTTACACAGGAGG - Intergenic
1068683646 10:59846922-59846944 TGGCCCTGCATAAAAGCAGGTGG + Intronic
1070922079 10:80194351-80194373 GGTGCCTCCATAAACCCAGGTGG - Intronic
1074241527 10:111644075-111644097 GGTCCCTCAATTACAGCATTGGG + Intergenic
1079184785 11:18227204-18227226 GGTGCCCCCATCAAAGCAGAGGG + Intronic
1080604826 11:33856437-33856459 CGTGCCTTCATTAAAGCAGTTGG - Intergenic
1087501380 11:98958834-98958856 GGTCCCTCCATTGACACATGGGG + Intergenic
1088533485 11:110835937-110835959 GGTCCCTCCCATAATGCATGGGG - Intergenic
1089845902 11:121458060-121458082 TGTCCCTCCATTACAGTGGGTGG - Intronic
1091078207 11:132641027-132641049 GGTCTCTCCCTCTAAGCAGGTGG + Intronic
1091405516 12:206907-206929 CTTCCCTCCAATAAAGGAGGTGG + Intronic
1091582768 12:1799107-1799129 GGGCCCTCCATGACTGCAGGAGG - Intronic
1091708234 12:2715210-2715232 GGTCTCTCCCTTAAAACATGGGG - Intergenic
1097134506 12:56840467-56840489 GCTGCATCCTTTAAAGCAGGAGG - Intergenic
1097920080 12:65062542-65062564 GGTCCCTCCATTAAAGCAGGTGG + Exonic
1098281103 12:68863715-68863737 GGCCCTTCCACTAAAGCAGAAGG + Intronic
1101304718 12:103516692-103516714 GGTCCCTCCCTTAACACATGTGG + Intergenic
1109928542 13:69181927-69181949 GGTCCCTTCAGTAAAGCATGTGG + Intergenic
1110970490 13:81754785-81754807 GGTCCCTCCCTTGAAACATGGGG - Intergenic
1114781380 14:25541877-25541899 GGTTACTCCACTAAAGAAGGAGG + Intergenic
1114947170 14:27697865-27697887 GGTTCCTCCATCGAAGCAGCTGG - Intergenic
1115295984 14:31827501-31827523 TGTGCCTCAATGAAAGCAGGTGG + Intronic
1119125653 14:72123489-72123511 GGTCCCCCCATTAAAATATGGGG - Intronic
1119481524 14:74961150-74961172 GGTCCCTCCATTAAAGCTTAGGG - Intergenic
1120093995 14:80367061-80367083 GCTCTCACCCTTAAAGCAGGGGG - Intronic
1121349563 14:93162562-93162584 GTTTCTTCCTTTAAAGCAGGTGG + Intergenic
1121511811 14:94518086-94518108 GTTCCCTGCATTTAAGCAGGAGG + Intergenic
1121867725 14:97378420-97378442 GGTCCCTGCTTTCAAGCAGCTGG + Intergenic
1122825253 14:104367569-104367591 TGTCCCACCATTGAAGGAGGTGG - Intergenic
1125604961 15:40934983-40935005 GGAGCCCCCATTGAAGCAGGGGG - Exonic
1126960928 15:53993283-53993305 GGTCCCTGTATTAAAGCAAGGGG + Intergenic
1129667429 15:77587441-77587463 GGACCCTCCTTTGGAGCAGGTGG - Intergenic
1130719803 15:86375441-86375463 GGTCCCTCCCTCAACGCATGGGG + Intronic
1133148648 16:3809480-3809502 GGTACCTCCATTTAAAAAGGTGG - Intronic
1135680936 16:24456067-24456089 GGTCCCTCCATCAATACATGGGG - Intergenic
1136617360 16:31406644-31406666 GGTGCCTCCAATAAGGCAGCTGG + Intronic
1136990558 16:35148932-35148954 GGTCCCTTCCTTCGAGCAGGAGG - Intergenic
1137734983 16:50717076-50717098 TGTCCCTGCATTCAATCAGGAGG - Intronic
1138207882 16:55138264-55138286 GGTCCCTCCCTGAAGCCAGGAGG + Intergenic
1138504407 16:57470553-57470575 GGACCCTCCATTTATCCAGGTGG + Intronic
1139460719 16:67120015-67120037 GGTCCCTGCAGTAAAGCCTGGGG - Intronic
1141003617 16:80331450-80331472 GTTCTCTTCATTGAAGCAGGTGG - Intergenic
1143188545 17:5024618-5024640 GGTCCCCCAAATATAGCAGGAGG - Exonic
1147761026 17:42797474-42797496 GATCTCTCCCTTAAATCAGGTGG + Intronic
1149021574 17:51972549-51972571 GGTCCATCCATTAAAGGAAGTGG + Intronic
1164882069 19:31741106-31741128 CGTCGCTCCATTCACGCAGGGGG - Intergenic
1164905922 19:31967997-31968019 CATCCGTCAATTAAAGCAGGAGG - Intergenic
1164927366 19:32140692-32140714 GGTCCCTCCATCAAGGCCAGTGG - Intergenic
1167399144 19:49253330-49253352 GGTCCCTGCATTCATGCAGGTGG - Intergenic
1167953446 19:53045917-53045939 GGTCCCTCCAGTGAAACAGGAGG - Intronic
1168038283 19:53737892-53737914 GGTCCCTGGATGGAAGCAGGAGG + Intergenic
1168041950 19:53765848-53765870 GGTCCCTGGATGGAAGCAGGAGG + Intergenic
926709826 2:15870023-15870045 GATGCCCTCATTAAAGCAGGCGG + Intergenic
929525080 2:42693994-42694016 GGTCCTTCCTTTAAGGCAGCAGG + Intronic
929868971 2:45741880-45741902 GGTCTCTCCTTTAAAGAGGGCGG + Intronic
931038755 2:58273440-58273462 GGTCCCTCCCTTGACACAGGGGG - Intergenic
932744535 2:74322006-74322028 GGTCCGTGCAAGAAAGCAGGAGG - Intronic
937083830 2:119158040-119158062 GGTCCCTGGATGAAAGGAGGAGG + Exonic
937475786 2:122214141-122214163 GGACCCGCCATCAAAGCAGATGG - Intergenic
937612567 2:123879452-123879474 GCTGCTTCCATCAAAGCAGGGGG + Intergenic
940698352 2:157009380-157009402 GGTCCCTCCCTTAACACATGAGG - Intergenic
942403862 2:175631973-175631995 TGTCACTAAATTAAAGCAGGTGG + Intergenic
942796501 2:179826568-179826590 GCACTCTCCCTTAAAGCAGGGGG + Intronic
942991543 2:182208472-182208494 GGTCCCTCCCTCAAAACATGGGG + Intronic
945753589 2:213818704-213818726 GGTTCCTCCCTTAAAGCATGGGG - Intronic
947045526 2:225978529-225978551 GGTCCCTCCCATAAAACATGGGG + Intergenic
1169207597 20:3748998-3749020 GGGCCTTCCTTTAACGCAGGAGG - Intronic
1169522286 20:6386761-6386783 GGTCCCTCCCATAAAACAGGAGG - Intergenic
1170142737 20:13141542-13141564 GGTCCCTCAATGAAAACAAGAGG + Intronic
1174863199 20:54111768-54111790 GGTCCCTCCATCAACACATGGGG + Intergenic
1176154361 20:63610793-63610815 GCTCCCTCCATCAAGACAGGGGG + Intronic
1177108055 21:16985938-16985960 GGTCCCTAAATTATAGCATGAGG - Intergenic
1183010686 22:34944245-34944267 GGTTCCTCCACTAGAGAAGGAGG + Intergenic
950189741 3:10968409-10968431 TGTCTCTCCATTAAAGTAAGTGG - Intergenic
952610843 3:35206773-35206795 GGTCCCCACATGAGAGCAGGAGG - Intergenic
952787303 3:37167779-37167801 GGTCTCTCCATTAGCCCAGGAGG - Intronic
956045154 3:65188236-65188258 GGTCCCTTCATTACCGAAGGTGG - Intergenic
965183355 3:165433446-165433468 GGTCCCTCCATTGACACATGGGG - Intergenic
967615576 3:191561198-191561220 GGTCCCTCCCTTAACACATGGGG + Intergenic
974334762 4:60527798-60527820 ATTCCCTCCATTAAAGGAGGGGG + Intergenic
988836595 5:35038606-35038628 GGCCCTTCCATCAAAGCAGGAGG - Intronic
990783315 5:59391733-59391755 TGTCCCTCCATGATGGCAGGAGG + Intronic
990975333 5:61555680-61555702 GGTCCCTCCTTCAAAACATGGGG + Intergenic
993331697 5:86608061-86608083 GGTCCCTCCCTCAAAACATGAGG + Intergenic
996319452 5:122198121-122198143 GATCCCTCTATTGAAGCAAGAGG - Intergenic
997413154 5:133705434-133705456 GGTCCCACCATTCCAGAAGGAGG - Intergenic
997616845 5:135252366-135252388 GGTCCCTCCCTTAACACATGGGG - Intronic
997779906 5:136646223-136646245 CTCCCCTCCATTAAAGGAGGTGG + Intergenic
1000302027 5:159965222-159965244 TGGCCCTCCATTAAGGAAGGAGG + Intronic
1002284486 5:178153227-178153249 GGTCCCTGAATTAATGAAGGTGG + Intronic
1006191668 6:32213230-32213252 GGTACCCCCATTGAAGCACGGGG + Exonic
1006738739 6:36292826-36292848 TGTCCCAGCTTTAAAGCAGGAGG - Intronic
1014451477 6:121586781-121586803 GGTCACTCCAGTAAAACAGTTGG + Intergenic
1014668516 6:124270965-124270987 GGTCCCTCCCTTAACACATGCGG - Intronic
1016143850 6:140645708-140645730 GGTCCCTCCCTTGATGCATGGGG + Intergenic
1022980468 7:35600830-35600852 GGTCCTTCCTTTGAAGAAGGAGG - Intergenic
1029042143 7:97587348-97587370 GTTCCCTCCATTGCTGCAGGAGG + Intergenic
1032143306 7:129354240-129354262 GGATCTTCCATTAAAACAGGAGG + Intronic
1032420639 7:131776281-131776303 GGTCCCACCATTGCAGTAGGAGG + Intergenic
1033669867 7:143481578-143481600 GGTCCCTCTCTTAATGCATGGGG - Intergenic
1036216775 8:6887014-6887036 GGTCCCTGCTTTAAAGGAGGAGG + Intergenic
1036480213 8:9132847-9132869 GGTGCCACCAGGAAAGCAGGGGG + Intergenic
1037830366 8:22184869-22184891 AGTCCATCCACTAAAGCAGGCGG - Intronic
1038235989 8:25755661-25755683 GTTCCCTCCAATGAAGCAAGAGG - Intergenic
1044851295 8:96431547-96431569 GGTCCCTCCCTTGAAACATGGGG - Intergenic
1048598017 8:135887266-135887288 GGTCCATCAAATAAAGCATGTGG + Intergenic
1049753319 8:144296147-144296169 GGTCCCTGCAGTGAGGCAGGGGG + Intronic
1051376161 9:16404922-16404944 GGCTCCTCCACTAAGGCAGGAGG + Intergenic
1052821288 9:33139596-33139618 GGTCCCTGCAGTATGGCAGGAGG - Intronic
1056056412 9:82828658-82828680 GGGCCCACCACAAAAGCAGGTGG + Intergenic
1056524371 9:87429275-87429297 GCTCCCTCCAATAATGCAGGTGG - Intergenic
1057672625 9:97107531-97107553 GGTCACCCCAAAAAAGCAGGAGG + Intergenic
1057830557 9:98402964-98402986 GGTCCCTCTATTGGAGCAAGAGG + Intronic
1058876920 9:109252474-109252496 TTTCCCTCCACTAAAGCAGCTGG + Intronic
1059743016 9:117171547-117171569 GGTCCCTCCATTGACACATGGGG - Intronic
1192539579 X:71956896-71956918 GGTCCCCAGATTAAACCAGGAGG - Intergenic
1193657524 X:84216641-84216663 GCTGCTTCCATTACAGCAGGTGG + Intergenic
1195225072 X:102784467-102784489 GGTCCTTCCCTTCAAGCAGTGGG + Intergenic
1198493472 X:137166913-137166935 TGTCTCTCCATTAAAGCAAATGG + Intergenic
1200345358 X:155441803-155441825 GGTCCCTCCCGTAATGCATGGGG + Intergenic
1202030971 Y:20573678-20573700 GGTCCCTCCCTTAACACATGGGG + Intergenic