ID: 1097921308

View in Genome Browser
Species Human (GRCh38)
Location 12:65077503-65077525
Sequence TTATGAACTTAGTGTGGGCT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 244
Summary {0: 1, 1: 0, 2: 0, 3: 20, 4: 223}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1097921303_1097921308 9 Left 1097921303 12:65077471-65077493 CCTTTTTTTTCTTTAAAAAAGTC 0: 1
1: 2
2: 14
3: 256
4: 2082
Right 1097921308 12:65077503-65077525 TTATGAACTTAGTGTGGGCTGGG 0: 1
1: 0
2: 0
3: 20
4: 223
1097921302_1097921308 27 Left 1097921302 12:65077453-65077475 CCAGATGTGTTTCTTTCTCCTTT 0: 1
1: 1
2: 9
3: 96
4: 921
Right 1097921308 12:65077503-65077525 TTATGAACTTAGTGTGGGCTGGG 0: 1
1: 0
2: 0
3: 20
4: 223

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1097921308 Original CRISPR TTATGAACTTAGTGTGGGCT GGG Intronic
901117286 1:6857271-6857293 TGATGGATTGAGTGTGGGCTGGG + Intronic
903068861 1:20716873-20716895 TCTAGACCTTAGTGTGGGCTTGG + Intronic
903915572 1:26761752-26761774 TTGTGAAGTTAGAGTGGGCTTGG + Intronic
904332853 1:29775250-29775272 TTATAGACTGAGTGTGAGCTAGG - Intergenic
904865788 1:33577867-33577889 CTTTGACCTTAGTGAGGGCTGGG + Intronic
904932278 1:34098552-34098574 TTATGAAAATAGTGTGGGGGTGG + Intronic
906328286 1:44862890-44862912 TTATAAAATGAGTGTAGGCTGGG - Intronic
906653567 1:47531991-47532013 TTGTGAACTTAGTATGTGCCAGG - Intergenic
907143550 1:52211283-52211305 TTAAGAAGATAGTGTGGGATGGG - Intronic
910660396 1:89665707-89665729 TTATAAATTTAGTGTAGCCTAGG + Intronic
911621822 1:100074004-100074026 TTAAGAACTTACTGGGTGCTGGG + Intronic
911799570 1:102118814-102118836 TTATGAATTTAGTCTGGGTTTGG - Intergenic
917816907 1:178720566-178720588 TTATCATGTTAGAGTGGGCTGGG - Intergenic
918564782 1:185916208-185916230 TTAAGAACCTACTGTGAGCTAGG - Intronic
922413065 1:225394465-225394487 TCATGAACTTAGTTTAGGGTAGG - Intronic
922945086 1:229507409-229507431 TTATGAACATGGTGTGTGTTGGG + Intronic
1062807354 10:433381-433403 TTTTAAAATTAGTGTTGGCTGGG + Intronic
1065601362 10:27372203-27372225 TTATGAACTTATTGAGTGCATGG + Intergenic
1069111947 10:64458356-64458378 TTATGAACTGTGTGTGTGTTGGG - Intergenic
1070063273 10:73006964-73006986 TTATGAAGTTATTATGGGCCAGG - Intergenic
1072712997 10:97730045-97730067 ATAAGAAGTTAGTGGGGGCTGGG - Intergenic
1073070226 10:100788547-100788569 CTCTGAACTGAGTGAGGGCTGGG + Intronic
1073911598 10:108351340-108351362 TTAAGAACTGACTTTGGGCTGGG + Intergenic
1074736929 10:116445152-116445174 CTCTGCACTTACTGTGGGCTAGG + Intronic
1075593810 10:123712602-123712624 TTGAGTACTTACTGTGGGCTGGG + Intronic
1075617481 10:123902189-123902211 TTCTGAACTTGGAGTGGGCCAGG + Intronic
1076662578 10:132065259-132065281 TTATGGACTGCGTGTGGGATTGG + Intergenic
1077639467 11:3868483-3868505 TTAATAACTTGGTGTGGGGTGGG + Intronic
1077702999 11:4458964-4458986 TTATTAACTCTTTGTGGGCTAGG - Intergenic
1079112332 11:17611972-17611994 CGATGCACTTAGTGTGAGCTCGG - Intronic
1079220698 11:18558497-18558519 TTATTAACTTTGGCTGGGCTTGG + Intronic
1079584237 11:22105969-22105991 TTAAGTACTTACTGTGTGCTGGG + Intergenic
1080630595 11:34071271-34071293 TTATGTACTTAGGCTGGGCGCGG + Intronic
1083372970 11:62196195-62196217 TTAGGGACTTAGTCTGAGCTGGG - Intergenic
1085696111 11:78706201-78706223 ATAAGAACTTAGTATGGGCCAGG - Intronic
1086914429 11:92512668-92512690 TAAACAACTTAGTGTTGGCTTGG + Intronic
1087570279 11:99918779-99918801 TAAGGAAGTTAGTGTGGCCTTGG - Intronic
1087827535 11:102783122-102783144 TTATAAATTTAGTGTAGTCTAGG + Intergenic
1089117383 11:116106966-116106988 TTAAGAACTTACTGTATGCTAGG - Intergenic
1089226059 11:116923209-116923231 TTAAGAAGTTAGTCTTGGCTGGG - Intronic
1090732067 11:129580568-129580590 TTATGAGGCCAGTGTGGGCTGGG + Intergenic
1091103861 11:132900164-132900186 TTATGAACTTGCTGTGGGCATGG - Intronic
1092817997 12:12327832-12327854 TTATGAACTTAGTGTAAACCAGG + Exonic
1094398996 12:30040694-30040716 TTGTGAGCCTACTGTGGGCTAGG - Intergenic
1097921308 12:65077503-65077525 TTATGAACTTAGTGTGGGCTGGG + Intronic
1098519821 12:71422367-71422389 TTGAGAACTTACTCTGGGCTAGG - Intronic
1099987951 12:89690030-89690052 TTATGAACTTTCTGTATGCTAGG + Intronic
1100976313 12:100125865-100125887 TTATGATCTTACTATGTGCTGGG + Intronic
1101177549 12:102170676-102170698 CTATAAATTTAGTGTGGCCTAGG - Intronic
1101228302 12:102712287-102712309 TGATGGATTTAGTGTGGGCAAGG + Intergenic
1101296730 12:103431645-103431667 TTAAGCACTTATTGTGGGCCAGG - Intronic
1101354172 12:103961369-103961391 TAATAAACTTAGTGTAGCCTAGG + Intronic
1101459476 12:104875494-104875516 TTATAAAATGAGTCTGGGCTGGG + Intronic
1102062698 12:109945842-109945864 TTCTTAACTTAGGGTGGGCATGG + Intronic
1102750767 12:115291976-115291998 TTAAGAACTTACTATGTGCTAGG - Intergenic
1103114095 12:118309977-118309999 TTAAGACCTTAATGTTGGCTGGG + Intronic
1103677762 12:122670030-122670052 TGATGAACTTAGTGTGTGCCAGG - Intergenic
1104024351 12:125015060-125015082 TTATTAACCAAGGGTGGGCTGGG - Intronic
1108081261 13:46738855-46738877 TTATGAACTTAGAGAAAGCTAGG - Intronic
1110449074 13:75620451-75620473 TTAGGAACCTAGGGTGGGGTAGG + Intronic
1111664432 13:91249253-91249275 TTAAAAACATAGTGTAGGCTGGG - Intergenic
1113279622 13:108775004-108775026 TTATGAAGTAAGTTTAGGCTTGG + Intronic
1113518450 13:110920896-110920918 TTAAGGACTTAATATGGGCTGGG - Intergenic
1115380465 14:32731965-32731987 TTAAAAACTCTGTGTGGGCTTGG - Intronic
1115488386 14:33935208-33935230 TTAAGCACTTAGTGTGTGCCAGG - Intronic
1116513223 14:45772331-45772353 TTATTCACTTAGTTTTGGCTGGG - Intergenic
1117335583 14:54754766-54754788 TTATGAACTAACTATGGGCGGGG - Intronic
1118974695 14:70666552-70666574 TAAAGTACTTAATGTGGGCTTGG - Intronic
1119893320 14:78199416-78199438 TTATGCACTTACTATGTGCTGGG + Intergenic
1126624481 15:50673093-50673115 TTATAAATTTAGTGTAGGCTAGG + Intronic
1127217857 15:56843612-56843634 TTTTAAACTCAGTTTGGGCTGGG - Intronic
1127525437 15:59787845-59787867 TTCTGAAATTATGGTGGGCTAGG + Intergenic
1129410146 15:75346273-75346295 TTAAGAAGTTACTGTTGGCTGGG + Intergenic
1129436852 15:75548542-75548564 TTATGATATTAGTCTGGGCGTGG - Intronic
1129882046 15:79013411-79013433 TTATGAACCTACTGTGTGCCAGG - Intronic
1130101544 15:80898380-80898402 TTAAGCACTTACTGTGTGCTAGG - Intronic
1133590844 16:7241550-7241572 TTATGAATTTTGTTTGGGTTGGG + Intronic
1133689569 16:8200182-8200204 TTCTGAGCTTCATGTGGGCTGGG - Intergenic
1134647442 16:15881315-15881337 TTATGAAAATAGTGGGGACTTGG - Intronic
1140519349 16:75567944-75567966 TGATGAACAGAGTGTGGGCAAGG - Intronic
1143853922 17:9834483-9834505 TTCTGAACTTAGTGTATGCTTGG - Intronic
1143872655 17:9968427-9968449 TGATGGACTTAGAGTGAGCTGGG - Intronic
1145992648 17:29088347-29088369 TTAAGAACTTATTTTCGGCTGGG - Intronic
1146766143 17:35523638-35523660 TTATAAACTTATTTTAGGCTGGG + Intronic
1148995668 17:51707230-51707252 TTATAAGGTTAGTGTGGGCCAGG + Intronic
1149510025 17:57232915-57232937 TTAAGAAATTATTGTGGGCTAGG + Intergenic
1153858744 18:9176584-9176606 TTAAGAACCGAGTTTGGGCTGGG - Intronic
1158915778 18:62127575-62127597 TTATGTACTTAGTGTATGCAAGG - Intronic
1164261718 19:23573575-23573597 ATATGAACATAGTGTGGCCATGG + Intronic
1164700663 19:30281770-30281792 GTATGAACTAAGTGGGGGTTGGG - Intronic
1167452386 19:49579396-49579418 ATATCAACTTAGTTTTGGCTTGG - Intronic
1168408391 19:56122448-56122470 TTGTGAACTTACTATGGGCCAGG - Intergenic
927253216 2:21017236-21017258 TTATGAGCCTATTGTGTGCTGGG + Intronic
927733154 2:25493790-25493812 TTATAAACTTCTTGTGGGCAGGG - Intronic
928194991 2:29209243-29209265 TTAAGAACTTGGTGTTGGCTGGG + Intronic
930180003 2:48345893-48345915 TTAGGTGATTAGTGTGGGCTAGG + Intronic
930197053 2:48520609-48520631 TTTTGAACTTAGTTTGAGTTAGG + Intergenic
931643200 2:64399437-64399459 TTAGGAACTGGGTGTGGGCTTGG + Intergenic
932027837 2:68154045-68154067 TTAAGAACTTACACTGGGCTGGG - Intronic
932988772 2:76761028-76761050 TTCTAAACATAGTGTGGCCTGGG - Intronic
935541363 2:104352929-104352951 TTAAGAACATAGTCTTGGCTGGG - Intergenic
936167260 2:110132357-110132379 AAATGAAGTAAGTGTGGGCTGGG + Intronic
936466996 2:112762753-112762775 TAAAGAACTTAGTGTAGGCCTGG - Intronic
936686332 2:114830584-114830606 TTATGAACCTACTGTGTGCTAGG - Intronic
938604032 2:132873910-132873932 TTAGGCACCTAGTGTGGGCCGGG + Intronic
938620191 2:133043712-133043734 TTACGTACTTAGTCTGAGCTAGG - Intronic
939379538 2:141416411-141416433 TTAAGAATTTACTGTGGGCTAGG - Intronic
940230444 2:151445832-151445854 TTTAGAAATTATTGTGGGCTGGG - Intronic
940585696 2:155646033-155646055 TTATGAGCTTCATGTGGGCAGGG + Intergenic
940659049 2:156523837-156523859 TTAAGAAATTATTGTTGGCTGGG - Intronic
941304328 2:163842954-163842976 TTTTGAGCATAGTGTGGGGTGGG + Intergenic
941889606 2:170565446-170565468 TTAGGCACTTACTGTGTGCTAGG - Intronic
942493483 2:176513342-176513364 TTATGAATTTAGTGTATCCTGGG - Intergenic
942799148 2:179856847-179856869 TTTTGAAAGTACTGTGGGCTTGG - Intronic
944469212 2:200035153-200035175 TTAAGAACTTACTATGTGCTAGG + Intergenic
945746121 2:213721045-213721067 TTAAGAACTTACTTGGGGCTGGG - Intronic
947264912 2:228267735-228267757 TCATGAACTTATTGAGGGATGGG + Intergenic
947847852 2:233259929-233259951 CTGTGACCGTAGTGTGGGCTGGG + Intronic
949017027 2:241719320-241719342 TCATGCACTGAGTGAGGGCTGGG - Intronic
1172011445 20:31848342-31848364 CTATGGGCTTAGTGTGGGCAGGG + Intronic
1173004690 20:39130880-39130902 TTAGGAACTCAGTGCGGGGTGGG + Intergenic
1174012618 20:47462761-47462783 TTAGGAGCTTAATGTGGCCTTGG - Intergenic
1175245862 20:57581577-57581599 TGATGAGCTTGCTGTGGGCTAGG + Intergenic
1177439656 21:21105028-21105050 TAATGAACTTGCTGTTGGCTAGG - Intronic
1178754413 21:35334926-35334948 TTGAGTACTTAGTGTGTGCTGGG + Intronic
1179302380 21:40124183-40124205 TTACCAACTTACTGTGGGATAGG + Exonic
1181877693 22:25952856-25952878 TTTTGCACCCAGTGTGGGCTAGG + Intronic
1184460981 22:44637884-44637906 TTAAAAACTTACTGTAGGCTGGG + Intergenic
1184622521 22:45692675-45692697 TTTTGCACTTTGTGTGGACTGGG + Intronic
1184630879 22:45778288-45778310 TTATGAACTTACTATGTGCCAGG + Intronic
949443966 3:4113790-4113812 TCATGACCTTAATGTGGGGTAGG + Intronic
951234182 3:20215446-20215468 TTATGACATTAGTCTGGGCAAGG + Intergenic
951343525 3:21517912-21517934 TTAACATCATAGTGTGGGCTTGG + Intronic
951736687 3:25873988-25874010 TTATTACCTTACTCTGGGCTTGG - Intergenic
952471362 3:33656134-33656156 TTATGAATTGAGGGTGGGTTTGG - Intronic
953507826 3:43503710-43503732 CTATAAACTTAGGCTGGGCTTGG - Intronic
953901021 3:46844415-46844437 TTGAGCACTTAGTGTGTGCTAGG - Intergenic
960624325 3:119665667-119665689 TCAAGAACTTAGTCTTGGCTGGG - Intronic
960727025 3:120680928-120680950 AGATGAACTGAGTCTGGGCTAGG - Intronic
962889891 3:139662434-139662456 TTATGAGCTTACTATGGGCCAGG - Intronic
963149266 3:142027516-142027538 TAAGGAACTTAGTGTGGGTGGGG - Intronic
963413019 3:144955780-144955802 TCCTGAACTCAGTGAGGGCTGGG - Intergenic
965983474 3:174722405-174722427 TTAATAACGTAGGGTGGGCTGGG + Intronic
966499089 3:180617814-180617836 TTATGAATTTACTGTAGCCTAGG + Intronic
968347641 3:198024174-198024196 TTAAGAACCTAGTGTGAGTTTGG + Intronic
972675367 4:41255310-41255332 TTAAGAACCTACTGTGTGCTGGG - Intergenic
974827244 4:67147310-67147332 TGAAGAAGTTGGTGTGGGCTAGG - Intergenic
976416445 4:84781544-84781566 ATATGAAGGTATTGTGGGCTGGG - Intronic
976834287 4:89353015-89353037 TTATAAATTTAGTGTAGCCTAGG - Intergenic
977607072 4:98994660-98994682 TTAAGAACTTTGTTTTGGCTAGG - Intergenic
978943016 4:114460145-114460167 TTAAGAACTAAGTGTGGTCATGG - Intergenic
980873531 4:138637232-138637254 TTATGAAAACAGTCTGGGCTTGG - Intergenic
981329979 4:143497254-143497276 TTATGAAGTTATAGTGGCCTCGG + Intergenic
981341286 4:143624677-143624699 CTATGAACTTTCTGGGGGCTGGG - Intronic
982121572 4:152148316-152148338 TTATGAACTTTTCCTGGGCTGGG - Intergenic
982638795 4:157930675-157930697 TTAAGTACTTATTGTGTGCTAGG + Intergenic
983217786 4:165018169-165018191 TAATAAATTTAGGGTGGGCTGGG - Intergenic
991142518 5:63261201-63261223 TTATAAATTTAGTGTAGCCTAGG + Intergenic
991146993 5:63318670-63318692 TTATGAACTAAGAGTGAGTTAGG - Intergenic
991536811 5:67678204-67678226 TTATGTACTTATTGTGTGCTAGG + Intergenic
991583034 5:68176279-68176301 TTATGAACTTAATGTAGTCTAGG + Intergenic
994268153 5:97742434-97742456 CTATGAAATTACTTTGGGCTTGG + Intergenic
994571354 5:101517999-101518021 CTTTGATCTTAGTGTGGGATTGG - Intergenic
995984808 5:118157209-118157231 TTATGAACAGGGTTTGGGCTTGG + Intergenic
998217899 5:140251229-140251251 TTATAAATATAATGTGGGCTGGG - Intronic
998735297 5:145131418-145131440 TCATGAATTTCGTGTGGGCAAGG + Intergenic
998999711 5:147907131-147907153 ATAAGAACTAAGTGTTGGCTGGG + Intergenic
999641336 5:153676243-153676265 TTGTGAACTTGGAGTGTGCTAGG + Intronic
1000586532 5:163106114-163106136 TTGTGAGCTTTGTGAGGGCTAGG + Intergenic
1002049333 5:176561131-176561153 TTATGTACTTACTGTGAGCTAGG + Intronic
1003481409 6:6536933-6536955 TTAAAAATGTAGTGTGGGCTGGG - Intergenic
1003863482 6:10342929-10342951 TTATGAAAATAGTGTGGGCATGG - Intergenic
1004196082 6:13506608-13506630 TTGAGAACCTAGTATGGGCTGGG + Intergenic
1004774275 6:18824865-18824887 TTATTAAATAAGTGTAGGCTGGG - Intergenic
1004987373 6:21097974-21097996 TTATGCACTTACTGTGTGCCTGG + Intronic
1010242927 6:73633525-73633547 TTAAAAACTTAGTCTTGGCTGGG - Intronic
1011381834 6:86750307-86750329 TTATAAACTCAGTGGGGGCAGGG + Intergenic
1011879641 6:92009100-92009122 TTAAGCACTTACTATGGGCTAGG + Intergenic
1012037581 6:94162660-94162682 TTAAGAACTTATTGTAGGCCAGG + Intergenic
1012802300 6:103846678-103846700 TAAAAAACTTAGTGTGGGCCGGG + Intergenic
1012841805 6:104338149-104338171 TAATGAGCTTACTGTGTGCTAGG - Intergenic
1016109766 6:140208113-140208135 AGAAGAACTTAGTGTGTGCTAGG + Intergenic
1019477859 7:1252621-1252643 TTCTGAACTAAAGGTGGGCTTGG - Intergenic
1020766071 7:12322954-12322976 TTTTGAACTTAGTGGGCCCTCGG - Intergenic
1020916014 7:14193619-14193641 TTATGACGTTAGGGTGGGCAAGG + Intronic
1021449053 7:20764649-20764671 TTATGAAACTAATGTGGACTAGG - Intronic
1021875858 7:25048468-25048490 TTAAGAACTTACTGTGGGCCAGG + Intergenic
1022449563 7:30502499-30502521 TTAAGTACTTACTGTGTGCTAGG - Intronic
1024101735 7:46039212-46039234 ATCTGAACATAGTGTGGCCTTGG + Intergenic
1025073613 7:55923367-55923389 TTGTGAATATAGTTTGGGCTGGG + Intronic
1027780704 7:82516274-82516296 GTATGAACTTCCTGAGGGCTGGG + Intergenic
1030116681 7:106066989-106067011 TTAAGAACTTGCTGTGGGCCAGG - Intergenic
1030137494 7:106269735-106269757 TTCTGTACTTAATGTGGACTTGG + Intronic
1031355713 7:120784186-120784208 TAAAGAACTTAATTTGGGCTGGG + Intergenic
1031656306 7:124360438-124360460 CTATAAAATAAGTGTGGGCTGGG + Intergenic
1032248764 7:130234880-130234902 ATAACAACTTAGTGTAGGCTGGG - Intergenic
1033867968 7:145715251-145715273 TTAAGAATTGGGTGTGGGCTAGG - Intergenic
1034830955 7:154306980-154307002 TTATGAAGTAAGTGTGCGATGGG + Intronic
1038531210 8:28319266-28319288 TTATGAACTCATAGTGGGGTCGG + Intronic
1040449562 8:47530699-47530721 TTATAAATTTAGTGTAGCCTAGG - Intronic
1041141699 8:54827185-54827207 TTATAAATCTAGTGTAGGCTTGG - Intergenic
1041317178 8:56575928-56575950 TAAAGAACTTAGTGTAAGCTAGG - Intergenic
1042251605 8:66761478-66761500 TTATAAAAATAGTTTGGGCTGGG + Intronic
1042568423 8:70136081-70136103 TTGTGAACTTAGGCTGGGCGCGG + Intronic
1043320517 8:78979924-78979946 TTAAGAACTTATTATGTGCTAGG + Intergenic
1043912133 8:85875411-85875433 TGATGATATTAGTGTGGCCTTGG - Intergenic
1043976863 8:86594035-86594057 GTATTAGCTTACTGTGGGCTTGG - Intronic
1044669383 8:94663642-94663664 TAATGAATTGAGTGTGTGCTTGG + Intronic
1046390324 8:113563813-113563835 TTATGGAGTTTGTGTAGGCTTGG + Intergenic
1046563777 8:115872339-115872361 TGATTAACTTACTGTGGGCTTGG + Intergenic
1047599015 8:126407979-126408001 TTATCAAATCAGTGTGGGATTGG + Intergenic
1048680900 8:136840461-136840483 TTCTGAAGTTTGTGTGGTCTAGG + Intergenic
1049033220 8:140052484-140052506 TTAAAAACTTAGTCAGGGCTGGG + Intronic
1050419368 9:5447293-5447315 TTATGAACTTATTGTGGGTGGGG + Intergenic
1051165903 9:14261708-14261730 TAATGAACTTAAAGTGGCCTGGG + Intronic
1052182247 9:25543914-25543936 TTATGTACTTGGTATGGGCTAGG + Intergenic
1052646293 9:31238494-31238516 TTAAGAACTTACTCTGGGTTAGG - Intergenic
1052823455 9:33158187-33158209 TTCTGAAATTTGAGTGGGCTGGG - Intronic
1053683694 9:40502150-40502172 TTATCAACTTAGGGAGGACTTGG - Intergenic
1053933674 9:43130463-43130485 TTATCAACTTAGGGAGGACTTGG - Intergenic
1054280022 9:63122776-63122798 TTATCAACTTAGGGAGGACTTGG + Intergenic
1054296795 9:63337642-63337664 TTATCAACTTAGGGAGGACTTGG - Intergenic
1054394812 9:64642148-64642170 TTATCAACTTAGGGAGGACTTGG - Intergenic
1054429460 9:65147348-65147370 TTATCAACTTAGGGAGGACTTGG - Intergenic
1054500922 9:65874183-65874205 TTATCAACTTAGGGAGGACTTGG + Intergenic
1058021369 9:100093346-100093368 TTAAGAACTCTGTGTGGGCTGGG + Intronic
1060956036 9:127640640-127640662 TAATGAACTTGCTGGGGGCTTGG - Intronic
1062450455 9:136613670-136613692 TTTTCAACTTTGTGTGGGGTTGG + Intergenic
1185761583 X:2692819-2692841 TTTTGCACCTACTGTGGGCTTGG + Intronic
1186300045 X:8190665-8190687 CTATGAACTCAGTGTGACCTTGG + Intergenic
1187308808 X:18121424-18121446 TTGTGCACTTACTGTGTGCTAGG - Intergenic
1187611702 X:20950564-20950586 TTTTTAACTTTGAGTGGGCTGGG - Intergenic
1188680735 X:33000967-33000989 TTATAAATTTACTGTGCGCTAGG + Intronic
1188830551 X:34891462-34891484 TTTTGAACTTAGGCTGGCCTTGG - Intergenic
1189101884 X:38199109-38199131 TTAAAACTTTAGTGTGGGCTGGG + Intronic
1189202281 X:39206886-39206908 TTATGAACTTAGGAGGGGATTGG + Intergenic
1193929845 X:87540246-87540268 TAATTAACTTAGTGTAGCCTAGG - Intronic
1195326051 X:103759442-103759464 TTAAGTACTTACTGTGTGCTAGG - Intergenic
1196092772 X:111764192-111764214 TTATGAAGTTAGTATGAGTTTGG + Intergenic
1197287419 X:124612530-124612552 TTATCAACATAGTTTGGGATGGG - Intronic
1197766303 X:130061240-130061262 TTAAGAACCTACTGTGTGCTAGG + Intergenic
1199023256 X:142907774-142907796 TTATGATCTTGATGTGGACTAGG - Intergenic
1200279526 X:154764397-154764419 TTATAAATTTAGTGTAGCCTAGG - Intronic
1202237356 Y:22726837-22726859 ATATAAACTTATTTTGGGCTGGG - Intergenic