ID: 1097923216

View in Genome Browser
Species Human (GRCh38)
Location 12:65099573-65099595
Sequence CTGAGTAAAGACTCTGTTTC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 256
Summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 244}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1097923216_1097923220 25 Left 1097923216 12:65099573-65099595 CCTGAAACAGAGTCTTTACTCAG 0: 1
1: 0
2: 0
3: 11
4: 244
Right 1097923220 12:65099621-65099643 AGCCAGCTCTTTGGCTGCCTGGG 0: 1
1: 0
2: 0
3: 22
4: 251
1097923216_1097923218 16 Left 1097923216 12:65099573-65099595 CCTGAAACAGAGTCTTTACTCAG 0: 1
1: 0
2: 0
3: 11
4: 244
Right 1097923218 12:65099612-65099634 TTCAAGTGAAGCCAGCTCTTTGG 0: 1
1: 0
2: 0
3: 8
4: 160
1097923216_1097923219 24 Left 1097923216 12:65099573-65099595 CCTGAAACAGAGTCTTTACTCAG 0: 1
1: 0
2: 0
3: 11
4: 244
Right 1097923219 12:65099620-65099642 AAGCCAGCTCTTTGGCTGCCTGG 0: 1
1: 0
2: 3
3: 23
4: 244
1097923216_1097923217 -7 Left 1097923216 12:65099573-65099595 CCTGAAACAGAGTCTTTACTCAG 0: 1
1: 0
2: 0
3: 11
4: 244
Right 1097923217 12:65099589-65099611 TACTCAGATATCAAGACTGCTGG 0: 1
1: 0
2: 2
3: 13
4: 131

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1097923216 Original CRISPR CTGAGTAAAGACTCTGTTTC AGG (reversed) Intronic
901589631 1:10329714-10329736 CAGAGCAAAGACTCTGTCTAGGG + Intronic
905924812 1:41741867-41741889 CTGAGTACCTACTATGTTTCTGG - Intronic
908853366 1:68395906-68395928 CTCAGTAGAGACTCTGTGTGGGG + Intergenic
909036953 1:70604339-70604361 GTGAGTGAAGCCTCTGATTCTGG + Intergenic
909352066 1:74665628-74665650 ATGAGAGAAGAGTCTGTTTCAGG + Intronic
909965514 1:81904849-81904871 GTGAGCCAAGACTCTGTCTCGGG + Intronic
910072555 1:83235855-83235877 CTGAGTTAAGTCTCTAATTCTGG + Intergenic
910987040 1:93015225-93015247 CAGAGTAAAAACCATGTTTCCGG - Intergenic
911788320 1:101979722-101979744 CCCAGTAGAGACTCTGTGTCGGG - Intronic
913199355 1:116483647-116483669 CTGAGTGAAGACTCTGAGGCAGG + Intergenic
913402243 1:118449066-118449088 CCCAGTAGAGACTCTGTTTGGGG - Intergenic
917128673 1:171716536-171716558 CTTAGGAAAGACTCTTTTTGAGG - Intronic
919104051 1:193127254-193127276 TAGAGCAAAGACTCTGTCTCAGG + Intronic
919468938 1:197954803-197954825 TTGAGTAATAACTCTGTCTCTGG + Intergenic
920736833 1:208540475-208540497 CTGAATGAAGACTCTTTTTTAGG - Intergenic
924593442 1:245424938-245424960 TCGAGAAAAGACACTGTTTCTGG + Intronic
924683797 1:246266492-246266514 CTGAGTAACTACTCTGTACCAGG - Intronic
1064491711 10:15864769-15864791 ATGAATAAATACTCTCTTTCAGG + Intergenic
1064718464 10:18202622-18202644 CTGAGAAATTACTCTGTTCCAGG - Intronic
1064824882 10:19387154-19387176 CTGCTTAAAGATTTTGTTTCAGG + Intronic
1064940854 10:20733968-20733990 CTGAGCAACAAATCTGTTTCTGG + Intergenic
1064980111 10:21157971-21157993 GTGAGGGAAGACTCTGTTTCAGG - Intronic
1066263602 10:33753207-33753229 CTGAGATAAGAATCTATTTCAGG - Intergenic
1066317868 10:34266819-34266841 CTCAGAACAGCCTCTGTTTCTGG - Intronic
1066695837 10:38076870-38076892 CCCAGTACAGACTCTGTTTGGGG + Intergenic
1067149117 10:43715158-43715180 CACAGAAAAAACTCTGTTTCAGG + Intergenic
1067454663 10:46410485-46410507 CTGAGTACAAATTCTGCTTCTGG - Intergenic
1067467622 10:46512874-46512896 CTCAGTAAACCCTTTGTTTCTGG + Intergenic
1067619564 10:47871731-47871753 CTCAGTAAACCCTTTGTTTCTGG - Intergenic
1067632541 10:47974154-47974176 CTGAGTACAAATTCTGCTTCTGG + Intergenic
1068203359 10:53813816-53813838 CTGACTAAAGAATATGTTACAGG + Intronic
1068958058 10:62838520-62838542 CTGAGTGATTACTATGTTTCAGG + Intronic
1069060300 10:63887852-63887874 AAGTGTACAGACTCTGTTTCTGG + Intergenic
1069173256 10:65259100-65259122 CAGAATTAAGTCTCTGTTTCAGG - Intergenic
1070489050 10:76958727-76958749 CTGAGGGAAGGATCTGTTTCAGG - Intronic
1070884823 10:79882408-79882430 CAGAGGAAAAACTATGTTTCTGG + Intergenic
1071781289 10:88848242-88848264 TTGAGTACATACTATGTTTCAGG - Intronic
1072865173 10:99051806-99051828 AGGAGTAAAGACTATGTCTCAGG + Intronic
1073942714 10:108716193-108716215 GTGAGTAAAGGATCTGTTTCAGG + Intergenic
1074224270 10:111468206-111468228 CTAATTAAATTCTCTGTTTCTGG + Intergenic
1075279075 10:121123279-121123301 CTGAGTAAAGCCGCATTTTCTGG - Intergenic
1077962107 11:7086707-7086729 CAGAGCAGAGACCCTGTTTCAGG + Intergenic
1080113593 11:28597281-28597303 CTGAGTAATTTCTCTGTTTTAGG + Intergenic
1080994936 11:37588188-37588210 CTGAGAAAAGAATGTGTTCCTGG + Intergenic
1082720883 11:56674952-56674974 CTGAGTATAGACTTTGTTCATGG + Intergenic
1084749580 11:71195584-71195606 CTATGAAAAAACTCTGTTTCGGG - Intronic
1085776647 11:79372527-79372549 CTGAGCAAAGGATCAGTTTCTGG - Intronic
1086472100 11:87124989-87125011 CTGAGTAATTGCTCTGTGTCTGG + Intronic
1086495250 11:87397613-87397635 CTGAGTATAAACTGTCTTTCTGG + Intergenic
1090974293 11:131668689-131668711 CTGACTAATGAGTCTATTTCTGG + Intronic
1093117143 12:15225128-15225150 TTTACTAAAGACTCTGTCTCAGG + Intronic
1094028674 12:25986098-25986120 CTGAGGACAGACTCTGCTACAGG - Intronic
1094780325 12:33784663-33784685 CTGAGGTAATACTCTGTATCTGG + Intergenic
1096269353 12:50152028-50152050 CTGAGGAAACACCATGTTTCAGG - Intronic
1097923216 12:65099573-65099595 CTGAGTAAAGACTCTGTTTCAGG - Intronic
1099415320 12:82378114-82378136 CTGAGTAAACACTGCATTTCAGG + Intronic
1101575560 12:105993717-105993739 CTGAGCAAAGATGCTGGTTCGGG + Intergenic
1104370520 12:128220141-128220163 CAGAGTGAACTCTCTGTTTCTGG + Intergenic
1106928608 13:34639229-34639251 TTGAGGAACTACTCTGTTTCAGG - Intergenic
1107763167 13:43703425-43703447 CTGAGTGAAGACTGCTTTTCGGG + Intronic
1109054628 13:57532016-57532038 AGCAGTAAAGACTCTGTTTTGGG - Intergenic
1109652170 13:65342720-65342742 CTGAGGAAATACTTTTTTTCTGG + Intergenic
1109930574 13:69211564-69211586 CTGCCAAAAGACTCAGTTTCAGG - Intergenic
1111834750 13:93374439-93374461 CAGGGTAAAGACTCTGTTGCAGG - Intronic
1112593696 13:100788429-100788451 ATGAGAAAAGAATCTGTTCCAGG - Intergenic
1113340679 13:109422355-109422377 CTGAGGGAAGGATCTGTTTCGGG + Intergenic
1114239790 14:20856040-20856062 CTGAGCATAGACTCTGTGCCAGG + Intergenic
1115461914 14:33670771-33670793 CTGAGGGAGGACTCTGTTTGTGG - Intronic
1117200926 14:53389209-53389231 CTTAGAAAAGAAGCTGTTTCTGG - Intergenic
1118019733 14:61698073-61698095 GAGAGTAATGATTCTGTTTCAGG + Intronic
1122111139 14:99503346-99503368 CTGAGTAAACACTAAGTTTCAGG - Exonic
1123202530 14:106680094-106680116 CGCAGTTAGGACTCTGTTTCAGG + Intergenic
1123720943 15:23061533-23061555 CTGAGTAGAGTCTCTCTTTGGGG + Intergenic
1123985972 15:25646404-25646426 CTGAATAAATATTCTGTTTATGG - Intergenic
1124883006 15:33659515-33659537 CTGAGTGGAGACACTGTTTAAGG + Intronic
1128643823 15:69360371-69360393 CTCAGTAATGACTTTGCTTCTGG - Intronic
1131984477 15:98028075-98028097 CTGAGTACATACTCTGTGCCAGG + Intergenic
1132026052 15:98405321-98405343 CTGAATAGAATCTCTGTTTCTGG + Intergenic
1133533554 16:6677558-6677580 CTGAGTCATTACTCTGCTTCCGG - Intronic
1135965294 16:27030265-27030287 TTGATTTAAGCCTCTGTTTCAGG + Intergenic
1137700395 16:50493858-50493880 TTGGGGAAAGACTCTTTTTCTGG - Intergenic
1138183060 16:54956029-54956051 CTGAGTACTGACTCTGTGCCAGG - Intergenic
1138749366 16:59400291-59400313 CTGAGTACATACTGTGTTCCAGG + Intergenic
1139125355 16:64071424-64071446 CTGAGAAATGACACTGTGTCTGG + Intergenic
1148022686 17:44563730-44563752 CTGAGTGAATAATCTGGTTCCGG - Intergenic
1149330342 17:55574872-55574894 TTGAGTATAGACTCTGCATCAGG + Intergenic
1149459711 17:56818305-56818327 CTAAGTATAGATTTTGTTTCTGG - Intronic
1150831774 17:68527879-68527901 CTTAGTAAAGTCTCTATTTTAGG + Exonic
1150873536 17:68942989-68943011 CTGAATAAATAATCTGTTTTAGG + Intronic
1152973942 18:194975-194997 CTGAATAAAGACTGTATTTTAGG - Intronic
1153067450 18:1062524-1062546 CTGAGACCAGGCTCTGTTTCAGG + Intergenic
1153697451 18:7658647-7658669 CTGAGTTAAGACACTGTGTGCGG - Intronic
1153845600 18:9046962-9046984 CTGAGGACTTACTCTGTTTCAGG - Intergenic
1154049000 18:10935490-10935512 TTGAGAAAAGACTCTGTTCCTGG + Intronic
1154263015 18:12854443-12854465 ATGAGGGAAGAATCTGTTTCTGG + Intronic
1156178106 18:34571392-34571414 CTGAGTCAAGTCTCTTTTCCTGG - Intronic
1158840292 18:61378544-61378566 CTGAGTAAAGAGGATGTTTCTGG - Intronic
1159963097 18:74570953-74570975 CTGAGGAATGAGTCAGTTTCAGG + Intronic
1161462935 19:4409625-4409647 CTGAGTACAGAGTCTTCTTCGGG - Exonic
1162200733 19:9018266-9018288 ATGAGTAAAGAAGCTATTTCGGG - Intergenic
1165716513 19:38049310-38049332 TTGAGTAAAGAGTCAGCTTCCGG + Intronic
1166597500 19:44062903-44062925 CTGAATGTTGACTCTGTTTCTGG + Intronic
1168332924 19:55580284-55580306 CTGAGAACACACTCTATTTCCGG - Intronic
926299504 2:11592460-11592482 GTGAGCAAGGACTATGTTTCTGG + Intronic
926320005 2:11743121-11743143 CTGAGGACAGACACTGTGTCTGG + Intronic
926657325 2:15422320-15422342 CTGAGTAAATATTCTATTTTGGG + Intronic
927100342 2:19783249-19783271 CTCAGTAAGGACTCTGTGTGGGG - Intergenic
927214568 2:20660745-20660767 CCGGGTCAACACTCTGTTTCAGG + Intergenic
927428184 2:23004379-23004401 TTGAGTAAAGACCTTGTCTCTGG + Intergenic
929261191 2:39868479-39868501 CTGAGTCAAGTCTCTTTTTCAGG - Intergenic
930232714 2:48859051-48859073 CTGAATACATTCTCTGTTTCTGG - Intergenic
933297689 2:80509066-80509088 CTGAGCACAGACTCTGCTTTTGG - Intronic
935962920 2:108445055-108445077 GTGAGGAAAGGATCTGTTTCTGG - Intergenic
937823007 2:126333496-126333518 TTGAGAAAAGAATCTGTTCCAGG + Intergenic
938295117 2:130173053-130173075 CTAAGCAAAGACTCTTGTTCAGG - Intronic
938461509 2:131500782-131500804 CTAAGCAAAGACTCTTGTTCAGG + Intergenic
938623915 2:133087854-133087876 CTGAGCAATTACTCTGTTGCAGG + Intronic
939145575 2:138410720-138410742 GTGAGCAAGGACTATGTTTCTGG - Intergenic
940960057 2:159775233-159775255 GTGAGTAAACACTATGTGTCAGG - Intronic
941191620 2:162391082-162391104 CAGAGAGAAGACTGTGTTTCTGG - Intronic
942025529 2:171906968-171906990 CTGAGTACTTACTTTGTTTCAGG + Intronic
942121366 2:172781298-172781320 CTGACTGAAGTGTCTGTTTCTGG - Intronic
942872104 2:180747506-180747528 CTGTGTAAGGACACTGCTTCGGG + Intergenic
945646418 2:212501118-212501140 CTAATTAAAGACTCTGCTACTGG - Intronic
946277818 2:218644102-218644124 TTGAGTAATGACTCTGACTCAGG + Exonic
948313859 2:237011816-237011838 CTGAGTAAAAACTTTGTATATGG + Intergenic
1169833833 20:9855483-9855505 TTGAGTAAAGACTCTGAGCCAGG - Intergenic
1170065258 20:12303635-12303657 CCTAGTGGAGACTCTGTTTCTGG + Intergenic
1171216261 20:23354708-23354730 CCCAGTAGAGACTCTGATTCTGG + Exonic
1172171971 20:32941732-32941754 CTGGGTAAAGAGTTTCTTTCTGG + Intronic
1175632370 20:60552544-60552566 CTGAGTGAAGGCTCTATGTCAGG + Intergenic
1175784062 20:61701080-61701102 CGGAGGGAAGACTCTGTTCCAGG + Intronic
1177257411 21:18683416-18683438 CTGAGGGAAGAATCTGTTTCAGG + Intergenic
1178064209 21:28885935-28885957 GTGAGTTAGGACACTGTTTCTGG + Intergenic
1179836678 21:44039196-44039218 CTTAGTAAAGACTCTGGCTCAGG - Intronic
1180664640 22:17500296-17500318 CTTAGTAAAGCTTATGTTTCAGG - Intronic
1180825850 22:18860748-18860770 CAGAGTAGAAACTCAGTTTCTGG + Intronic
1181114390 22:20621959-20621981 CTGAGCAAAGACTCTTGTTGAGG - Intergenic
1181186884 22:21113802-21113824 CAGAGTAGAAACTCAGTTTCTGG - Intergenic
1181212318 22:21296691-21296713 CAGAGTAGAAACTCAGTTTCTGG + Intergenic
1181945463 22:26513600-26513622 CTGAGTACATACTATGTGTCAGG - Intergenic
1182726037 22:32446450-32446472 CTGAGTACTTACTCTGTGTCAGG - Intronic
1184956052 22:47886821-47886843 CTGAGAAATGACTCCATTTCAGG - Intergenic
1203275992 22_KI270734v1_random:86653-86675 CAGAGTAGAAACTCAGTTTCTGG + Intergenic
949770336 3:7570746-7570768 CTCAGTAGGGACTCTGTTTGGGG + Intronic
950121655 3:10485820-10485842 CTGAGTAAAGACTGTGCTCTTGG + Intronic
951144842 3:19214586-19214608 CTGAGAAAAGACATGGTTTCTGG - Intronic
951263646 3:20541276-20541298 CTGAGTAGATGCTCTGTTCCAGG - Intergenic
952435225 3:33266941-33266963 CCGAGTAGGGACTCTGTGTCAGG + Intergenic
952890757 3:38038927-38038949 TTGTGTAAAGATTGTGTTTCAGG - Intergenic
955155739 3:56414804-56414826 CTGAGTGAAAACTCTGTACCTGG - Intronic
957348982 3:78998735-78998757 ATGAGTAAAGACATTGTTACTGG - Intronic
959756480 3:109905819-109905841 CCCAGTAAAGACTCTGTGTACGG + Intergenic
960393066 3:117103257-117103279 CTGAGAAAAGCCTCTGAATCTGG + Intronic
960984189 3:123262515-123262537 CTCAGTAGAAACTATGTTTCAGG + Intronic
962363686 3:134762664-134762686 GTGAGGAAAGGATCTGTTTCAGG - Intronic
962943477 3:140146763-140146785 GTGACTAAAGTCTCTGGTTCTGG - Intronic
963235301 3:142949951-142949973 CTGAGTAAAGAATCAGCTTGAGG - Intronic
963639183 3:147837516-147837538 CTGAGTAAAGTCTCTTTTATAGG + Intergenic
964546735 3:157842308-157842330 CTTAGTAAAGACTTATTTTCTGG - Intergenic
967300211 3:188005146-188005168 CTGCAGAAAGACTCTGATTCAGG + Intergenic
969654762 4:8490231-8490253 TTGAGTAGTGACTCTGTGTCTGG + Intronic
970352215 4:15213906-15213928 CTGAGTATAAACTCTGTGCCAGG + Intergenic
970562006 4:17291294-17291316 CTAAGTAAATCCTCAGTTTCTGG + Intergenic
970829096 4:20314126-20314148 CAGAGTAAAGTACCTGTTTCTGG + Intronic
970988023 4:22180633-22180655 GTGAGGAAAGAATCTGTTCCAGG - Intergenic
971157137 4:24095422-24095444 CTTTGTAAAGACTCTATCTCTGG - Intergenic
971645236 4:29190996-29191018 ATGAGGGAAGATTCTGTTTCAGG + Intergenic
974171288 4:58270245-58270267 CCCAGTAAGGACTCTGTTTGGGG - Intergenic
974532546 4:63128396-63128418 CTCAGTAAAGACTCCATTTCTGG - Intergenic
974794658 4:66732606-66732628 CTTAATAAAGACTGTGCTTCAGG - Intergenic
978790143 4:112654276-112654298 CTGAGTATATACTATGTTTTAGG + Intronic
979016255 4:115437554-115437576 CTCAGGAAAGACTTTCTTTCTGG + Intergenic
980204771 4:129703294-129703316 ATGAGTAAAGACTCTTTTATAGG + Intergenic
980601344 4:135029505-135029527 CTGAACTAAGACTCAGTTTCAGG - Intergenic
981176835 4:141691896-141691918 CTCAGTGAAGACTCTGTGTGGGG + Intronic
982843736 4:160223972-160223994 CTGTGTAAAGATTCTGGTACAGG - Intergenic
983189315 4:164738294-164738316 CTGTCTTAAGACCCTGTTTCTGG - Intergenic
983285718 4:165736579-165736601 ATGAGACAAGACACTGTTTCAGG - Intergenic
984545461 4:181096250-181096272 CTCATTAAAAACTCTGTTTATGG + Intergenic
984770256 4:183431081-183431103 CTGAGTATAGAATCTGCTCCTGG - Intergenic
987546744 5:19320253-19320275 CTGAGCAAAGACTCTGCATGGGG - Intergenic
988227112 5:28426636-28426658 CTAAGTAGAGACTGTGTTTGGGG - Intergenic
988665308 5:33320826-33320848 TTGAGCAACTACTCTGTTTCAGG - Intergenic
990572634 5:57094565-57094587 CTGAGTATGGACTGTGTATCAGG + Intergenic
991137981 5:63205677-63205699 CTCAGTAATGACTCAGTTTGAGG + Intergenic
991949806 5:71936410-71936432 CTGAGGAAAGCCTGTCTTTCTGG - Intergenic
992048428 5:72921438-72921460 CTGAGCATTTACTCTGTTTCAGG - Intergenic
993142237 5:84049772-84049794 CTGAGAAATGCCTCTGTTTAGGG + Intronic
995328917 5:110924334-110924356 CTGAGTGACTACTGTGTTTCTGG - Intergenic
997774904 5:136594651-136594673 ATGAGAAAAGAATCTGCTTCAGG + Intergenic
998186454 5:139983312-139983334 ATGAGAAAGGTCTCTGTTTCTGG + Intronic
1001204338 5:169748005-169748027 CTGAATGAAGAGGCTGTTTCAGG + Intronic
1002661594 5:180794514-180794536 TTGTGTAATGAGTCTGTTTCTGG - Intronic
1004148044 6:13088523-13088545 TTGAGTAATGACTATATTTCAGG + Intronic
1011853629 6:91661622-91661644 CTGATTTAAGAATCTGTTGCAGG + Intergenic
1012142616 6:95642780-95642802 CTGAGAAAGGACTGAGTTTCTGG + Intergenic
1012644173 6:101658987-101659009 CTGATTATAGTTTCTGTTTCTGG + Intronic
1012809912 6:103944146-103944168 GTGAGGAAAGGCTCTGTTCCAGG + Intergenic
1015074501 6:129139180-129139202 CAGAGTAAAGGCTCTGAGTCTGG - Intronic
1016858188 6:148693098-148693120 CTGAGGACAGTCTCTCTTTCTGG - Intergenic
1018883947 6:167916095-167916117 CTGAGGAAAGGATCTGTTTCAGG + Intronic
1019763304 7:2830373-2830395 CTGACTAAAGAGTCTGGTTTTGG + Intronic
1020016608 7:4835239-4835261 CTGAGCGGAGTCTCTGTTTCAGG - Exonic
1021244794 7:18247824-18247846 CTGAGAGAAGATTCTCTTTCTGG + Intronic
1021853859 7:24834348-24834370 CTGAGTAATGAACCTGTTTACGG + Intronic
1024424731 7:49212493-49212515 CCGAGTAGAGACTCTGTATGGGG + Intergenic
1024708452 7:51987260-51987282 TTGAGTAACGATTTTGTTTCTGG + Intergenic
1025173563 7:56783388-56783410 CTGAGGACAGACTTTATTTCTGG + Intergenic
1025698539 7:63794765-63794787 CTGAGGACAGACTTTATTTCTGG - Intergenic
1027290277 7:76701003-76701025 CTGAGTTAAGTCTCTAATTCTGG + Intergenic
1027748914 7:82116235-82116257 CTGAACAAATACCCTGTTTCTGG + Intronic
1028296450 7:89138209-89138231 CCCAGTAAAGACTCTGTGTGCGG - Intronic
1029064372 7:97834661-97834683 CTTAGTACATACTCTGTTCCAGG - Intergenic
1029221922 7:98996923-98996945 GTCAGCAAAGACTATGTTTCTGG - Intronic
1029469864 7:100747557-100747579 CTGAGAAGAGAGTGTGTTTCCGG - Exonic
1029900603 7:104035325-104035347 CTGAAAAAAGACTTTGATTCTGG + Intergenic
1032484353 7:132273181-132273203 CTGAGTGATGTCTGTGTTTCTGG + Intronic
1033276538 7:139975900-139975922 CTGGGTGACGTCTCTGTTTCAGG - Intronic
1033871785 7:145762813-145762835 CCCAGTAGAGACTCTGTTTGGGG - Intergenic
1033873907 7:145791474-145791496 TTGAGGAAAGACACTTTTTCTGG - Intergenic
1039031357 8:33313019-33313041 CTGAGTACATACTCTGTGCCAGG + Intergenic
1040130474 8:43790033-43790055 CTGGTTAAAGACACTGTTTTTGG + Intergenic
1040759884 8:50827397-50827419 CAGACTAAACACTATGTTTCAGG - Intergenic
1041260112 8:56013966-56013988 CTGAGTAAAGAATGTGTGTATGG - Intergenic
1044963423 8:97553436-97553458 CTCAGTAAACATTCTGTGTCTGG - Intergenic
1045515553 8:102856848-102856870 CTGGATATAGACTCTGATTCAGG + Intronic
1045767770 8:105695470-105695492 CTCATTAAATACTCAGTTTCAGG + Intronic
1046364077 8:113203315-113203337 CAGAGCAGAGACTCTGTCTCAGG - Intronic
1046549482 8:115696443-115696465 CTGAGGGAAGAGACTGTTTCAGG - Intronic
1046898858 8:119502116-119502138 TTGAGTAAGCACTCTGTATCAGG - Intergenic
1047672184 8:127160187-127160209 CTGACTAAAGACTGAGCTTCAGG - Intergenic
1047914177 8:129564521-129564543 TTCAGTAAAAACTCTATTTCAGG + Intergenic
1048115276 8:131514746-131514768 ATGAGTAAAGACAATGTTTTTGG + Intergenic
1048319842 8:133389855-133389877 CTGAGAAAAGCTTGTGTTTCAGG + Intergenic
1048895749 8:138990733-138990755 CCCAGTACAGACTCTGTTTGGGG + Intergenic
1050057221 9:1668219-1668241 CTGAGTATCTACTCTGTGTCAGG - Intergenic
1050098164 9:2089455-2089477 CTGGGTAACGACTCTATTTTTGG + Intronic
1050685716 9:8166676-8166698 CTGAGAACACACTCTGTGTCTGG + Intergenic
1050900974 9:10948373-10948395 CTGAATAAAACCTCTGTATCTGG - Intergenic
1052179952 9:25513574-25513596 CAGAGGAAAGAGACTGTTTCTGG - Intergenic
1054888795 9:70229492-70229514 GTGATTAAGGACCCTGTTTCTGG + Intergenic
1055234683 9:74106368-74106390 GTGAGGAAAGGGTCTGTTTCAGG - Intergenic
1055774349 9:79751891-79751913 CTCAGTAGAGACTCTGTGTGGGG + Intergenic
1056480821 9:87003940-87003962 CTGAGTAAACATTCTGTTCAGGG - Intergenic
1057379870 9:94558027-94558049 CTAAATATTGACTCTGTTTCTGG + Intergenic
1190966613 X:55307340-55307362 CTGAGTATATACTTTGTTTATGG + Intergenic
1193543079 X:82795078-82795100 CCCAGTAGAGACTCTGTTTGGGG - Intergenic
1194306201 X:92252718-92252740 CTCAGTAAATACATTGTTTCTGG + Intronic
1194715307 X:97280942-97280964 CTGAGTAATGACTATTTTACAGG + Intronic
1194932928 X:99910718-99910740 CAGAGTAAAACCTCTGTTTTTGG - Intergenic
1195770966 X:108350830-108350852 CTTAGTACTGACTCCGTTTCTGG + Intronic
1198840597 X:140853084-140853106 CTGAGTACCTACTCTGTTCCAGG + Intergenic
1199686997 X:150273622-150273644 CCCAGTAAAGACTCTGTATGGGG - Intergenic
1199896855 X:152135229-152135251 CTGGGTAAAGACTCACTGTCTGG + Exonic
1202033798 Y:20609659-20609681 CTGAGTAAAAAATCTTTTTGAGG - Intergenic