ID: 1097927657

View in Genome Browser
Species Human (GRCh38)
Location 12:65147772-65147794
Sequence TCAAACTTCCCCAGGGAAGA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1097927650_1097927657 5 Left 1097927650 12:65147744-65147766 CCTCAGCCTGTTTGTATAGCTCC No data
Right 1097927657 12:65147772-65147794 TCAAACTTCCCCAGGGAAGATGG No data
1097927652_1097927657 -1 Left 1097927652 12:65147750-65147772 CCTGTTTGTATAGCTCCTGGCCT No data
Right 1097927657 12:65147772-65147794 TCAAACTTCCCCAGGGAAGATGG No data
1097927649_1097927657 15 Left 1097927649 12:65147734-65147756 CCTAAACACTCCTCAGCCTGTTT No data
Right 1097927657 12:65147772-65147794 TCAAACTTCCCCAGGGAAGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1097927657 Original CRISPR TCAAACTTCCCCAGGGAAGA TGG Intergenic
No off target data available for this crispr