ID: 1097929935

View in Genome Browser
Species Human (GRCh38)
Location 12:65171634-65171656
Sequence ATGAATATAAAAAAGCAGCA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1096
Summary {0: 1, 1: 0, 2: 5, 3: 52, 4: 1038}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1097929935 Original CRISPR ATGAATATAAAAAAGCAGCA AGG Intronic
900234536 1:1581373-1581395 ATGAAAATAAAAAACTAGCCAGG - Intergenic
901108093 1:6773337-6773359 AAGAATATAAAAGATTAGCAAGG - Intergenic
902166860 1:14579462-14579484 AAAAATACAAAAAAGCAGCTGGG + Intergenic
902831413 1:19015652-19015674 AAGAAAATAAAAAATCAGCTGGG - Intergenic
902909009 1:19581309-19581331 AAAAATACAAAAAAGCAGCCAGG - Intergenic
903204164 1:21768044-21768066 AAAAATATAAAAAAGTAGCCGGG + Intronic
903630122 1:24762259-24762281 ATAAAAATAAAAAATCAGCTGGG + Intronic
903945888 1:26962224-26962246 ATGAATGAAAAATAGCAACATGG + Intergenic
904208423 1:28870224-28870246 AAGAAAAAAAAAAAGAAGCATGG - Intergenic
904216073 1:28920791-28920813 AAAAATATAAAAAATCAGCCAGG - Intronic
904353197 1:29922234-29922256 AGGAATTTAAAACAGGAGCAGGG - Intergenic
904687061 1:32268031-32268053 AAAAATATAAAAAATCAGCCAGG + Intronic
905067776 1:35197964-35197986 ATGAATAAATAAAAGCATAATGG + Intergenic
905067975 1:35199831-35199853 ATGAATAAATAAAAGCATAATGG + Intergenic
905068518 1:35205237-35205259 AAAAATACAAAAAATCAGCAGGG - Intergenic
905135093 1:35793116-35793138 AAGAATACAAAAAAGTAGCCGGG - Intergenic
906062176 1:42956250-42956272 ATGAATTTAAAAATACAGCCGGG + Intronic
906135463 1:43497116-43497138 AAAAATATAAAAAATCAGCTGGG - Intergenic
906499551 1:46331526-46331548 ATCAAAAAAAAAAAGCAGCATGG - Intergenic
906642164 1:47447977-47447999 ATGAAAACAAAATTGCAGCAAGG - Intergenic
907539674 1:55202134-55202156 ATGAATACAAAAATAAAGCATGG - Intronic
907543533 1:55238949-55238971 ATAAAAATAAAAAATCAGCTGGG + Intergenic
908228393 1:62079405-62079427 ATGAATATCAAAAAGGAGAAAGG - Intronic
908304150 1:62793450-62793472 AAGAATAGAAAAAAGTAGCCAGG + Intronic
908715909 1:67068852-67068874 AAAAATATAAAAAATTAGCAGGG - Intergenic
908907139 1:69028987-69029009 ATTAACATAAAAAAGCTGCCTGG + Intergenic
909159258 1:72124614-72124636 ATAAAGATAAAAAATTAGCAGGG + Intronic
909693483 1:78437023-78437045 ATGAAGCTGAAAAAACAGCAGGG + Intronic
909804799 1:79860554-79860576 ATGAATATCAAAGGACAGCAAGG + Intergenic
909902608 1:81157095-81157117 ATTCATATAAGAAAGCAGCTAGG - Intergenic
910717079 1:90243997-90244019 AAAAATATAAAAAATCAGCCGGG - Intergenic
910723659 1:90314931-90314953 ATGAACATCAGAAAGCTGCATGG + Intergenic
910743385 1:90546593-90546615 AAGAAAAGAAAGAAGCAGCAGGG + Intergenic
911059646 1:93736805-93736827 ATGAAAATAAAAAATCATCATGG + Intronic
911395149 1:97296882-97296904 ATAAATATAAAAAAGCACAGTGG + Intronic
911432824 1:97814129-97814151 CTGAATAGCAAGAAGCAGCAAGG + Intronic
911520380 1:98922822-98922844 AAGAATACAAAAAATCAGCTGGG + Intronic
911742052 1:101396896-101396918 ATAACTATAAAAAACAAGCAAGG - Intergenic
911834701 1:102602264-102602286 AAGAATATTTAAAAGAAGCATGG - Intergenic
912085498 1:105997502-105997524 AAAAATACAAAAAAGTAGCAGGG - Intergenic
912283159 1:108339124-108339146 AAAAATATAAAAAATTAGCATGG + Intergenic
912307297 1:108581831-108581853 ATAAACTTAATAAAGCAGCAGGG + Intronic
912727797 1:112075045-112075067 ATAAATAAATAAAAGCAGCAGGG + Intergenic
912847128 1:113084374-113084396 AAAAATATAAAAAATCAGCCGGG - Intronic
912915193 1:113807598-113807620 AAAAATATAAAAAAGTAGCTGGG + Intronic
912930018 1:113949757-113949779 AAAAATATAAAAAATCAGCCAGG - Intronic
913533737 1:119751701-119751723 ATGAAAATAAAAATGGAGCAGGG - Intronic
914749682 1:150526187-150526209 AAAAATATAAAAAATCAGCTGGG + Intergenic
914786980 1:150842499-150842521 ATTAAAATAAAAAAGAAGGAAGG + Intronic
915412908 1:155716784-155716806 AAAAATATAAAAAATCAGCCGGG + Intronic
915452131 1:156013264-156013286 AAAAATATAAAAAAGTAGCCGGG + Intronic
915992024 1:160527770-160527792 ATGAAAAGAAAAAAAAAGCAGGG - Intergenic
916206671 1:162321742-162321764 ATATATATATAAAAGCAACATGG + Intronic
916604453 1:166327053-166327075 ATGAATCTTAATAAGAAGCATGG - Intergenic
916659684 1:166910896-166910918 AAGAAAAAAAAGAAGCAGCAAGG - Exonic
916923138 1:169489707-169489729 AGTAATATAAAAAAGCATGAAGG + Intergenic
917213568 1:172655592-172655614 ATGAATCAACAGAAGCAGCAGGG + Intergenic
917677502 1:177333660-177333682 GTGAATACAAGAAAGCAGGAAGG + Intergenic
918385372 1:184002021-184002043 AGGAAGATAAAATAGGAGCAAGG - Intronic
918595265 1:186286052-186286074 ATATATTTAAAAAAACAGCATGG - Intergenic
918791260 1:188833451-188833473 ATGAATATTAAAAATCAACGAGG - Intergenic
919096368 1:193041962-193041984 AAAAATATAAAAAATTAGCAGGG + Intronic
919223403 1:194661196-194661218 ATGAAAAAAAAAAAAAAGCAGGG + Intergenic
919891013 1:201974618-201974640 TTGGCTATAAAAAGGCAGCATGG - Intergenic
920101242 1:203518232-203518254 ATAAAAATAAAAAATCAGCCAGG + Intergenic
920247319 1:204598168-204598190 ACAAATACAAAAAAGCAGCTGGG - Intergenic
920439734 1:205971800-205971822 AAAAATATAAAAAAGTAGCCAGG - Intergenic
920969288 1:210729135-210729157 AGGAATTTAAAAATGCAGAATGG - Intronic
921599727 1:217093621-217093643 AGAAATAGAAAAAATCAGCAGGG + Intronic
921796771 1:219353901-219353923 ATGAATATAATAAAGAGACATGG + Intergenic
921852287 1:219943937-219943959 AAAAATATAAAAAATTAGCAGGG + Intronic
922054926 1:222032669-222032691 TTAAATATAAAAAAACAACAAGG - Intergenic
922453265 1:225753760-225753782 AAAAATACAAAAAAGCAGCAGGG - Intergenic
922962037 1:229655903-229655925 ATGTATCTAAAACAGGAGCAGGG - Intronic
923676483 1:236084899-236084921 AAAAATAAAAAAAATCAGCAAGG + Intergenic
923806888 1:237267357-237267379 AAGAATACAAAAAATGAGCAGGG + Intronic
923821745 1:237450925-237450947 ATAAATATAGAAAAGAAACAAGG - Intronic
924225915 1:241921523-241921545 AGGAACATAAAGAAACAGCATGG + Intergenic
924229318 1:241950067-241950089 AAAAATATAAAAAATCAGCCAGG + Intergenic
924515485 1:244761986-244762008 ATGAAAATAAAAAATTAGCCAGG - Intergenic
924593526 1:245425698-245425720 ATGAATAAAAAAACACAGCTGGG - Intronic
924682999 1:246257469-246257491 ATGAATAACAAAAAAGAGCAGGG - Intronic
924725356 1:246664585-246664607 AAAAATATAAAAAATCAGCTGGG - Intronic
924748136 1:246858118-246858140 AAAAATACAAAAAATCAGCAGGG - Intronic
924873442 1:248073664-248073686 AAAAATAAAAAAAAGAAGCATGG + Intronic
1063171791 10:3515933-3515955 ATGACGTTAAAAAATCAGCAAGG - Intergenic
1063394363 10:5673040-5673062 AAGAATATAGAAAATCAGAAGGG - Intergenic
1063864791 10:10352377-10352399 ATGAACATAAAATTGCATCAAGG + Intergenic
1064080348 10:12303092-12303114 ATGAAAATAAAAAATTAGCTGGG + Intergenic
1064685327 10:17855408-17855430 AAAAATATAAAAAATTAGCAGGG + Intronic
1064760371 10:18612980-18613002 AGGAATATAAATAAGAAACAGGG + Intronic
1064770876 10:18721607-18721629 ATGAATACAGAAAAGTAGGAAGG - Intergenic
1064783880 10:18872859-18872881 ATGAATATACAAAAGCAATTTGG + Intergenic
1064860447 10:19819400-19819422 CTGAATATATAAAAAAAGCAAGG + Intronic
1065868793 10:29937718-29937740 ATAAAGATAAAAGAACAGCATGG - Intergenic
1066394721 10:35008112-35008134 ATGAAAAGGAAAAAGGAGCAAGG - Intergenic
1066406642 10:35125799-35125821 AGGAATAAAGAATAGCAGCATGG - Intergenic
1067519224 10:46983235-46983257 ATGAACAGAAAAAATCAGCCAGG - Intronic
1067643022 10:48068604-48068626 ATGAACAGAAAAAAACAGCCAGG + Intergenic
1067802513 10:49368841-49368863 ATGAATGTTAAAAAGAAGGAAGG + Intronic
1068370009 10:56100905-56100927 TTGAATTTAAAAAAGCAGGCCGG - Intergenic
1068905179 10:62314176-62314198 ATTACTATAAAAATGAAGCATGG - Intergenic
1068930734 10:62586548-62586570 TAAAATATAAAATAGCAGCAGGG + Intronic
1069290424 10:66772262-66772284 AAAAATACAAAAAAGTAGCAGGG + Intronic
1069475243 10:68726310-68726332 AATAATATAAAAAATCAGCCGGG - Intronic
1069568998 10:69483147-69483169 AAAAATACAAAAAAGCAGCCGGG - Intronic
1070124376 10:73608734-73608756 AAAAATATAAAAAATTAGCAGGG + Intronic
1070361449 10:75693815-75693837 TTGAATAAAAAAAAGCAGGATGG + Intronic
1070551993 10:77497177-77497199 ATGAATTTTCAAAAGCAGCCAGG + Intronic
1071031239 10:81184321-81184343 ATGAATAACAAAAATTAGCAAGG - Intergenic
1071135420 10:82447818-82447840 ATGAATATACAAAATCTCCAAGG + Intronic
1071307902 10:84315235-84315257 AAAAATATAAAAAATCAGCCAGG + Intergenic
1071327960 10:84535249-84535271 AAAAATATAAAAAATCAGCCAGG + Intergenic
1071571142 10:86698046-86698068 ATGGCTATAAAAAGGCGGCATGG - Intronic
1072218404 10:93307459-93307481 AAGAATATAAAAAATTAGCTGGG - Intronic
1072860533 10:98999543-98999565 GGCAACATAAAAAAGCAGCATGG - Intronic
1072923088 10:99593085-99593107 ATAACTATTAAAAATCAGCAAGG - Intergenic
1073835784 10:107440006-107440028 ATGAATTTAGCAAGGCAGCAAGG - Intergenic
1074085956 10:110209067-110209089 ATAAATACAAAAAAGAAGCCAGG - Intronic
1074104519 10:110378528-110378550 ATATATATAAAAAAACAGTATGG - Intergenic
1074648658 10:115492802-115492824 AAAAATATAAAAAATTAGCAGGG - Intronic
1075126441 10:119703805-119703827 AAAAATATAAAAAATCAGCCAGG - Intergenic
1075266618 10:121004772-121004794 AGGAATACAAAAGAGCATCAGGG - Intergenic
1075481698 10:122787809-122787831 ACACATATAAAAAAGCAGCTGGG + Intergenic
1075624674 10:123953580-123953602 AAAAATATAAAAAATCAGCTGGG + Intergenic
1075756529 10:124816259-124816281 ATCTATTTAAAAAAGCATCATGG - Intronic
1076010720 10:126986003-126986025 ATAAATACAAAAAATCAGCCGGG - Intronic
1076377220 10:129999506-129999528 AAAAATACAAAAAATCAGCAGGG - Intergenic
1076511352 10:131015880-131015902 AGGAGTATAAAAGAGCAACATGG + Intergenic
1076939727 10:133594276-133594298 ATGAATCAAAAAAATCAGCCAGG - Intergenic
1077941029 11:6843677-6843699 ATGAAAATTAAAAAGCTGCTAGG - Intergenic
1078702503 11:13700714-13700736 ATGAATTTAAACATGCAACAGGG + Intronic
1078770732 11:14349124-14349146 ATGAATACAAAAAATTAGCCGGG - Intronic
1078793043 11:14564160-14564182 ATGATTATAAAAGGGCAGCATGG - Intronic
1079040314 11:17053345-17053367 AAAAAAAAAAAAAAGCAGCAAGG + Intergenic
1079053250 11:17181930-17181952 AAAAATATAAAAAATCAGCCAGG + Intronic
1079167842 11:18063519-18063541 ATGAATACAAAAATGAAGCTGGG + Intergenic
1079227906 11:18623924-18623946 ATGAATATAAAAATAATGCATGG - Intronic
1079499108 11:21082318-21082340 ATTAATTTAGAAAAGCACCAAGG + Intronic
1079664454 11:23086161-23086183 ATGAATACAAAAACGAGGCAAGG - Intergenic
1079781700 11:24615272-24615294 ATGGCTATAAAAAAGCAAAAAGG - Intronic
1080274088 11:30484388-30484410 TTAAATATAAAAAATCAGCTTGG - Intronic
1080360437 11:31507116-31507138 AAAAATACAAAAAATCAGCAGGG + Intronic
1081085865 11:38800026-38800048 ATGAATAGAAAAAAATTGCATGG + Intergenic
1081480204 11:43479077-43479099 AAGAATACAAAAAATTAGCAAGG + Intronic
1081972912 11:47212435-47212457 ATAAATATAAAAAATTAGCTGGG - Intergenic
1082217785 11:49595725-49595747 ATGAAAATAAAAAATCAGCCAGG - Intergenic
1082264556 11:50105226-50105248 ATGATTTTAAAAAACCACCATGG - Intergenic
1082706447 11:56498752-56498774 AAGAGTACAAAAAATCAGCAGGG - Intergenic
1083120418 11:60506988-60507010 ATGAATAAAAACAAGCAATATGG - Intronic
1083284637 11:61650600-61650622 ATAAAAATAAAAAAGAAGCCAGG - Intergenic
1083319489 11:61836970-61836992 ATGTATAGAAAAAAGCTGGAAGG + Intronic
1083370575 11:62175921-62175943 ATGAATATACAAAATCAAAAAGG - Intergenic
1083536979 11:63478480-63478502 AAAAATACAAAAAATCAGCAGGG - Intronic
1083937659 11:65878651-65878673 AAAAATACAAAAAAGCAGCTGGG - Intergenic
1084037144 11:66518916-66518938 ATAAAAATAAAAAATCAGCCAGG - Intronic
1084986396 11:72876713-72876735 AAGAATATAGAAAATCAGTAAGG - Intronic
1085106384 11:73846857-73846879 AGGAAAATAAAAAATCAGCTTGG - Intronic
1085177497 11:74503331-74503353 AAAAATATAAAAAATCAGCTGGG + Intronic
1085258085 11:75188308-75188330 ATGAATCAAGAAAAGCAGGAAGG - Intronic
1085538186 11:77239799-77239821 AAAAATATAAAAAATTAGCAGGG + Intronic
1085655045 11:78306389-78306411 AAGAATATAAAAAATTAGCCGGG - Intronic
1085761116 11:79242382-79242404 ATAAAAATAAAAAACCAGAAAGG + Intronic
1085802159 11:79600693-79600715 ATGTTTATAAAAAAACAACAAGG + Intergenic
1085815465 11:79732697-79732719 ATGAAGACAACAAAGCAGGAAGG + Intergenic
1086631790 11:89028425-89028447 ATGAAAATAAAAAATTAGCCAGG + Intronic
1086650957 11:89289498-89289520 ATGAAGATAGAAAGGCATCATGG - Intronic
1086716062 11:90063540-90063562 AAAAATACAAAAAATCAGCAGGG + Intergenic
1087589771 11:100172743-100172765 ATAGATGTAAAAAAGCAGCTGGG + Intronic
1087751739 11:102014102-102014124 AAAAATATAAAAAAGTAGCCGGG - Intergenic
1087900030 11:103630165-103630187 ATGAATTTTAAAAAGCATGAAGG - Intergenic
1088331314 11:108655576-108655598 AAAAATATAAAAAAGTAGCCAGG + Intergenic
1088631031 11:111774080-111774102 AAAAAAAAAAAAAAGCAGCACGG + Intergenic
1088648131 11:111933779-111933801 ATGACTATAAAGAAACAGAAAGG - Intronic
1089112581 11:116068504-116068526 AAGAATATAAAAAATTAGCCTGG + Intergenic
1089229749 11:116962795-116962817 ATCAATATAAAAATGTATCAGGG - Intronic
1089464341 11:118674835-118674857 GAGAATATAAAAATGCAGCCAGG - Intronic
1089727582 11:120496133-120496155 AAAAATATAAAAAATCAGCTGGG - Intergenic
1090294603 11:125575947-125575969 AAGAATATAAAAAATTAGCCAGG - Intronic
1090602025 11:128382522-128382544 ATAAAAATAAAAAATTAGCAGGG - Intergenic
1090655060 11:128836800-128836822 TTGAATATAATAATGCATCATGG + Intronic
1090787383 11:130061828-130061850 AAAAATATAAAAAATCAGCCAGG + Intergenic
1091256820 11:134195397-134195419 AAGAATATAAAGAAGCCTCAAGG - Intronic
1091465516 12:680671-680693 AAAAATACAAAAAAGTAGCAGGG + Intergenic
1092554845 12:9546785-9546807 AAAAATATAAAAAATGAGCAGGG + Intergenic
1092685349 12:11037879-11037901 AAAAATAGAAAAAATCAGCAGGG + Intronic
1092808152 12:12246534-12246556 ATTAATTTAAAAAAGTAGCCAGG + Intronic
1092987637 12:13861801-13861823 ATGAGAATCGAAAAGCAGCATGG - Intronic
1093528478 12:20133351-20133373 AGGCATATTAAAAAGCAGTAAGG - Intergenic
1094369567 12:29722758-29722780 ACAAATACAAAAAAACAGCAGGG + Intronic
1094385718 12:29891094-29891116 AATAATAAAAAAAAGAAGCAAGG - Intergenic
1094584372 12:31764311-31764333 ATGAATACAAAAAATTAGCCGGG + Intergenic
1095431344 12:42138104-42138126 CTAAAAATAAAAAATCAGCAAGG + Intronic
1095474568 12:42572664-42572686 ATATATATATAAAATCAGCAAGG + Intronic
1095575199 12:43729345-43729367 ATGAAATTTAAAAAGCAGTATGG - Exonic
1095676328 12:44923201-44923223 ATGAATGAAAAAAAGGTGCAGGG + Intergenic
1095765334 12:45888032-45888054 AAAAATATAAAAAATCAGCTGGG + Intronic
1095860104 12:46907466-46907488 ATGTATATAAAAAATAAACATGG + Intergenic
1096249143 12:50016084-50016106 TTGATAATAAAAAAGCAGCCGGG + Intronic
1096400872 12:51305173-51305195 CTAAATATAAAAAATTAGCAGGG + Intronic
1096629623 12:52917546-52917568 AAAAATATAAAAAAGTAGCTGGG + Intronic
1097010453 12:55950133-55950155 AAAAATACAAAAAATCAGCAAGG - Intronic
1097057759 12:56260025-56260047 AAAAATATAAAAAAGTAGCCTGG + Intergenic
1097064706 12:56312377-56312399 AAAAATATAAAAAAGTAGCTGGG - Intronic
1097586444 12:61521538-61521560 ATGCATATAAGAAAGCTACAAGG - Intergenic
1097897715 12:64842196-64842218 AAAAATACAAAAAACCAGCAGGG + Intronic
1097929935 12:65171634-65171656 ATGAATATAAAAAAGCAGCAAGG + Intronic
1098170750 12:67744580-67744602 ATGAATGTATGAAAGCAGAAAGG + Intergenic
1098196860 12:68011511-68011533 ATGAATAGAAAGAAGGACCATGG + Intergenic
1098254336 12:68601241-68601263 AAAAATACAAAAAATCAGCAGGG - Intergenic
1098541241 12:71660709-71660731 ATGTATATAAAAAAGTACTATGG - Intronic
1098913671 12:76235735-76235757 ATAAAAATAAAAAATTAGCAGGG + Intergenic
1099949925 12:89290589-89290611 ATTAATATTATAAAGCAGCCAGG + Intergenic
1100078413 12:90817479-90817501 AAGAATATAAAACTGAAGCAAGG - Intergenic
1100640570 12:96478587-96478609 ATGAATTTAAAGAAGAGGCAGGG - Intergenic
1100976540 12:100128541-100128563 ATGAAAAAAAAAAAAAAGCATGG + Intronic
1101288277 12:103338976-103338998 ATTTTTATAAAAAAGCAGCCTGG + Intronic
1101403835 12:104411290-104411312 AAAAATATAAAAAATTAGCAGGG + Intergenic
1102402341 12:112640353-112640375 AAAAAAAAAAAAAAGCAGCAGGG + Intronic
1102641084 12:114367264-114367286 AAGAAAAGAAAAAATCAGCATGG + Intronic
1102922253 12:116800470-116800492 ATAAATATAAAAAATCAGCCGGG + Intronic
1103020491 12:117530100-117530122 ATAAAGATAACAAAGCAGGATGG + Intronic
1103262802 12:119603108-119603130 ATAAAAATAAAAAATCAGCTGGG + Intronic
1103531030 12:121601895-121601917 ATAAATAAAAAAAAGAAGGAAGG - Intergenic
1103742621 12:123101355-123101377 ATTAATAGAAACAAGAAGCAGGG - Intronic
1104238200 12:126960396-126960418 ATGAATTTAAATAAGCAGGGAGG + Intergenic
1104466037 12:128991496-128991518 ATGAATACAAAAAAGGGGGAGGG + Intergenic
1104999883 12:132683361-132683383 CTGAAGATGAAGAAGCAGCAAGG + Intronic
1105659930 13:22482968-22482990 ATGAACATAAACAAGCATAAGGG - Intergenic
1105861701 13:24420698-24420720 AAAAATATAAAAAATTAGCAGGG + Intergenic
1105932008 13:25061435-25061457 AAAAATATAAAAAATCAGCCGGG + Intergenic
1106071412 13:26415572-26415594 GTGAATAAACAAATGCAGCAAGG + Intergenic
1106077569 13:26474567-26474589 AGGAAGACAAAAAGGCAGCAGGG + Intergenic
1106320391 13:28632222-28632244 CTGACTATAACACAGCAGCATGG - Intergenic
1106460197 13:29961530-29961552 ATGAATATTCAACAGCTGCATGG + Intergenic
1106772976 13:32980637-32980659 GTGTATATAAGGAAGCAGCATGG + Intergenic
1106855304 13:33845820-33845842 ATGAACATCTACAAGCAGCAGGG - Intronic
1107201717 13:37728315-37728337 ATTAATAAACAAAATCAGCAAGG + Intronic
1108022461 13:46142131-46142153 CTGAAAAAAAAAAAGCAGAAAGG + Intronic
1108662773 13:52601340-52601362 AAAAATATAAAAAATTAGCAGGG - Intergenic
1109059615 13:57597985-57598007 ATAAAAATAAAAAAGTAGCTAGG + Intergenic
1109290255 13:60465268-60465290 ATAAATAAAAATAAGCACCAAGG - Intronic
1109447491 13:62461507-62461529 ATGAATTTAAAAAAGAACTATGG + Intergenic
1109943444 13:69401708-69401730 AAAAATATAAATATGCAGCAAGG + Intergenic
1111193985 13:84847908-84847930 AAAAATATAAAAAAGTAGCCGGG + Intergenic
1111925709 13:94461365-94461387 AAAAATATAAAAAAGTAGCCAGG - Intronic
1111945595 13:94661778-94661800 ATGAGTATAATAAAAGAGCAAGG + Intergenic
1112038513 13:95520532-95520554 ATAAAAATACAAAAGTAGCAGGG - Intronic
1112150329 13:96753211-96753233 ATGTATATAAAAAGGCAACAAGG - Intronic
1114512534 14:23274743-23274765 AAAAATATAAAAAAGTAGCCGGG + Exonic
1114725773 14:24935151-24935173 GTAAATATGAAAAAGCAGCAAGG + Intronic
1114769801 14:25415957-25415979 ATTAATATAAAGAAGTAGTATGG - Intergenic
1114967608 14:27982669-27982691 CTGCATATAATAAAGCAGTATGG - Intergenic
1114979604 14:28146746-28146768 ATGAATATAGGTTAGCAGCAGGG + Intergenic
1115109225 14:29801436-29801458 ATGAACATGAATAAGCAGTAGGG + Intronic
1115325998 14:32138975-32138997 ATTAATAGAATAAATCAGCAGGG - Intronic
1115973251 14:38969354-38969376 ATAAAAATAAAAAGGTAGCAAGG + Intergenic
1116130458 14:40849788-40849810 AAGAAAAAAAAATAGCAGCAGGG + Intergenic
1116454611 14:45105326-45105348 ATGAATATTAAAACTCAGAATGG - Intronic
1116783234 14:49259760-49259782 ATGTAAATAAAAAACCAACATGG + Intergenic
1116894971 14:50307116-50307138 ATAATTATCAAAAGGCAGCAAGG - Intronic
1117027962 14:51641128-51641150 ATAAATACAAAAAATTAGCAGGG - Intronic
1117152116 14:52900369-52900391 ATACATATAAAAAAGCATGAGGG + Intronic
1117513951 14:56481916-56481938 ATTATTATAAAAACGCTGCACGG + Intergenic
1117519698 14:56538780-56538802 ATCAACATAAAGCAGCAGCAGGG + Intronic
1117917253 14:60690559-60690581 ATCAAAATAAAAATGCAGCCAGG - Intergenic
1118306878 14:64662381-64662403 AAGAAAAAAAAAAAGCAGCTGGG - Intergenic
1118490103 14:66250541-66250563 AAGAATATAAAAAGGCGGCCGGG + Intergenic
1118545415 14:66881849-66881871 ATTAATACATATAAGCAGCATGG + Intronic
1118577652 14:67259449-67259471 AAAAATATAAAAAATCAGCCGGG + Intronic
1118585323 14:67347142-67347164 AAAAATATAAAAAATCAGCCAGG - Intronic
1119258697 14:73223194-73223216 TTGCATATAAAAAAGCACCCTGG + Exonic
1119270977 14:73304471-73304493 ATAAAAATAAAAAAGTAGCCAGG - Intronic
1119638739 14:76297811-76297833 ATGAATCTTAAAATGCAGCCGGG - Intergenic
1119728942 14:76938894-76938916 ATAAATACAAAAAATTAGCAGGG + Intergenic
1119796387 14:77401535-77401557 AAAAATATAAAAAATCAGCTGGG + Intronic
1120153983 14:81070638-81070660 AAAAAAAAAAAAAAGCAGCAAGG + Intronic
1120199171 14:81518050-81518072 AAGAATATAAAAAATTAGCTAGG - Intronic
1120959650 14:90113072-90113094 AAAAATATAAAAAATTAGCAGGG - Intronic
1121356717 14:93221820-93221842 AAAAATATAAAAAAGTAGCCAGG + Intronic
1122584033 14:102791971-102791993 AAAAATAAAAAAAAACAGCAGGG - Intronic
1122964256 14:105114077-105114099 ATAAATACAAAAAAGTAGCCAGG + Intergenic
1202829326 14_GL000009v2_random:9543-9565 CTGAATATAAAAAATTAGCCGGG - Intergenic
1123679664 15:22752090-22752112 AGGAATTTAAAAAATAAGCAAGG + Intergenic
1123702941 15:22929057-22929079 AAAAATATAAAAAAGTAGCTGGG + Intronic
1123862303 15:24480949-24480971 AAAAATATAAAAAATCAGCCAGG - Intergenic
1124135142 15:27028643-27028665 AAAAATATAAAAAATCAGCTGGG + Intronic
1124546936 15:30637571-30637593 AAGAATATAAAAAATTAGCTGGG + Intronic
1124621096 15:31274454-31274476 AAGAAAAGAAAAAAGAAGCATGG + Intergenic
1124643977 15:31421952-31421974 AAAAATATAAAAAATTAGCAGGG + Intronic
1124780538 15:32627566-32627588 AAGAATATAAAAAATTAGCTGGG + Intronic
1124921076 15:34027366-34027388 ATAAAAATAAAAAAACAGCCAGG + Intronic
1125060451 15:35415195-35415217 ATGAATATACAAGGTCAGCATGG + Intronic
1125082120 15:35687095-35687117 ATGAAGAAAGAAAAGCAACAGGG - Intergenic
1125263897 15:37857168-37857190 ATAGATATGAAAAAGCAGCTTGG + Intergenic
1125298848 15:38232904-38232926 AAAAATATAAAAAAGTAGCCAGG + Intergenic
1126601195 15:50429457-50429479 ATGAATATAAACATGCTGCTAGG - Intronic
1126639981 15:50814605-50814627 AAAAAAATAAAAAAGCAGAATGG - Intergenic
1126899861 15:53304113-53304135 ATGAATATAAGGAAGAGGCAAGG + Intergenic
1127220295 15:56873357-56873379 TTGAAGATAAAAAAGCTTCATGG + Intronic
1127644298 15:60944701-60944723 AAAAAAAAAAAAAAGCAGCATGG + Intronic
1127744212 15:61948520-61948542 AAAAATATAAAAAATCAGCCAGG + Intronic
1127871041 15:63073919-63073941 ATTAATATAAAAAAGGAGAACGG + Intergenic
1128653732 15:69441921-69441943 CTGAAAATAAAAAATTAGCATGG - Intronic
1130215243 15:81962135-81962157 ATGTATATAAAAAATAAGCATGG + Intergenic
1130425040 15:83788764-83788786 ATGAATAGAAGAAATCATCAAGG - Intronic
1130518553 15:84644931-84644953 AAAAAAAAAAAAAAGCAGCAGGG - Intronic
1130730024 15:86482180-86482202 ATGAATATAAAATAATAACAAGG + Intronic
1130786536 15:87103891-87103913 ATGAAAATAAAAATTCAGAAGGG + Intergenic
1131363729 15:91819108-91819130 ATGAGGAGAAAAAAGCATCAAGG + Intergenic
1131716340 15:95114522-95114544 ATGAACATCAAAAAGCATCAAGG + Intergenic
1132090000 15:98940562-98940584 AAAAATATAAAAAATCAGCTGGG - Intronic
1132773060 16:1575392-1575414 ATGAAAATAAAAAAGTAGCCAGG + Intronic
1132931951 16:2463158-2463180 AAAAATATAAAAAAGTAGCCAGG + Intronic
1133153314 16:3853447-3853469 AAAAATATAAAAAATCAGCCAGG + Intronic
1133196158 16:4172011-4172033 ATAAAAATAAAAAATTAGCAGGG - Intergenic
1133497703 16:6335481-6335503 ATGAAAATAAAAAATCAGGCCGG + Intronic
1133862168 16:9606163-9606185 AAAAATATAAAAAATCAGCTGGG - Intergenic
1134713443 16:16341437-16341459 TTGAATATAAAAAAGCATTGTGG - Intergenic
1134721313 16:16384795-16384817 TTGAATATAAAAAAGCATTGTGG - Intronic
1134946113 16:18327089-18327111 TTGAATATAAAAAAGCATTGTGG + Intronic
1134953376 16:18367233-18367255 TTGAATATAAAAAAGCATTGTGG + Intergenic
1135312164 16:21413929-21413951 TTGAATATAAAAAAGCATTGTGG + Intronic
1135365112 16:21846385-21846407 TTGAATATAAAAAAGCATTGTGG + Intronic
1135406927 16:22205422-22205444 AAAAATACAAAAAAGCAGCCGGG - Intergenic
1135446727 16:22524954-22524976 TTGAATATAAAAAAGCATTGTGG - Intronic
1135493397 16:22930409-22930431 ATTAAAATACAAAAGCAGCCGGG + Intergenic
1135493431 16:22930675-22930697 ATTAAAATACAAAAGCAGCCAGG + Intergenic
1135518807 16:23157611-23157633 AAGAATACAAAAAATTAGCAGGG - Intergenic
1136066635 16:27763309-27763331 ATAAATAAAAAAAAGTAGCCAGG + Intronic
1136085002 16:27878597-27878619 ATGAAGAAAAAAAAGTAGCTGGG - Intronic
1136087168 16:27893738-27893760 ATGAAAATAAAAAATTAGCTGGG - Intronic
1136151335 16:28351852-28351874 TTGAATATAAAAAAGCATTGTGG + Intronic
1136155007 16:28376676-28376698 ATAAATATACAAAATCAGCAAGG - Intergenic
1136167567 16:28465693-28465715 TTGAATATAAAAAAGCATTGTGG + Intronic
1136195409 16:28649325-28649347 TTGAATATAAAAAAGCATTGTGG - Intronic
1136208085 16:28738586-28738608 ATAAATATACAAAATCAGCAAGG + Intergenic
1136211747 16:28763441-28763463 TTGAATATAAAAAAGCATTGTGG - Intronic
1136256468 16:29043389-29043411 TTGAATATAAAAAAGCATTGTGG - Intronic
1136308867 16:29392920-29392942 TTGAATATAAAAAAGCATTGTGG + Intronic
1136322284 16:29494451-29494473 TTGAATATAAAAAAGCATTGTGG + Intronic
1136344338 16:29665213-29665235 AAAAATACAAAAAAGCAGCTGGG - Exonic
1136436963 16:30234423-30234445 TTGAATATAAAAAAGCATTGTGG + Intronic
1136549009 16:30972117-30972139 ATGAACAAAGAAAAGCAGCTAGG - Intronic
1137450025 16:48563782-48563804 ATGAATATATACAATCAGCCAGG - Intronic
1137585193 16:49660044-49660066 AAGAAGATAAAAAAGCATAAGGG - Intronic
1137832028 16:51553099-51553121 ATGAATACAAAATGGCAGCGTGG + Intergenic
1137923401 16:52514848-52514870 ACCAATATAAAAAATCAGCCGGG + Intronic
1138469662 16:57223609-57223631 CTGAATATAAAAAATTAGCTGGG + Intronic
1138936427 16:61730875-61730897 ATGAGTCTTAAAAAGCAACAAGG - Intronic
1139381193 16:66532306-66532328 AAGAATATAAAATACCAGCCAGG + Intronic
1139812034 16:69628911-69628933 AAAAATATAAAAAATCAGCCGGG + Intronic
1139856572 16:69985351-69985373 TTGAATATAAAAAAGCATTGTGG + Intergenic
1140098131 16:71892888-71892910 AAAAATATAAAAAATTAGCAGGG - Intronic
1140366159 16:74382706-74382728 TTGAATATAAAAAAGCATTGTGG - Intronic
1140636583 16:76922040-76922062 ATGTATATAACAAACCTGCAGGG - Intergenic
1140698558 16:77559897-77559919 AAAAATATAAAAAAGCATAAAGG - Intergenic
1140733874 16:77880553-77880575 AAGAAAAAAAAAAAGCAACATGG - Intronic
1140981686 16:80116050-80116072 AAGAATACAAAAAAGTAGCCTGG + Intergenic
1141458971 16:84165478-84165500 ATTATTTTAAAAAACCAGCAGGG - Intronic
1141857780 16:86695982-86696004 ATGATTATAACAATGCTGCAAGG - Intergenic
1142107062 16:88309835-88309857 ATCAAAATAACAAAGCATCAGGG + Intergenic
1142668497 17:1475968-1475990 ATGCATAGAAAAAGGCAGGAGGG + Intronic
1142739576 17:1923322-1923344 CTGAAAAAAAGAAAGCAGCAGGG - Intergenic
1142921011 17:3186207-3186229 AAAAATATAAAAAATCAGCCAGG - Intergenic
1143199915 17:5105359-5105381 AAAAATATAAAAAATCAGCTGGG + Intergenic
1143699929 17:8650825-8650847 AAAAATATAAAAAAGTAGCTGGG + Intergenic
1143764993 17:9131790-9131812 AATAATAAAAAAAAGCATCAAGG - Intronic
1143957763 17:10686419-10686441 AAAAATATAAAAAAGTAGCCAGG + Intronic
1144195300 17:12889155-12889177 ATGAATACAAGAAAGAAGAAAGG - Intronic
1144546011 17:16196662-16196684 AAAAATACAAAAAAGTAGCAGGG + Intronic
1144636795 17:16915185-16915207 AAAAATACAAAAAAGCAGCTGGG + Intergenic
1145762596 17:27434530-27434552 ATGAAAAAAAAAAATTAGCAGGG + Intergenic
1146185502 17:30721647-30721669 ACAAATATAAAAAAGTAGCTGGG - Intergenic
1146338144 17:31992863-31992885 AAAAATATAAAAAATTAGCAGGG - Intronic
1146587574 17:34095525-34095547 ATGATTAAAATAAAGCATCATGG - Intronic
1146645525 17:34574597-34574619 ATGAATTTGGAAAAGCAGCTAGG + Exonic
1146674501 17:34764047-34764069 ATGAATGAGTAAAAGCAGCAGGG + Intergenic
1146779044 17:35650252-35650274 AAAAATATAAAAAATCATCAGGG - Intronic
1146985455 17:37212386-37212408 ATTCTTATAACAAAGCAGCAGGG - Intronic
1147027132 17:37596587-37596609 ATGCATATTAAAAAACAGTATGG + Intronic
1147052521 17:37806229-37806251 AAAAATACAAAAAATCAGCAGGG + Intergenic
1147270650 17:39268190-39268212 AAGAATACAAAAAATCAGCCGGG + Intronic
1147526956 17:41234317-41234339 AAGAATGTAAGAAAGGAGCAAGG + Intronic
1148003789 17:44408344-44408366 AAAAATATAAAAAATCAGCCGGG - Intronic
1148654198 17:49271069-49271091 AAAAATATAAAAAATCAGCCAGG + Intergenic
1148815530 17:50325280-50325302 AAAAATACAAAAAATCAGCAGGG + Intergenic
1148885669 17:50770779-50770801 ATAAATAAATAAAAGCAACAAGG - Intergenic
1148893369 17:50824047-50824069 ATGAATAGAAAACACCATCATGG + Intergenic
1149005233 17:51798143-51798165 ATGAATATAGAAAAATAGGAAGG - Intronic
1149392717 17:56208168-56208190 AAAAATATAAAAAATCAGCCAGG - Intronic
1149462560 17:56842737-56842759 ATGAATATAAAAAAGAAAAGAGG - Intronic
1149688761 17:58555682-58555704 AGGTATATAAAAAATCTGCATGG + Intergenic
1149708806 17:58719887-58719909 AAAAATATAAAAAATCAGCTGGG - Intronic
1149965365 17:61157525-61157547 ATGAAAAAAAAAAAGAGGCAGGG - Intronic
1150255951 17:63744314-63744336 AAAAATATAAAAAATTAGCAGGG + Intronic
1150982789 17:70162471-70162493 ATGAAGATAAAAAATCTCCAAGG + Intergenic
1151143453 17:72017116-72017138 TGGAAGACAAAAAAGCAGCAAGG + Intergenic
1152186348 17:78858679-78858701 AAAAATATAAAAAATTAGCAGGG - Intronic
1153247707 18:3089712-3089734 ATAAAGATAAAAAATGAGCAGGG - Intronic
1153446436 18:5178187-5178209 ATGCATATCAATAAGCAGGAGGG - Intronic
1153768663 18:8398131-8398153 ATAAAAATAAAAAACCAGCCAGG - Intronic
1154118046 18:11628616-11628638 TTGAATATAAAAAAGCATTGTGG + Intergenic
1154216900 18:12422098-12422120 ATAAAAATAAAAAAACAGCCAGG - Intronic
1155587683 18:27386428-27386450 ATGAATGGAAAAAAGGAGGAAGG - Intergenic
1155597042 18:27500185-27500207 CTGAATATGCAACAGCAGCAAGG + Intergenic
1155981984 18:32189675-32189697 CTGGATATATTAAAGCAGCATGG + Intronic
1156342053 18:36218673-36218695 ATGAAAATTAAAAAGTAGCCAGG - Intronic
1156426956 18:37024151-37024173 AAAAATTTAAAAAATCAGCAGGG - Intronic
1156792559 18:40993615-40993637 ATGCATATAAAATGGCAACATGG - Intergenic
1156973614 18:43189275-43189297 ATGAATGTAAAAAAGTACAAAGG - Intergenic
1157417627 18:47519251-47519273 ATGAATATAAAAGACAAGAAAGG + Intergenic
1157894677 18:51454433-51454455 ATGAATATCATAAAGAAGCTGGG + Intergenic
1158116251 18:53999267-53999289 AGGAATATATAAAAGCCTCATGG + Intergenic
1158341331 18:56469771-56469793 TAGAATATAAAAGAGCAGCGTGG - Intergenic
1158397208 18:57088703-57088725 AAGAAAAGAAAAAAGAAGCAGGG + Intergenic
1158460956 18:57645357-57645379 AAGAATAAAAAAAAGCAGCCAGG - Intergenic
1158615949 18:58987259-58987281 AAAAATATAAAAAATCAGCTGGG + Intergenic
1158731188 18:60024346-60024368 ATGAATGTAAAGATGCAGGATGG + Intergenic
1158907908 18:62031659-62031681 ATGAATATTCAAAAGAAACAGGG + Intergenic
1159209966 18:65305793-65305815 ATGGATATAAGAAAGCAAAAGGG + Intergenic
1159220914 18:65461884-65461906 ATCAATATAACAGATCAGCATGG + Intergenic
1159598682 18:70408083-70408105 ATGCATTAAAAAAAGAAGCAAGG - Intergenic
1159741042 18:72170926-72170948 ATGAAGGTAGAATAGCAGCAGGG - Intergenic
1159920441 18:74222719-74222741 AGGAATATAAAACAGAGGCAGGG + Intergenic
1159968811 18:74623809-74623831 ATGAAGATAATAAAGCTACATGG + Intronic
1160138773 18:76299097-76299119 ATAAAAATAAAAAAGAAGAAAGG + Intergenic
1160206862 18:76841852-76841874 ATAAAAATAAAAAATCAGCCTGG - Intronic
1160783307 19:888041-888063 AAAAATACAAAAAAGCAGCCGGG + Intronic
1160934877 19:1589670-1589692 ATGAACATAAAAAATTAGCTGGG + Intronic
1160959231 19:1711080-1711102 AAGAATATAATAAAGAAGCTGGG + Intergenic
1161272112 19:3395655-3395677 ATAAAAATAAAAAATCAGCCAGG - Intronic
1161672194 19:5619682-5619704 AAAAATATAAAAAAGTAGCTGGG + Intronic
1162101011 19:8338712-8338734 AAAAATATAAAAAAGTAGCCGGG + Intronic
1162558742 19:11403477-11403499 AAGAATATAAAAAACTAGCTGGG + Intronic
1162707413 19:12565507-12565529 AAGAATACAAAAAAGTAGCTAGG - Intronic
1162716779 19:12639356-12639378 ATAAATACAAAAAAACAGCCGGG - Intronic
1162739404 19:12765586-12765608 AAAAATATAAAAAATCAGCCAGG + Intronic
1162973283 19:14194081-14194103 ACAAATATAAAAAAGTAGCTGGG + Intronic
1162993633 19:14319527-14319549 ATAAATAGAAAACAACAGCAGGG - Intergenic
1163011291 19:14428119-14428141 ATAAAAATAAAAAAGGAGCGGGG - Intergenic
1163812198 19:19440429-19440451 AAAAATATAAAAAATTAGCAGGG - Intronic
1164035913 19:21454784-21454806 AAAAATATAAAAAATCAGCTGGG + Intronic
1164656923 19:29928566-29928588 TTGAAAATAAACAAGCATCAGGG - Intronic
1165041404 19:33070503-33070525 AAAAATACAAAAAATCAGCAAGG - Intergenic
1165705487 19:37973395-37973417 ACTAATATAAAAAATCAGCTGGG - Intronic
1165719370 19:38068181-38068203 ATGAAGAAAAAAAATCAGCCGGG - Intronic
1166096117 19:40540386-40540408 ATTAAAATTAAAAAGCAGCATGG - Intronic
1166501933 19:43348051-43348073 AAAAATATAAAAAAGTAGCCAGG - Intergenic
1166615697 19:44243380-44243402 AAAAATATAAAAAATTAGCAAGG - Intronic
1166672754 19:44721404-44721426 AAGAAAAAAAAAAAGGAGCAGGG + Intergenic
1167351778 19:48979804-48979826 AAAAATAAAAAAAATCAGCAGGG - Intronic
1167669652 19:50842952-50842974 AAAAATATAAAAAAGTAGCCGGG - Intergenic
1168313145 19:55471754-55471776 AAAAATACAAAAAATCAGCAGGG - Intergenic
1168391708 19:56013972-56013994 ATGAAGTTAAAAAAGGACCAAGG - Intronic
1168481974 19:56727822-56727844 ATGAAGATAGAAGAGCAGGAAGG + Intergenic
1168624381 19:57905243-57905265 AAAAATATAAAAAAGTAGCCAGG + Intronic
1202643366 1_KI270706v1_random:118239-118261 CTGAATATAAAAAATTAGCCGGG + Intergenic
925083259 2:1086786-1086808 ATAAATATGAAAAAGGAACAAGG + Intronic
925130541 2:1491007-1491029 AAAAATATAAAAAATCAGCTGGG + Intronic
926187790 2:10705054-10705076 AAAAATATAAAAAATCAGCCGGG + Intergenic
926332189 2:11834850-11834872 CTGCAAATAAAAAAGGAGCAGGG + Intergenic
926572980 2:14550446-14550468 GTTGATATAAACAAGCAGCAGGG + Intergenic
926838550 2:17051981-17052003 ATGAACATGAAAAAGGACCAGGG + Intergenic
927617260 2:24611738-24611760 ATGAAAAATAAAAAGGAGCAGGG - Intronic
927900151 2:26813109-26813131 ATAAAAATAAAATAGCAACATGG - Intergenic
929140265 2:38660835-38660857 AAAAATATAAAAAATCAGCCAGG + Intergenic
929481562 2:42313107-42313129 AAGAATATAAAAAATTAGCCAGG - Intronic
930148183 2:48029194-48029216 ATGGCAATAAAAAAGCAGAAAGG + Intergenic
930294243 2:49534376-49534398 ATGAAAAAAAAAAAGAAACAAGG + Intergenic
930352892 2:50280115-50280137 AAAAATACAAAAAAGTAGCAGGG + Intronic
931947864 2:67331471-67331493 ATTAATTTAAAAAAATAGCATGG + Intergenic
932615939 2:73231627-73231649 ATGAAAAAAAAAAATCAGCCTGG - Intronic
932616753 2:73236657-73236679 AGGAATAAAAAAAAGGAGCGAGG + Intronic
932639130 2:73424910-73424932 ATGAATCTGAAAAAGAATCAGGG - Intronic
932962160 2:76425877-76425899 AAAAATATAAAAAAGTAGCCGGG + Intergenic
933039076 2:77438565-77438587 AAAAATATAAAAAATCAGCCTGG - Intronic
933196229 2:79393242-79393264 ATCAATATCAAAAAGCACCATGG + Intronic
933885117 2:86712049-86712071 AAAAATATAAAAAATTAGCAGGG - Intronic
933925056 2:87084635-87084657 AAAAATATAAAAAATTAGCAGGG + Intergenic
934073816 2:88410130-88410152 AAAAATATAAAAAAGTAGCTGGG + Intergenic
934075473 2:88424782-88424804 ACGTATATAAAAAAGTTGCATGG - Intergenic
935094268 2:99929088-99929110 ATGAAAGTAAAAACTCAGCAAGG + Intronic
935305471 2:101732580-101732602 AAAAAAATAAAAAAGGAGCAAGG - Intronic
935792383 2:106605037-106605059 ATCATTATCAAAAAACAGCAAGG + Intergenic
935893603 2:107708441-107708463 AGGAATAAACAAAAGCAGGATGG + Intergenic
936547876 2:113408083-113408105 ATGAATAAAAAAAAGGAAAAGGG - Intergenic
936647751 2:114391303-114391325 ATGAAGATAAAGAAACAACAGGG - Intergenic
936736998 2:115457130-115457152 ATTAATTTAAAAAAATAGCAAGG + Intronic
936745143 2:115566900-115566922 AGGAATATAAAAACACAGAAAGG - Intronic
937463934 2:122112708-122112730 ATGACTCTAAACAAACAGCAAGG + Intergenic
938166468 2:129031891-129031913 ATTGATATAGAAAATCAGCAAGG + Intergenic
938900512 2:135795366-135795388 AAAAATATAAAAAATCAGCCAGG - Intronic
939203890 2:139074785-139074807 ATGAAAAAGAAAAAGAAGCAGGG - Intergenic
939393138 2:141593989-141594011 ATAAATATAAAAAAGGTGAAGGG - Intronic
939750994 2:146045558-146045580 ATAAATATAGAGAAGCAGTAAGG - Intergenic
940016093 2:149106631-149106653 ATCAATATCAAAAAGGAGGAAGG - Intronic
940037562 2:149327452-149327474 ATTAATTTAAAAAATCAGAAAGG + Intergenic
940204396 2:151186667-151186689 AGTAATAAAAAAAAGCAGTATGG - Intergenic
940540101 2:155003607-155003629 AAAAATACAAAAAATCAGCAGGG - Intergenic
940724126 2:157315554-157315576 ATAAACAGAAAAAAGAAGCATGG + Intergenic
940788419 2:158006306-158006328 AAGAATATAAAAAATTAGCCGGG + Intronic
940904793 2:159159283-159159305 AAAAATATAAAAAATTAGCAAGG + Intronic
940954058 2:159709143-159709165 AAGAAAAAAAAAAAGAAGCAGGG + Intergenic
941222161 2:162796117-162796139 ATGACTACAAAGAAACAGCATGG + Intronic
941634671 2:167923673-167923695 AAAAATATAAAAAATCAGCCGGG - Intergenic
941837454 2:170040264-170040286 AAAAATATAAAAAATTAGCAGGG - Intronic
942342243 2:174960829-174960851 ATGAAAATAAAAACACAGCTGGG + Intronic
942471262 2:176263007-176263029 ATGTATATAAAAAAACTGGATGG - Intergenic
942549551 2:177100719-177100741 ATAAAAATAAAAAATCAGCTGGG - Intergenic
942576462 2:177368732-177368754 ATGAATACAAAAAATTAGCTGGG - Intronic
942707914 2:178798102-178798124 ATGAATAGAAAAATACACCAGGG - Intronic
942841687 2:180369534-180369556 ATAAAAATAAAAAATTAGCAGGG + Intergenic
943138419 2:183945826-183945848 ATATATATATAAAAGCAGGAGGG + Intergenic
944032518 2:195252718-195252740 ATGAATGTAAGAAAGGAGTATGG - Intergenic
944334293 2:198512048-198512070 ATTAAAATAAAAAAAAAGCAAGG - Intronic
944556621 2:200893766-200893788 ATAAATATAAAAAAGCACTTGGG - Intronic
944563656 2:200965846-200965868 AGAAATATAAAAAAACAGCCAGG - Intergenic
944585605 2:201170379-201170401 ATGAATTTAAAATAGAAACATGG - Exonic
944691256 2:202160472-202160494 AAAAATATAAAAAATCAGCTGGG - Intronic
944785434 2:203065446-203065468 GTGAGTACAAAAAAGAAGCATGG + Intronic
944796793 2:203195035-203195057 AAAAATATAAAAAATTAGCAGGG + Intronic
944969801 2:204979043-204979065 ATGAATACAAAAAATTAGCCGGG + Intronic
945284291 2:208066529-208066551 AAAAATATAAAAAATTAGCAGGG + Intergenic
945454375 2:210033278-210033300 ATTAATACAAGAAAACAGCATGG + Intronic
946088837 2:217201899-217201921 ATCAATGTATAAAATCAGCATGG - Intergenic
946124251 2:217546782-217546804 AAGAACATAAAAAATCATCAAGG + Intronic
946272197 2:218603695-218603717 ATAAATATAAAAAATTAGCCGGG - Intergenic
946279730 2:218658378-218658400 AAAAATACAAAAAATCAGCAGGG + Intronic
946380166 2:219342431-219342453 AAAAATATAAAAAATCAGCCAGG + Intergenic
946936092 2:224722187-224722209 ATCTATATAAAAAACCAGCCAGG - Intergenic
947021621 2:225683753-225683775 TGGAAAATATAAAAGCAGCAAGG + Intergenic
947024798 2:225725106-225725128 ATAAATACAAAAAATTAGCATGG - Intergenic
948263355 2:236620741-236620763 ATGGAAATAAAAGAGCAGCATGG + Intergenic
948331557 2:237170794-237170816 AAAAATATAAAAAAGCAGCCAGG + Intergenic
948563604 2:238869785-238869807 ATGAAAATAAAAAAGTAGCAGGG + Intronic
1168769269 20:404316-404338 ATGACCATAATAAATCAGCAGGG + Intergenic
1169179027 20:3545830-3545852 ATCACTAAAAAAATGCAGCAAGG - Exonic
1169243027 20:4000924-4000946 ATAAAGGTAAAAAAGAAGCAGGG - Intronic
1169282401 20:4278719-4278741 ATTAATATAAAGAAGAAGCAGGG - Intergenic
1169307493 20:4504908-4504930 ATGAATATAGAAAAGTAATAAGG + Intergenic
1169707909 20:8527386-8527408 ATGAAAATAAATAAACAGCATGG + Intronic
1169781035 20:9310727-9310749 ATAAATAAAAAAAGGGAGCAGGG + Intronic
1169886392 20:10403266-10403288 ATGAATAGAATACAGCAGAAGGG - Exonic
1170520723 20:17182052-17182074 ATGGAAATCAAAAAGAAGCAGGG + Intergenic
1170546638 20:17440390-17440412 ATGAATAGAAAAGGGCAGCAGGG + Intronic
1170924560 20:20711799-20711821 ATTAAATTTAAAAAGCAGCATGG + Intronic
1171033952 20:21701983-21702005 GGGAAAATAAAAAAGCAGCTCGG - Intergenic
1171450337 20:25231377-25231399 ATGAATATCTAAAGGCAGAATGG + Intergenic
1171450851 20:25235268-25235290 ATGAATATCTAAAGGCAGAATGG + Intergenic
1171529226 20:25841080-25841102 AAGAATACAAAAAATTAGCAGGG + Intronic
1171547600 20:26014805-26014827 AAGAATACAAAAAATTAGCAGGG - Intergenic
1171879325 20:30605362-30605384 ATAAAAATAAAAAAACAGCCAGG + Intergenic
1172143418 20:32740154-32740176 AAAAATATAAAAAATCAGCCGGG + Intronic
1172528286 20:35614224-35614246 ATGAATGTTAAGAAGGAGCAGGG - Intergenic
1172698783 20:36840021-36840043 AAAAATATAAAAAATCAGCTGGG - Intronic
1172722524 20:37010974-37010996 ATGAAAATAAAAAATTAGCTGGG - Intronic
1173113262 20:40216207-40216229 ATGAATAAAAAACAACAACATGG + Intergenic
1174314241 20:49685012-49685034 TTGAAAATAAAATAACAGCATGG - Intronic
1174503476 20:51002210-51002232 ATTAATTTAAAAAAGAAGGAAGG - Intergenic
1174690219 20:52496759-52496781 AAAAATATAAAAAATCAGCTGGG - Intergenic
1174699334 20:52591522-52591544 AAAAATATAAAAAATCAGCCAGG - Intergenic
1175074692 20:56362756-56362778 ATAAAAATAAAAAGGCAGCCAGG - Intronic
1175235072 20:57504135-57504157 AAAAATATAAAAAATCAGCCGGG - Intronic
1176014054 20:62919545-62919567 AAGAAAAAAAAAAAGCAGCAAGG + Intronic
1176608510 21:8854383-8854405 CTGAATATAAAAAATTAGCCGGG - Intergenic
1177284920 21:19037402-19037424 AAAAATATAAAAAATCAGCAGGG - Intergenic
1177415455 21:20787619-20787641 AACAATATAAAAAATTAGCAGGG + Intergenic
1177493225 21:21855250-21855272 ATAAATGTAACAAAACAGCAAGG + Intergenic
1177533233 21:22391107-22391129 AAAAATACAAAAAATCAGCAGGG + Intergenic
1177627219 21:23678184-23678206 ATTAATATTAAAAAGAAACAAGG - Intergenic
1177628585 21:23698459-23698481 ATATATATAAAAAAACAGAATGG + Intergenic
1177810055 21:25915872-25915894 ATGAATATAATTAACCACCATGG - Intronic
1178825755 21:36015219-36015241 ATGACTATAAAATAGCATCATGG - Intergenic
1179681685 21:43026167-43026189 ATGAATGCAGAAAAGCAGGAGGG - Intronic
1180015190 21:45077504-45077526 AAAAATATAAAAAATCAGCCGGG + Intronic
1180358594 22:11864198-11864220 CTGAATATAAAAAATTAGCCGGG - Intergenic
1180379672 22:12128133-12128155 CTGAATATAAAAAATTAGCCGGG + Intergenic
1180663250 22:17487538-17487560 AAAAATATAAAAAATCAGCCGGG + Intronic
1181123519 22:20688733-20688755 AAAAATACAAAAAAGCAGCCGGG + Intergenic
1181389342 22:22568548-22568570 ATAAATAGACACAAGCAGCATGG - Intergenic
1182239052 22:28900192-28900214 AGGAATATAAATAAGGAGCTGGG - Intronic
1182324622 22:29503046-29503068 ATGAATTCAGTAAAGCAGCAGGG + Intergenic
1182324814 22:29504502-29504524 AAAAATATAAAAAATTAGCATGG + Intergenic
1182648571 22:31830983-31831005 ATGATTATAAAGAAGCAACGAGG - Intronic
1183101149 22:35585135-35585157 AAAAATATAAAAAATTAGCAGGG - Intergenic
1183859552 22:40659942-40659964 ATAAATACAAAAAATCAGCTGGG - Intergenic
1184019649 22:41812259-41812281 AAAAATATAAAAAAGTAGCCGGG + Intronic
1184474642 22:44713962-44713984 AAAAATACAAAAAATCAGCAGGG - Intronic
1184605423 22:45570963-45570985 AAAAATATAAAAAATTAGCATGG + Intronic
1184659055 22:45957232-45957254 ATGTATGTAAAAATGCATCAAGG + Intronic
1184753850 22:46505099-46505121 AAAAATACAAAAAATCAGCAAGG + Intronic
949110121 3:250125-250147 ATGAATATAAAAAATTAGCCAGG - Intronic
949346112 3:3078426-3078448 ATGAATATTTGAAAGCAGAAGGG - Intronic
949623254 3:5839851-5839873 AGGCATATAAGAAAGCAACAGGG + Intergenic
949708905 3:6851920-6851942 ACAAATATAATAAAACAGCAAGG - Intronic
949983255 3:9516938-9516960 AAAAATATAAAAAATCAGCCCGG - Intronic
950195971 3:11009509-11009531 ATGAAGAAAAAAACCCAGCAAGG - Intronic
950243047 3:11388728-11388750 ATGAATAAAAAAAAGAAAGAAGG - Intronic
950353690 3:12383583-12383605 ATAAATAAATAAAAACAGCATGG + Intronic
950759990 3:15214039-15214061 AAAAATATAAAAAATCAGCTGGG - Intronic
950996105 3:17498891-17498913 ATCAATATAATAAAACAGCCAGG - Intronic
951206023 3:19926654-19926676 ATAAAAATAAAAAAGCAGGCTGG - Intronic
951217190 3:20036638-20036660 AAAAATATAAAAAATCAGCTGGG + Intergenic
951656159 3:25010840-25010862 ATGAATATCAAAAAGAGTCACGG - Intergenic
952485075 3:33801747-33801769 ATAAAAATAAAAAACCAGCAGGG - Intronic
952671259 3:35972308-35972330 ATGAACAAAAAAAAGTAGTAAGG - Intergenic
952876753 3:37951519-37951541 ATAAAAATAAAAAATCAGCTAGG + Intronic
953459593 3:43072010-43072032 ATGAATATAAGAAGGAAGGAAGG - Intergenic
954177335 3:48854886-48854908 ATAAATATAAAAAATTAGCTGGG + Intergenic
954192774 3:48976069-48976091 AAAAATATAAAAAAGTAGCCAGG - Intronic
954605194 3:51904154-51904176 ATGAATATAAAGAAGAAAAAAGG + Intergenic
954991035 3:54840881-54840903 AAAAATATAAAAAATCAGCCAGG - Intronic
956484469 3:69707621-69707643 AAGAATATAAAATGGCAGGAGGG + Intergenic
957316189 3:78579659-78579681 ATAAAAATAAAAAATGAGCAAGG - Intergenic
957518146 3:81282863-81282885 AAAAAAAAAAAAAAGCAGCAAGG + Intergenic
957679464 3:83414193-83414215 CTGAAGCTAAAAAGGCAGCATGG - Intergenic
957719438 3:83974292-83974314 ATGAATATCAGAAAGAGGCAAGG + Intergenic
957900460 3:86482194-86482216 ATAAATATTTAAAAACAGCAGGG - Intergenic
958536946 3:95415977-95415999 ATGAGTTTAGCAAAGCAGCAGGG + Intergenic
959164222 3:102757143-102757165 CTGAAAAAAAAAAAGAAGCAGGG - Intergenic
959173995 3:102881647-102881669 ATAAAAAGAAAAAAACAGCAAGG + Intergenic
959312865 3:104762970-104762992 AAGAATAGAAAAAAGGAACAAGG + Intergenic
959590055 3:108069426-108069448 ATGAATAGAAAAAGACAGAAAGG + Intronic
959794528 3:110408913-110408935 ATGAATAAACAAATTCAGCAAGG - Intergenic
959849264 3:111069514-111069536 ATGCACATAAAACACCAGCATGG + Intergenic
959852866 3:111110977-111110999 ATGAATACAGAAATGCAGAAGGG - Intronic
959982830 3:112536758-112536780 AAGAATATAAAAAATTAGCCGGG + Intronic
960211481 3:114972348-114972370 ATGAAAATAAAAAACTAACATGG + Intronic
960327535 3:116315786-116315808 CTGAAGATAAAATAGAAGCATGG + Intronic
960638049 3:119803174-119803196 ATGAAAAAAAAAAAGTAGCTGGG + Intronic
960829375 3:121830045-121830067 AAGAATACAAAAAATCAGCTGGG + Intronic
960990543 3:123308002-123308024 ATGAAAAAAAAAAAAGAGCATGG - Intronic
961311706 3:126006437-126006459 AGGAAAATAAAAAGACAGCAAGG + Exonic
961824984 3:129594486-129594508 ATAAAAATAAAAAAACTGCAAGG + Intronic
961912046 3:130327823-130327845 ATGTTTATAAATAAGCAGAATGG + Intergenic
961924910 3:130468679-130468701 ATGAGTATGGAAATGCAGCATGG + Intronic
962021457 3:131506529-131506551 AAAAATAGAAAAAAGCAGTATGG + Intergenic
962180851 3:133205124-133205146 AAGAAAAAAAAAAAGCAGCAGGG - Intronic
962247423 3:133807411-133807433 AAAAATATAAAAAATCAGCCGGG - Intronic
962542252 3:136394614-136394636 AAAAATATAAAAAAGTAGCCAGG + Intronic
962578635 3:136777247-136777269 AAAAATATAAAAAATCAGCTGGG + Intergenic
962772098 3:138621941-138621963 AAAAATACAAAAAATCAGCAGGG - Intronic
962794476 3:138838565-138838587 AGGAAAAAAAAAAAGCAGCTGGG - Intergenic
962943956 3:140150731-140150753 GAGAAGAAAAAAAAGCAGCAAGG - Intronic
963350333 3:144143545-144143567 ATCAATTTAAGAAAGCATCATGG + Intergenic
963353155 3:144177174-144177196 AAGAATATAAAGAAACAGGAAGG - Intergenic
963478064 3:145831951-145831973 AAAAATATAAAAAATCAGCCGGG + Intergenic
963861348 3:150313656-150313678 ATGAATGACAGAAAGCAGCAAGG + Intergenic
964003042 3:151799433-151799455 TTGAACATAAAAAAGAAGCCAGG - Intergenic
964068897 3:152608354-152608376 AAAAATATAAAAAATTAGCAGGG + Intergenic
964333516 3:155629910-155629932 CTGAATATAAAAAAGGAGTAAGG - Intronic
964501636 3:157354526-157354548 ATGAATAAGGAGAAGCAGCAAGG - Intronic
964960772 3:162422256-162422278 TTAAATATAAGAAAGCAGAAAGG - Intergenic
965213053 3:165820549-165820571 ATGACTTTAAAAAAGAATCAGGG - Intronic
965540586 3:169867416-169867438 AAAAATATAAAAAAGTAGCCGGG - Intronic
965752531 3:171990888-171990910 AAAAATATAAAAAAGTAGCTGGG - Intergenic
965776694 3:172239278-172239300 GTCAATATAAACAAGCTGCATGG - Intronic
965911787 3:173786914-173786936 AAAAATACAAAAAAGTAGCAGGG + Intronic
966007947 3:175039325-175039347 AAGAATATAAAAAATTAGCCAGG - Intronic
966523434 3:180897205-180897227 AAAAATACAAAAAATCAGCAAGG - Intronic
966548559 3:181179501-181179523 AGGAATAGAAGAAAGCAGCTAGG - Intergenic
966905280 3:184519610-184519632 AAAAATATAAAAAAGTAGCCAGG + Intronic
967704040 3:192629681-192629703 ATGAATACAAAAAAGTACAAAGG + Intronic
967832388 3:193931438-193931460 ATAAAAATAAAATAGCACCATGG + Intergenic
968065378 3:195755965-195755987 ATAAAAATAAAAAAGCAGATAGG + Intronic
968738853 4:2316851-2316873 AAAAATATAAAAAATCAGCCAGG - Intronic
968770972 4:2506726-2506748 AAAAATATAAAAAATCAGCCAGG - Intronic
968784500 4:2609766-2609788 AAAAATATAAAAAATCAGCTGGG + Intronic
969650570 4:8465409-8465431 ATGAAGTCAAAGAAGCAGCAGGG - Exonic
970595025 4:17592219-17592241 ATGACTACAAAAAGGCAGAAGGG - Intronic
970833376 4:20369735-20369757 CTGTATATAAAAAGGTAGCAGGG + Intronic
971612366 4:28742120-28742142 ATGAAAATAAATGAGCAGGAAGG - Intergenic
971777026 4:30979163-30979185 AAAAATATAAAAAATCAGCTGGG + Intronic
971794895 4:31214741-31214763 TTTTACATAAAAAAGCAGCATGG - Intergenic
971887986 4:32477384-32477406 ACAAACATGAAAAAGCAGCAAGG + Intergenic
971915943 4:32869934-32869956 AAAAATAAAAAAAAGTAGCAGGG + Intergenic
972049870 4:34716379-34716401 ATGAATGTAAACAAGCGGTAAGG - Intergenic
972109002 4:35531500-35531522 ATAAATATAAAAAATAAGAAGGG + Intergenic
972327068 4:38026632-38026654 ATGAAAAGAAAAAAAAAGCATGG - Intronic
972424010 4:38915687-38915709 ATGAATAGCAAAAGTCAGCAGGG + Intronic
972502595 4:39692425-39692447 AAAAATATAAAAAATTAGCAGGG + Intergenic
973853351 4:54984689-54984711 ATGAAAATAAAATATTAGCAAGG - Intergenic
974542739 4:63259524-63259546 ATAAATATAGAAAAACACCAAGG + Intergenic
974640334 4:64622560-64622582 ATGAATTTAGAAAAGTTGCAAGG - Intergenic
974885063 4:67808254-67808276 ATAATTATAATGAAGCAGCAGGG + Intergenic
974946382 4:68534261-68534283 ATGGAAAGCAAAAAGCAGCAGGG - Intergenic
975941067 4:79646708-79646730 ATAAATTTAAAAATCCAGCAAGG - Intergenic
976328839 4:83804380-83804402 AAGAATACAAAAAAGTAGCCAGG + Intergenic
976430992 4:84964170-84964192 ATGAAATTAAGAAAGAAGCAGGG + Intronic
976579384 4:86717676-86717698 ATGAATATAAAATAACAGGAAGG + Intronic
977047133 4:92081275-92081297 ATGGAAATAAAAAAAAAGCAGGG + Intergenic
977761012 4:100737001-100737023 ATGAAGATGAAAGAGCAGAATGG + Intronic
977774687 4:100903040-100903062 ACGAATACAAAAAAGTAACAAGG + Intergenic
977938682 4:102834586-102834608 CAGAAAATAAAAAATCAGCATGG + Intronic
978023359 4:103841347-103841369 ATGAAAAAAACAAGGCAGCAGGG + Intergenic
978124098 4:105115036-105115058 ATAAATATAAAAAATTAGCTAGG - Intergenic
978255056 4:106682927-106682949 ATGTATATAAACCACCAGCAAGG - Intergenic
978481786 4:109200609-109200631 AAAAATACAAAAAATCAGCAGGG - Intronic
978835066 4:113139429-113139451 ATTAAAATAAAAAAGCAAGATGG - Intronic
978938540 4:114409788-114409810 AAAAATATAAAAAAGTAGCCTGG + Intergenic
979339266 4:119501458-119501480 ATAAAAATAAAAAATCAGCCAGG - Intronic
979633515 4:122930530-122930552 ATGAACAATAAAAAGCAGAAGGG + Intronic
979867812 4:125777802-125777824 CTAAAAATAAAAAAGGAGCATGG + Intergenic
980445215 4:132897001-132897023 ATGAATATAGTAAAGTCGCAGGG + Intergenic
980490980 4:133528327-133528349 ATCAAAATGAAAAAGCGGCAAGG + Intergenic
980567803 4:134568164-134568186 AAAAATACAAAAAAGTAGCAAGG - Intergenic
980711960 4:136580718-136580740 AGGAATAAAATAAAGAAGCATGG - Intergenic
980734360 4:136866167-136866189 TTGAATATAAAAATGAAGAAAGG - Intergenic
981001167 4:139830573-139830595 AAAAATATAAAAAATTAGCATGG - Intronic
981035750 4:140167219-140167241 AAAAATATAAAAAATTAGCATGG - Intergenic
981074572 4:140578246-140578268 ATAAACAAAAAAAAGAAGCATGG + Intergenic
981182671 4:141764083-141764105 ATAAATATAAAAAATGAGCTGGG + Intergenic
981728862 4:147876430-147876452 AAAAATACAAAAAATCAGCAGGG + Intronic
981864947 4:149406388-149406410 ATGAATAGAATAAACCAGTAAGG + Intergenic
982014385 4:151138986-151139008 ATAAATACAAAAAAGTAGCCGGG - Intronic
982135825 4:152273101-152273123 AAAAATATAAAAAATCAGCCGGG + Intergenic
982272986 4:153610382-153610404 ATAAATAAAATAAAGCATCATGG - Intronic
982635935 4:157896728-157896750 ATGAATAAAAAATGGCAACAAGG - Intergenic
982738036 4:159026596-159026618 ATGAAAAAAAAGAAGCAGTATGG - Intronic
982928754 4:161375042-161375064 ATGGAAATGAATAAGCAGCACGG + Intergenic
983431565 4:167657608-167657630 AAAAATATAAAAAATCAGCTGGG - Intergenic
983678015 4:170318704-170318726 ATGAAAATAAAAAAAAAGCAGGG + Intergenic
984077346 4:175199748-175199770 ATGAATCTAAAATTGCAGCTTGG + Intergenic
984178264 4:176447462-176447484 ATTAAGATCAAAAGGCAGCAAGG - Intergenic
985059774 4:186065830-186065852 ATGAACATACCAAACCAGCAAGG - Intergenic
1202770739 4_GL000008v2_random:204149-204171 CTGAATATAAAAAATTAGCCGGG + Intergenic
985626100 5:989182-989204 AAAAATATAAAAAATCAGCCAGG + Intergenic
986014366 5:3745027-3745049 ATGAAGATCAAAAAGCAGCAAGG + Intergenic
986252705 5:6075351-6075373 ATGAAGATAAAAAAGGAACATGG + Intergenic
986377667 5:7148793-7148815 ATGAAAAAAGAGAAGCAGCAAGG + Intergenic
986452771 5:7882540-7882562 AGGAATATAGAAAAGGAGTAGGG + Intronic
986897758 5:12391255-12391277 CTGAAAACAAAAAAGCAGTAAGG - Intergenic
986986792 5:13509429-13509451 ATGATGATTAAAAAACAGCATGG - Intergenic
987034784 5:14008461-14008483 AAAAATACAAAAAAGTAGCAGGG + Intergenic
987226279 5:15844910-15844932 ATGAATATAAGAAAGCTCAATGG + Intronic
987289606 5:16496013-16496035 ATTTATTTAAAAAAGGAGCAAGG + Intronic
987467047 5:18284648-18284670 AAAAATATAAAAAATTAGCAGGG + Intergenic
987977134 5:25028942-25028964 ATAAATAAATAAAAGTAGCAGGG + Intergenic
988214339 5:28251614-28251636 AAAAATATAAAAAATTAGCAGGG - Intergenic
988246395 5:28688027-28688049 ATAAAAATAAAAAAGTAGCCAGG - Intergenic
988799341 5:34681796-34681818 ATGAAAAAAGAAATGCAGCAGGG - Intronic
988849733 5:35168295-35168317 ATGAAAATAAAAAATTAGTAAGG + Intronic
988889768 5:35602211-35602233 AAGAATATAAAAAAATAGCCAGG + Intergenic
988932606 5:36051420-36051442 ATGAATATATATAAGAAGAAGGG + Intronic
989012853 5:36892938-36892960 ATAATAATAAAAAAGTAGCATGG + Intronic
989253234 5:39339818-39339840 AAAAATACAAAAAATCAGCAGGG - Intronic
989626836 5:43437803-43437825 ATGAAGTTAAAGAAGCAGGATGG + Intergenic
989747462 5:44847131-44847153 ATGAATATAAATAACCAGGTGGG + Intergenic
990087534 5:51997167-51997189 GGAAATATAAAAATGCAGCAAGG + Intergenic
990346636 5:54878087-54878109 AAAAATATAAAAAATTAGCAGGG + Intergenic
990451847 5:55940651-55940673 GTTAATATAAAAGAGGAGCAAGG - Exonic
990459400 5:56017101-56017123 AAGAATATAAAAAATTAGCCAGG - Intergenic
990593109 5:57285333-57285355 AAGAATAAAAAAAAGAAGCGTGG + Intergenic
990854445 5:60248285-60248307 TGGCATATAAAAGAGCAGCAAGG + Intronic
990997555 5:61747696-61747718 AAAAATATAAAAAATTAGCAGGG - Intronic
991208993 5:64083402-64083424 ATGAACAAAATAAAGCACCAGGG - Intergenic
991268229 5:64747765-64747787 AAAAATATAAAAAAGTAGCCGGG + Intronic
991473236 5:66992206-66992228 ATGAAGATTATATAGCAGCATGG - Intronic
991515398 5:67429344-67429366 ATGAAAATAACTAAGAAGCAAGG - Intergenic
991577314 5:68118486-68118508 AGGAATATAAAAAAGGGGCTGGG + Intergenic
991710346 5:69402492-69402514 AAAAATATAAAAAATCAGCCGGG + Intronic
992613681 5:78529803-78529825 AAGAATTTATAAAAGCATCAGGG + Intronic
993140443 5:84026396-84026418 ATGAAGATAAAAAAGAAAGATGG - Intronic
993167808 5:84380827-84380849 ATGACTAAAATAAAGTAGCATGG - Intronic
993302261 5:86225782-86225804 ATGATTAAAAACATGCAGCAGGG + Intergenic
993881126 5:93362234-93362256 ATAATTATATATAAGCAGCATGG - Intergenic
994384446 5:99113172-99113194 AAAAATATAAAAAATTAGCAGGG + Intergenic
994458293 5:100042921-100042943 ATCAATATAAAGAAAAAGCAAGG + Intergenic
994518814 5:100803194-100803216 ATGATCATAGAAAAGCAGAAAGG + Intergenic
994750300 5:103728937-103728959 ATGAATACCAAAAGGGAGCAAGG - Intergenic
994761252 5:103856960-103856982 AAAAATACAAAAAAGCAGCCAGG - Intergenic
994939607 5:106305119-106305141 AAAAATACAAAAAATCAGCAGGG + Intergenic
995096981 5:108247971-108247993 ATGCAGATAAAAAAGCCCCAAGG - Intronic
995375995 5:111475000-111475022 AAAAATATAAAAAATTAGCAGGG + Intronic
995795615 5:115938160-115938182 ATGGATAGAAAAAAGTAGGAAGG - Intergenic
995891169 5:116953584-116953606 ATGAAAATAAAATAACAGCAAGG + Intergenic
996384879 5:122900606-122900628 AAAAATATAAAAAATCAGCCAGG + Intronic
996529508 5:124512838-124512860 AAGAAAATAGAAAAGGAGCATGG + Intergenic
996696773 5:126405723-126405745 TTTAATATAAAATAGCAGGATGG - Intronic
996720419 5:126624606-126624628 ATGAAAATAAAAAAGCTGCTAGG + Exonic
996773264 5:127107829-127107851 ATGAATAAAATGAAGCAGGAAGG - Intergenic
997150069 5:131483938-131483960 AAGAATACAAAAAATTAGCATGG + Intronic
997906976 5:137827319-137827341 AAGAATATAAAAATGCTGGAGGG + Intergenic
998171746 5:139876499-139876521 ATTAATTTAAAAAAGCACCCGGG + Intronic
998251213 5:140554262-140554284 ATGAATTTAAACTATCAGCATGG - Intronic
998288721 5:140891203-140891225 ATGATTATAAAGACACAGCATGG - Intronic
998863433 5:146469652-146469674 CTGAATATAAAACAGCAGATGGG + Exonic
999135159 5:149313836-149313858 ATGAAGATGAAAAATTAGCAGGG + Intronic
999854854 5:155583104-155583126 ATAAATAGAAAAAAGGATCATGG + Intergenic
999977371 5:156925147-156925169 AAAAATATAAAAAATCAGCCAGG + Intronic
1000090882 5:157928816-157928838 AAAAATATAAAAAAGTAGCCGGG - Intergenic
1000258455 5:159562988-159563010 CCCTATATAAAAAAGCAGCAGGG - Intergenic
1001034373 5:168287083-168287105 ATAAATAAAAAGAACCAGCAAGG + Intergenic
1001205160 5:169755581-169755603 ATAAATATAAAAAACTAGCCGGG + Intronic
1001218009 5:169874115-169874137 ATTAAAATAAAAAAGCGGCCGGG + Intronic
1002460319 5:179370050-179370072 ATCATTGAAAAAAAGCAGCATGG + Intergenic
1002692934 5:181063341-181063363 AAAAATATAAAAAATCAGCTGGG + Intergenic
1002770440 6:286174-286196 AAAAATATAAAAAATTAGCAGGG + Intergenic
1003999572 6:11584584-11584606 ATGAATAAAAAAAATTACCAAGG - Intergenic
1004652390 6:17622967-17622989 AAAAATATAAAAAATCAGCCAGG + Intronic
1005117019 6:22350369-22350391 ATAAATATAAGAAAGCAAGATGG - Intergenic
1005461425 6:26073185-26073207 AAAAATATAAAAAATTAGCAGGG - Intergenic
1005896483 6:30183529-30183551 ATGAATATAAAAAATAAAAAGGG + Intergenic
1006309125 6:33244931-33244953 AAAAATATAAAAAATCAGCTAGG - Intergenic
1006542274 6:34750103-34750125 AAGAATATAAAAAGGCAGTCAGG + Intergenic
1006635274 6:35457285-35457307 ATAAATATAAAAAATTAGCCAGG - Intronic
1006938678 6:37736847-37736869 ATGTATGTGAAAATGCAGCATGG + Intergenic
1007036133 6:38675514-38675536 ATGAATTTAAAGAATGAGCAAGG + Intergenic
1007423209 6:41732019-41732041 ATAAAAATAAAAAAGCAGGGTGG - Intronic
1007439270 6:41844058-41844080 ATAAATACAAAAAATCAGCCAGG + Intronic
1008068623 6:47076510-47076532 ATGAATAGAAAAAGGCCACAAGG - Intergenic
1008180240 6:48319239-48319261 ATAAATATAAAATAGGGGCATGG + Intergenic
1008348062 6:50454008-50454030 AAGACTAAAATAAAGCAGCAAGG + Intergenic
1008419276 6:51278305-51278327 ATGAATAAACAAAAGCATAAAGG - Intergenic
1008733439 6:54512161-54512183 AAAAATATAAAAAATTAGCAGGG - Intergenic
1008810863 6:55497112-55497134 ATGAATGCATAAAGGCAGCATGG + Intronic
1008969407 6:57349046-57349068 ATGAATATAAAAAGTCAAAAAGG - Intronic
1009042186 6:58191797-58191819 ATGAATACCTAAAAGGAGCAAGG - Intergenic
1009158380 6:60250877-60250899 ATGAATATAAAAAGTCAAGAAGG - Intergenic
1009218023 6:60946031-60946053 ATGAATACCTAAAAGGAGCAAGG - Intergenic
1009635648 6:66261186-66261208 AAAAAAATAAAAAAGAAGCAGGG + Intergenic
1009642366 6:66354658-66354680 TTGAATTTAAGAAAGAAGCATGG - Intergenic
1009800946 6:68535495-68535517 ACGAAAATAAAAAATTAGCAGGG + Intergenic
1009861250 6:69335880-69335902 CTGATTATAAAAAAGAAGAAAGG - Intronic
1009886738 6:69632336-69632358 AGGAATATAAAAAAGAAACCAGG + Intergenic
1010213475 6:73381682-73381704 ATTAATATAAAAAACCAGGCTGG + Intronic
1010282021 6:74033498-74033520 ATGGAAAAAAAAAAACAGCAGGG - Intergenic
1010341492 6:74758765-74758787 ATCAATTTAAAAAAGCTGCCAGG + Intergenic
1010414131 6:75594179-75594201 AAGAATATAAAAAATTAGCTGGG + Intergenic
1010565092 6:77400973-77400995 AAGAATATAAAAAATTAGCCAGG + Intergenic
1010820465 6:80409746-80409768 ATGGAAAGCAAAAAGCAGCAGGG - Intergenic
1010838117 6:80614409-80614431 ATGGAAATAAAAAAAAAGCAGGG + Intergenic
1011082197 6:83501799-83501821 ATAAATAAAATAAATCAGCAAGG + Intergenic
1011132097 6:84062331-84062353 ATGTACAGAAAAAAGAAGCAAGG - Intronic
1011301226 6:85876722-85876744 ATGGAAATAAAAAAAAAGCAGGG - Intergenic
1011655143 6:89545050-89545072 AAAAATATAAAAAATTAGCAGGG + Intronic
1012192951 6:96302982-96303004 ACCAATATAAAAATGCAGCAAGG + Intergenic
1012727867 6:102839265-102839287 CTGAATATAATAAATAAGCAGGG + Intergenic
1012833064 6:104230009-104230031 ATTAATATAAAAATGCAGGCTGG + Intergenic
1013135897 6:107282551-107282573 ATTAAAAAAAAAAAGCAGCCAGG - Intronic
1013146285 6:107396847-107396869 ATAAAAATAAAAAATCAGCCAGG - Intronic
1013220143 6:108071025-108071047 AAAAATATAAAAAATCAGCCGGG + Intronic
1013248262 6:108308864-108308886 AAAAATACAAAAAAGCAGCTGGG - Intronic
1013305748 6:108845827-108845849 ATGCATGTATAATAGCAGCATGG + Intergenic
1014365047 6:120529345-120529367 ATGAATAGAGACAAGCAGGATGG - Intergenic
1014475612 6:121868939-121868961 AAGAATATAAAAAATTAGCCGGG + Intergenic
1014648497 6:124005869-124005891 ATGAATAGATATAAGAAGCAGGG - Intronic
1014975351 6:127874735-127874757 ATGGCTATAAAAAAGCAACATGG + Intronic
1014991222 6:128079717-128079739 ATGAATATAAAGACAAAGCATGG + Intronic
1015237065 6:130983686-130983708 AAAAATAAAAAAAATCAGCAGGG - Intronic
1015543561 6:134339983-134340005 AAGAAAATGAGAAAGCAGCATGG + Intergenic
1015839588 6:137462352-137462374 ATAAATAAATAAAACCAGCAAGG + Intergenic
1015887362 6:137931509-137931531 ATGAGTAGAAAAAAGCTCCAAGG + Intergenic
1016087929 6:139937645-139937667 AAAAATATAAAAAATTAGCAGGG - Intergenic
1016203513 6:141443116-141443138 ATGAAAATAAAAATATAGCAAGG + Intergenic
1016542948 6:145187308-145187330 ATTAATAGGAAAAAGCAGAAAGG + Intergenic
1016716000 6:147229722-147229744 ATGAATAAAAAAGTTCAGCAAGG - Intronic
1016922140 6:149306387-149306409 AAAAATATAAAAAATTAGCAGGG + Intronic
1016946361 6:149538103-149538125 ATAAATACAAAAAATCAGCCGGG + Intronic
1016978055 6:149828302-149828324 AATAAAATAAAAAAGCTGCATGG - Intronic
1017121266 6:151026225-151026247 ATGAATTTAATAAAGCATGAAGG + Intronic
1017617608 6:156261626-156261648 AAAAATATAAAAAATCAGCTGGG + Intergenic
1017697812 6:157036213-157036235 ATGAATTTTAAAAAGCTGCGAGG - Intronic
1017801892 6:157904273-157904295 AAAAATATAAAAAAGTAGCTGGG + Intronic
1017803067 6:157916193-157916215 AAAAATATAAAAAATTAGCAGGG - Intronic
1018090086 6:160338701-160338723 ATGAATACAACAATACAGCATGG - Intergenic
1018602121 6:165555566-165555588 ATGTATCTAAAACAGTAGCATGG - Intronic
1018770284 6:166964602-166964624 AAAAATATAAAAAATCAGCCAGG - Intergenic
1019583659 7:1783319-1783341 AAAAATATAAAAAATCAGCTGGG - Intergenic
1019644786 7:2123307-2123329 AAAAAAAAAAAAAAGCAGCAGGG + Intronic
1019990625 7:4688025-4688047 ATGTATTTAAAAAAGCAGCTGGG - Intronic
1020030133 7:4926903-4926925 AAAAATATAAAAAATCAGCTGGG - Intronic
1020088973 7:5326961-5326983 AAAAATATAAAAAAGTAGCTGGG + Intronic
1020733356 7:11912917-11912939 ATGACTATATAAAGGCAGAAAGG + Intergenic
1021036249 7:15802750-15802772 ATAAAAATAAAGAAGCAACAGGG + Intergenic
1021132158 7:16924381-16924403 ATAAATACAAAAAATCAGCCAGG - Intergenic
1021152783 7:17172302-17172324 ATCAAAATGAAAAAGCAACATGG + Intergenic
1021331575 7:19344611-19344633 ATAAATATAAAAAAACGGCCAGG - Intergenic
1021543132 7:21782747-21782769 AAAAATATAAAAAATCAGCCGGG + Intronic
1022386229 7:29901675-29901697 AAAAATATAAAAAAGTAGCCAGG + Intronic
1022917103 7:34968473-34968495 AAAAATATTAAAAAGCAGCCAGG + Intronic
1023679174 7:42666530-42666552 AAAAATAAATAAAAGCAGCATGG + Intergenic
1023828043 7:44022860-44022882 AAAAATTTAAAAAATCAGCAGGG + Intergenic
1024730936 7:52253140-52253162 ATGAATATATTAAGGAAGCAGGG + Intergenic
1024748342 7:52432426-52432448 AAGAAAATAAAAAAGCAGTTTGG + Intergenic
1024895418 7:54255455-54255477 ATGAATATAAATATCCAGGATGG - Intergenic
1024998500 7:55294620-55294642 AGGAATCTAAAAAGGCAGCCTGG + Intergenic
1025037239 7:55602955-55602977 ATCAACACAAATAAGCAGCAGGG + Intergenic
1025205341 7:56990165-56990187 AAAAATATAAAAAAGTAGCCGGG - Intergenic
1025261613 7:57424077-57424099 ATGTATATAAAAATGAATCATGG + Intergenic
1025666597 7:63586772-63586794 AAAAATATAAAAAAGTAGCCGGG + Intergenic
1025984634 7:66438344-66438366 AGGAAATTAGAAAAGCAGCAGGG - Intergenic
1026030080 7:66784601-66784623 AGGAAATTAGAAAAGCAGCAGGG + Intronic
1026332718 7:69366708-69366730 GAAAATATAAAAAATCAGCAAGG - Intergenic
1026474043 7:70718726-70718748 AAGTATATGAAGAAGCAGCAGGG - Intronic
1026505483 7:70979280-70979302 ATGAAGATCAGAAAGCATCAAGG + Intergenic
1026509345 7:71015586-71015608 ATGGATATTAAGAAGCAGAAGGG + Intergenic
1026540715 7:71277515-71277537 AAGAATATTACAAAACAGCAAGG + Intronic
1026835617 7:73637173-73637195 TTGAAAATAAAAAAGCAAAAAGG + Intergenic
1026889514 7:73973866-73973888 AAAAATATAAAAAATTAGCAGGG - Intergenic
1027113365 7:75458366-75458388 CTAAATATAAAAAATCAGCTGGG + Intronic
1027207839 7:76116933-76116955 AGGAAATTAGAAAAGCAGCAGGG - Intergenic
1027234565 7:76290476-76290498 AAGAAAAGAAAAAAGCAGGAGGG - Intergenic
1027411338 7:77922181-77922203 ATAAAAATAAAAAATCAGCCAGG - Intronic
1027443924 7:78250124-78250146 ATGAATATTAAAAAACAGCAAGG + Intronic
1027703556 7:81500071-81500093 AAAAATATAAAAAATTAGCAGGG - Intergenic
1027783962 7:82555703-82555725 ATGGAAATAAAAAATGAGCAGGG + Intergenic
1027808655 7:82863694-82863716 ATGAATATTAGAAAGCTGGAGGG - Intronic
1027844725 7:83358068-83358090 AAAAATATAAAAAATCAGCCAGG + Intergenic
1028038059 7:86010544-86010566 GTGAATTAAAAAAAGGAGCAAGG - Intergenic
1028443603 7:90892937-90892959 AAAAATATAAAAAATCAGCCGGG - Intronic
1028448268 7:90950235-90950257 TTGAAAATAAAAAATCAGCTGGG - Intronic
1028534355 7:91875408-91875430 ATAAAAATAAAAAATCAGCTGGG - Intronic
1028775856 7:94675292-94675314 AAAAATATAAAAAATTAGCAGGG + Intergenic
1028811314 7:95090511-95090533 AAGAAAATAAAAAATCAGCCAGG + Intronic
1028927665 7:96377138-96377160 ATAAATACAAAACAGTAGCAGGG - Intergenic
1029756348 7:102576304-102576326 AAAAATTTAAAAAATCAGCAGGG + Intronic
1029774290 7:102675383-102675405 AAAAATTTAAAAAATCAGCAGGG + Intergenic
1029936560 7:104431204-104431226 ATCAATTTACAAAAGCAGTAGGG - Intronic
1030028589 7:105348849-105348871 ATGAATATATCAGAGCAGCCGGG + Intronic
1030249257 7:107424110-107424132 TTGAATACAAAAAATTAGCAGGG + Intronic
1030771829 7:113484846-113484868 AAGAATACAAAAAATCAGCCGGG + Intergenic
1031630289 7:124035752-124035774 ATGAAAATATAAAAGAAACATGG - Intergenic
1031719933 7:125161578-125161600 AAAAATATAAAAAATCAGCCAGG + Intergenic
1031729628 7:125282744-125282766 TTGCATATAAAAAATTAGCAGGG + Intergenic
1031890564 7:127289045-127289067 ATAAAAATAAAAAATCAGCCAGG - Intergenic
1032517283 7:132516485-132516507 CTGAAAATAAAATTGCAGCATGG + Intronic
1032883220 7:136112679-136112701 ATGGAAAGAAAAAAGAAGCAGGG - Intergenic
1033133554 7:138766050-138766072 ATGAAATTAAAACAGCACCAGGG - Intronic
1033394956 7:140964728-140964750 AAGAAAATAAAAAGGCAGCCAGG - Intergenic
1033863049 7:145653368-145653390 AAGAAAAGAAAAAAGAAGCAGGG - Intergenic
1033938539 7:146620814-146620836 AAGAAAGTAAAAAAGCAGAAAGG - Intronic
1033988199 7:147251959-147251981 ATTAATAAAAAAAAACAGCAAGG + Intronic
1035848698 8:2892311-2892333 ATGAATAAAAAACAGTAGCGAGG - Intergenic
1035932971 8:3804865-3804887 ATGATTATAAAAAAGTAGCATGG + Intronic
1036152257 8:6309501-6309523 AAAAATATAAAAAAGTAGCCAGG - Intergenic
1036176063 8:6539560-6539582 ATGACTAGAAAAAAGCAAAAAGG - Intronic
1037556151 8:20024687-20024709 ATAAATATAAAAAATCACCTGGG - Intergenic
1037646177 8:20794765-20794787 AAAAAAAAAAAAAAGCAGCATGG + Intergenic
1037727555 8:21495669-21495691 AAAAAAAAAAAAAAGCAGCAAGG - Intergenic
1037999758 8:23381670-23381692 ATGAATCTTACAAAGCAACAAGG - Intronic
1038026978 8:23599794-23599816 GTGACTAAAAAAGAGCAGCATGG - Intergenic
1038219569 8:25594583-25594605 AAGAATATAAAAAATTAGCCAGG - Intergenic
1038587143 8:28800208-28800230 ATGAATATATAAAAAGAACATGG + Intronic
1038759626 8:30374621-30374643 AAAAATACAAAAAATCAGCAGGG - Intergenic
1038772620 8:30497381-30497403 AGAAATATAAAAAATCAGCTGGG + Intronic
1038923021 8:32106671-32106693 ATATATAGAAGAAAGCAGCAAGG + Intronic
1038944807 8:32346988-32347010 AAAAATATAAAAAAGTAGCCAGG - Intronic
1039093338 8:33856512-33856534 ATGAAAATAAAACAGCAGGCTGG + Intergenic
1039206005 8:35155568-35155590 ATGAATAAATAAAAACAGTAGGG + Intergenic
1039409819 8:37343279-37343301 ATGAATATAAAAACCCAACAAGG - Intergenic
1039498437 8:37998694-37998716 GTGAAAAGAAAAAAGCAGCCAGG + Intergenic
1039646249 8:39286731-39286753 ATAAAAAAAAAAAAGCTGCACGG - Intergenic
1039988316 8:42466648-42466670 AAGAAAAGAAAAAAGCAACATGG - Intronic
1039998002 8:42551155-42551177 AAAAATATAAAAAATTAGCAGGG + Intronic
1040040215 8:42908978-42909000 CTGAATTTAAAAAAGCATGAAGG + Intronic
1040480480 8:47821985-47822007 ATGAATAGAAAAACCCAGCTGGG + Intronic
1040502821 8:48020194-48020216 AAAAATATAAAAAATTAGCAAGG - Intronic
1040505749 8:48046277-48046299 AAAAATACAAAAAATCAGCAGGG - Intronic
1040663483 8:49602783-49602805 ATGAATATGGAAATGCAGCATGG - Intergenic
1041291298 8:56310802-56310824 ATGAGTATAAGCAAGCACCAAGG + Intronic
1041532362 8:58883944-58883966 ATGAATGGAAAGAAGCAACAAGG + Intronic
1041543250 8:59010818-59010840 GTTAATTTAAAAGAGCAGCAGGG + Intronic
1041577481 8:59416022-59416044 TTGAATATATAAATGAAGCAGGG - Intergenic
1042128819 8:65566154-65566176 ATTAAGATAAAATAGCAGCGTGG + Intergenic
1042140688 8:65675436-65675458 ATAAATATAAAAAATTAGCTGGG + Intronic
1042156310 8:65847885-65847907 ATGAACAGAAAAAAGAAACAAGG + Intergenic
1042316186 8:67428642-67428664 AAGAATACAAAAAAATAGCAAGG - Intronic
1042882270 8:73506809-73506831 TTGTTTATAAAACAGCAGCAGGG - Intronic
1043672655 8:82907140-82907162 ACTAATATTAAAAAGAAGCAAGG - Intergenic
1043709053 8:83391515-83391537 ATACATACAAAAAAGAAGCAAGG - Intergenic
1044264111 8:90162628-90162650 AAGAAAATAAAAAAACAACAAGG + Intergenic
1044547379 8:93474814-93474836 ATGAATACACAAAAGGTGCAAGG - Intergenic
1044722861 8:95167753-95167775 TTGAGTATCAACAAGCAGCAGGG - Intergenic
1044976849 8:97673497-97673519 AAAAATACAAAAAATCAGCAGGG + Intronic
1045857070 8:106776815-106776837 AAAAATATAAAAAATCAGCCGGG - Intergenic
1045997113 8:108375954-108375976 ATGGATAGAAAAAATCAGTATGG - Intronic
1046100237 8:109605467-109605489 TTGAATGAAAAAAAGGAGCAGGG - Intronic
1046157224 8:110308499-110308521 AAAAATATAAAAAAGTAGCCGGG + Intergenic
1046500922 8:115075501-115075523 ATGAAAAGAAAAAAGAAACAAGG - Intergenic
1046560773 8:115834506-115834528 ATGAAAAAAAAAAAGAAGAAGGG - Intergenic
1046922068 8:119741433-119741455 AAGAATACAAAAAATCAGGAAGG + Intronic
1047020792 8:120773107-120773129 ATAATTTTAAAAAATCAGCAAGG + Intronic
1047253803 8:123200655-123200677 AAAAATATAAAAAATCAGGAGGG + Intronic
1047345008 8:124019245-124019267 ATGAATATACATAATCATCAAGG - Intronic
1047583618 8:126244307-126244329 ATGATTTTAAAAAAGGAGCCAGG + Intergenic
1048660013 8:136588697-136588719 AAAAATACAAAAAAGTAGCAGGG - Intergenic
1048768888 8:137873924-137873946 ATGACTATTAAAAACTAGCAAGG + Intergenic
1050302400 9:4273168-4273190 ATGAAGACAGAAATGCAGCAAGG + Intronic
1050342030 9:4649961-4649983 CTGAATCTTAAAAAGCAGGAAGG - Intronic
1050817827 9:9837745-9837767 AAGAATAAAAAAATGCAGCAAGG - Intronic
1050884423 9:10746007-10746029 ATAAATACAAAAAATCAGCCAGG + Intergenic
1051434026 9:17011685-17011707 ATGAAAAAAAAAAATCAGAATGG - Intergenic
1051512251 9:17891176-17891198 AAAAATATAAAAAATTAGCAGGG + Intergenic
1052125463 9:24769290-24769312 ATGAATATCAAAAGGCACCCAGG - Intergenic
1052535653 9:29743152-29743174 ATATATATAAAAAATTAGCAAGG - Intergenic
1052849478 9:33368072-33368094 AAAAATATAAAAAAGTAGCCGGG + Intronic
1053249911 9:36565814-36565836 ATGAAAATAAAAAGTAAGCAAGG - Intergenic
1053508483 9:38667103-38667125 AAAAATATAAAAAAGTAGCCAGG + Intergenic
1053891817 9:42701383-42701405 AAAAATATAAAAAATCAGCCAGG + Intergenic
1054358403 9:64087753-64087775 CTGAATATAAAAAATTAGCAGGG - Intergenic
1054728870 9:68680147-68680169 ATAAAGATAAAAAAGCGGGAAGG - Intergenic
1054736271 9:68753683-68753705 AAAAATATAAAAAATTAGCAAGG - Intronic
1054773111 9:69101405-69101427 AAAAATATAAAAAAGTAGCTGGG - Intergenic
1054968106 9:71053104-71053126 AAAAAAAAAAAAAAGCAGCAGGG + Intronic
1055218875 9:73903554-73903576 ATGAATATAAAATAGGAGCATGG - Intergenic
1055271636 9:74566806-74566828 ATAAATAAAATAAAGAAGCAGGG + Intronic
1055289224 9:74765557-74765579 ATTAAAATAAAGAAACAGCATGG + Intronic
1055294900 9:74824309-74824331 AAAAATACAAAAAAGCAGCCGGG - Intronic
1055322816 9:75099095-75099117 ATAAATACAAAAAAGTAGCTGGG - Intronic
1055399197 9:75905360-75905382 ATAAAAATAAAAAATTAGCAGGG + Intronic
1055404636 9:75962048-75962070 ATAAACATAAATAACCAGCATGG + Intronic
1055572015 9:77626059-77626081 AAGAAAAAAAAAAAGAAGCAGGG + Intronic
1055599866 9:77904491-77904513 AAAAATATAAAAAAGTAGCCAGG - Intronic
1055626082 9:78178749-78178771 AAGAATACACAAAAGCAACACGG + Intergenic
1055680466 9:78710024-78710046 AGGAAGATAAACAAGGAGCAGGG + Intergenic
1055841215 9:80506497-80506519 AAGAATATTAAAAAGAAGAAGGG - Intergenic
1055994885 9:82146594-82146616 ATGAATATAAACAAAAAGGAAGG + Intergenic
1056064394 9:82918173-82918195 ATCAACATAAAAAATCAACATGG - Intergenic
1056368996 9:85935670-85935692 ATAAGTAGAAAAAAGCAGCAAGG + Intergenic
1056559268 9:87716108-87716130 AAAAAAAAAAAAAAGCAGCAAGG + Intergenic
1056607441 9:88098129-88098151 AAGAATATAAAAAATTAGCTGGG - Intergenic
1057229822 9:93314285-93314307 ATAAAAATAAAAAAACAGCTGGG + Intronic
1057431414 9:94997852-94997874 ATGAAAATAAAAAATTAGCTGGG - Intronic
1058048793 9:100385830-100385852 ATAAATACAAAAAAGTAGCCGGG - Intergenic
1058380120 9:104368487-104368509 ATAAATAATAAAAAGAAGCAAGG - Intergenic
1058674828 9:107391311-107391333 AAGAATACAAAAAATCAGCCGGG - Intergenic
1059177344 9:112179364-112179386 AAAAATATAAAAAAGTAGCTAGG + Intergenic
1059757302 9:117305422-117305444 ATGTATTTAAAAAAATAGCAGGG - Intronic
1059912108 9:119056004-119056026 ATGCACATAAAAAAGTAGAAAGG - Intergenic
1059941760 9:119366881-119366903 AGGAATATTAAAGAGCAGAAAGG - Intronic
1060107336 9:120881306-120881328 AAAAATATAAAAAATCAGCGGGG - Intronic
1060644863 9:125269582-125269604 AAAAATATAAAAAATGAGCAGGG - Intronic
1061144466 9:128789160-128789182 AAAAATATAAAAAAGTAGCTGGG + Intronic
1061705656 9:132451175-132451197 ATGAATACAAAAAATTAGCCGGG + Intronic
1062183052 9:135201223-135201245 AATAATATAAAAAATCAGAACGG - Intergenic
1062211655 9:135367565-135367587 ATAAATACAAAAAATCAGCCAGG + Intergenic
1062563471 9:137152065-137152087 AAAAATACAAAAAAGTAGCAGGG - Intronic
1062720468 9:138040096-138040118 ATAAATATAAAAAATTAGCTGGG - Intronic
1203483830 Un_GL000224v1:32890-32912 AAAAATATAAAAAATCAGCCAGG + Intergenic
1203703910 Un_KI270742v1:19603-19625 CTGAATATAAAAAATTAGCTGGG - Intergenic
1185548083 X:961838-961860 AAGAAAATAAAAAAGCAGGCTGG - Intergenic
1185923043 X:4115118-4115140 AAAAATACAAAAAAGCAGCTGGG - Intergenic
1186011817 X:5142824-5142846 CTAAACATAAAAAAGCAGCCGGG + Intergenic
1186253741 X:7697725-7697747 CTGAACAGAAGAAAGCAGCAAGG - Intergenic
1187189381 X:17018960-17018982 ATAAAAATAAAAAATCAGCTGGG - Intronic
1188061733 X:25609519-25609541 ATGAATAAAAAATAGAAGTAAGG + Intergenic
1188572243 X:31601877-31601899 ATAAAAAGAAAAAAGCATCAAGG + Intronic
1188728268 X:33611670-33611692 ATAAAAATAAAAAAGTAGTAGGG + Intergenic
1188819582 X:34757979-34758001 ATGCATAAAAAAGAGCAGTAAGG - Intergenic
1189098800 X:38167919-38167941 ATGAATAAATAAAATCAGCTAGG - Intronic
1189215276 X:39317727-39317749 ATCTATATAAAAATGCAGAAGGG - Intergenic
1189302496 X:39962250-39962272 AAGAAGAAAAAAAAGAAGCAAGG + Intergenic
1189339990 X:40197656-40197678 AAAAATATAAAAAATCAGCCAGG - Intergenic
1189577786 X:42373755-42373777 AAGAAAAAAAAAAAGCAGGATGG + Intergenic
1189671293 X:43412873-43412895 AAGAAAGTAAAAAATCAGCAAGG - Intergenic
1190156579 X:47998243-47998265 ATGTATATAAAAAATTAGCTAGG - Intronic
1190421299 X:50287308-50287330 ATGAATATTTTAAAGCAGAAGGG - Intronic
1190576783 X:51847555-51847577 AGGAAAAAAAAAAATCAGCAAGG + Intronic
1190924480 X:54889829-54889851 ATGGAAATAAAAAAAAAGCAGGG + Intergenic
1191071804 X:56408865-56408887 ATGGAAATCAAAAAGTAGCAGGG - Intergenic
1191591002 X:62884962-62884984 AAGAAAAGAAAAAAGGAGCAGGG - Intergenic
1191840027 X:65506327-65506349 ATGAATACATAAATACAGCATGG + Exonic
1192134380 X:68583308-68583330 AAAAATATAAAAAAGTAGCCGGG - Intergenic
1192390848 X:70726824-70726846 ATGAAAAAAAAAAAGCAGCCAGG - Intronic
1192787032 X:74345797-74345819 AGAAAAAAAAAAAAGCAGCATGG + Intergenic
1192907279 X:75565097-75565119 ATGAAAAACAAAAAGAAGCAGGG - Intergenic
1193596284 X:83450564-83450586 ATGAATTAAGTAAAGCAGCAGGG - Intergenic
1193788884 X:85795013-85795035 ATGAAAAAAAGAAAACAGCAGGG - Intergenic
1193821983 X:86176103-86176125 ATGAGTATAACAAAGCAAGAGGG + Intronic
1194129343 X:90061106-90061128 ATGGATATAGAAAAGAACCATGG + Intergenic
1194471264 X:94300781-94300803 AAGGAAATAAAAAAGCAGCAAGG - Intergenic
1194775444 X:97957309-97957331 ACGAATCTAAAACAGAAGCAGGG - Intergenic
1194865689 X:99063135-99063157 ATGAAAATAAGAAATCAGAAAGG + Intergenic
1194924001 X:99802583-99802605 TTGAGTATAAAAGAGCAGAATGG + Intergenic
1195433338 X:104814006-104814028 ACAAATTTAAAAAGGCAGCAGGG - Intronic
1195492431 X:105486929-105486951 AAAAATACAAAAAAGCAGCCAGG + Intronic
1195551377 X:106175399-106175421 AAAAATACAAAAAATCAGCAGGG - Intronic
1195563284 X:106310862-106310884 AAGAATATAAAAAATTAGCCAGG - Intergenic
1196210189 X:112987193-112987215 AAGAATACAAACAAGCAGTAAGG - Intergenic
1196406621 X:115369391-115369413 ATGAATATGAAAAAAAAGCATGG - Intergenic
1196649366 X:118153137-118153159 AAGAAGTTAAAAAAGCAACAGGG - Intergenic
1196673082 X:118390052-118390074 ATAAATATAAAAAATTAGCCTGG - Intronic
1196899834 X:120371827-120371849 AAGAATACAAAAAATTAGCAGGG - Intronic
1197026232 X:121753172-121753194 ATGTCTATGAAAAAGCAGTATGG + Intergenic
1197266225 X:124375241-124375263 ACACACATAAAAAAGCAGCAGGG + Intronic
1197452564 X:126638217-126638239 ATTAATAAAAAAAACCAGAAAGG - Intergenic
1197687696 X:129459611-129459633 ATGAATAAATAAAAGCTGCAGGG + Intronic
1198143023 X:133825014-133825036 AAAAATATAAAAAAGTAGCTTGG - Intronic
1198769421 X:140113639-140113661 ATGAATATAAAATTGCAGATAGG - Intergenic
1199267170 X:145841940-145841962 ATGAATATATAAATGCTACATGG + Intergenic
1200781877 Y:7224108-7224130 ATGAATATAAACATGGAACATGG - Intergenic
1201470545 Y:14329439-14329461 CTGAACAGAAGAAAGCAGCAAGG - Intergenic
1201665378 Y:16447377-16447399 ATGAATATAAAAAATCTTCAGGG - Intergenic
1201969687 Y:19777839-19777861 ATGTATATATAAAATCAGCTGGG + Intergenic