ID: 1097931247

View in Genome Browser
Species Human (GRCh38)
Location 12:65189369-65189391
Sequence CTCTGTGTCCGGAGGGCAGT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 233
Summary {0: 1, 1: 0, 2: 3, 3: 19, 4: 210}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1097931243_1097931247 -10 Left 1097931243 12:65189356-65189378 CCATAAACTCACTCTCTGTGTCC 0: 1
1: 0
2: 4
3: 23
4: 289
Right 1097931247 12:65189369-65189391 CTCTGTGTCCGGAGGGCAGTTGG 0: 1
1: 0
2: 3
3: 19
4: 210
1097931241_1097931247 25 Left 1097931241 12:65189321-65189343 CCAAGTAAAATAAAAAGGTTGAT 0: 1
1: 0
2: 4
3: 49
4: 441
Right 1097931247 12:65189369-65189391 CTCTGTGTCCGGAGGGCAGTTGG 0: 1
1: 0
2: 3
3: 19
4: 210

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1097931247 Original CRISPR CTCTGTGTCCGGAGGGCAGT TGG Intronic
900760404 1:4466719-4466741 CACTGTGTCTGCAGGGCAGTAGG - Intergenic
900760456 1:4466977-4466999 CACTGTGTCCAGGGGGCAGTGGG - Intergenic
901068890 1:6507609-6507631 CTCTGTTTCCGGGGGGCGGGGGG + Intronic
902375370 1:16027800-16027822 CTCTGGGGAAGGAGGGCAGTGGG - Exonic
902380334 1:16049597-16049619 CTCTGGGGAAGGAGGGCAGTGGG - Exonic
903019792 1:20386063-20386085 CTGTGTTTCTGGAGGGCAGAAGG - Intergenic
906152696 1:43596757-43596779 CTGTGTGTGCGGGTGGCAGTGGG + Intronic
906637591 1:47419437-47419459 CTCTTTGAGGGGAGGGCAGTAGG + Intergenic
906746619 1:48226417-48226439 CTCTGTGTTTGGGGCGCAGTGGG - Intronic
906886151 1:49650996-49651018 CTCTGTGTACGGAGGGCAGATGG - Intronic
907035766 1:51214887-51214909 CTTAGAGTCTGGAGGGCAGTTGG - Intergenic
907135733 1:52138164-52138186 CTCTGAGGCTGGAGTGCAGTGGG + Intergenic
907734479 1:57098475-57098497 TTGTGTGTCTGGAGGGCAGAAGG + Intronic
907955010 1:59219708-59219730 CTCTTTATCCTGAGAGCAGTGGG - Intergenic
911118542 1:94271902-94271924 CTTTGTGTCCAGAGGCAAGTAGG + Intronic
915941181 1:160119453-160119475 CTCTATTTCCTGAGGGAAGTGGG + Intronic
917368662 1:174263075-174263097 GTCTGTGTCAGGAAGGCTGTAGG - Intronic
918193371 1:182198134-182198156 CTCCTTGTCCTGAGGGCAGAGGG + Intergenic
920243779 1:204573049-204573071 CTCTGTGTTCAGGGGACAGTGGG + Intergenic
920682406 1:208083170-208083192 GTCTGTGTCCGGAAAGCTGTGGG - Intronic
923746092 1:236701471-236701493 CCCTGTGACTGGAGGGCTGTGGG + Intronic
1064208395 10:13344166-13344188 GACTGTGTCAGGAGGGCATTGGG - Intronic
1067544601 10:47183939-47183961 CTCTGTGGTTGGAGGGCAGAGGG + Intergenic
1067934051 10:50593062-50593084 CTCTGTTTTCGGAGGGAAGCTGG + Intronic
1069560872 10:69428416-69428438 CTCAGTGGAGGGAGGGCAGTTGG - Intergenic
1069613197 10:69789163-69789185 CTCTGTGTGGGGAAGGCTGTGGG + Intergenic
1071124446 10:82318058-82318080 CTTTGTGTCTGGTGGGCAGGGGG + Intronic
1071293470 10:84203223-84203245 CTCTGTGTGAGGAGGGCAACCGG - Intronic
1073106535 10:101035562-101035584 CCCTGTGTCCGGATGGAAGGCGG - Exonic
1073147516 10:101290694-101290716 CTCTGTGTGCGGATGTCACTGGG - Intergenic
1074224630 10:111472563-111472585 GTCTTTGTCCCGAGGGCAATGGG - Intergenic
1074707452 10:116147617-116147639 CTCTGTGTGAGGATGGCAGGTGG - Intronic
1076783475 10:132737228-132737250 GTGTGTGTCCAGAGGGCAGGTGG + Intronic
1077066563 11:643679-643701 CTCTTGGTCAGGAGGGCAGGGGG + Intergenic
1077257732 11:1596062-1596084 CTCGGTGTCCTGTGGGCTGTGGG + Intergenic
1078095050 11:8291689-8291711 CCCTGTTTCCGGAGGGCAGGTGG + Intergenic
1080681251 11:34478163-34478185 CTGCGTGTCCAGAAGGCAGTAGG + Intergenic
1080776974 11:35395101-35395123 CCCTGAGTAGGGAGGGCAGTGGG + Intronic
1083304714 11:61756336-61756358 CTCTGCCTCCAGAGGGCAGGAGG + Intronic
1083486018 11:62983496-62983518 CTGGGTGGCCGGAGGGGAGTGGG + Intronic
1083860115 11:65415862-65415884 CCCTGTGTGCGGGGAGCAGTTGG - Intergenic
1085345782 11:75767518-75767540 CTGTAGGTCAGGAGGGCAGTGGG - Intronic
1086436998 11:86791361-86791383 ATCTGTGTGCGGAGGGCAGAAGG + Intronic
1091064483 11:132496118-132496140 CTCTGTGCCAGGACTGCAGTGGG - Intronic
1091671581 12:2456010-2456032 TACTGTGTCTGGAGGTCAGTGGG - Intronic
1096795970 12:54077776-54077798 CTCTGTGCCCAGAGGGAATTAGG + Intergenic
1097931247 12:65189369-65189391 CTCTGTGTCCGGAGGGCAGTTGG + Intronic
1104076967 12:125398499-125398521 CTCAGTGTCAGGGAGGCAGTAGG + Intronic
1104714149 12:131005536-131005558 CTCTGCGTGTGGAGGGCAGACGG + Intronic
1104717873 12:131028606-131028628 TTCTGTGTCTGCAGTGCAGTAGG + Intronic
1104858043 12:131910983-131911005 CTCTGGGACCTGAGGGCTGTGGG - Intronic
1105767321 13:23574734-23574756 CTCTGTGATGGGAGGGCAGAGGG + Intronic
1106002155 13:25734275-25734297 CTCTGTGTCCAGCTGGGAGTAGG + Intronic
1106860871 13:33906911-33906933 CTCTGTGTCCCGAGTTCAGGTGG + Intronic
1112385407 13:98934886-98934908 CTCAGTGTCCGGAAGAAAGTAGG - Intronic
1113882309 13:113634136-113634158 CTCTGTGTCCGGCTGGCAGACGG + Intronic
1116871477 14:50072823-50072845 CTCGGTGGGCGGAGGGCGGTGGG + Intergenic
1118845373 14:69544058-69544080 CTCTGAGTAGGGAGGTCAGTAGG + Intergenic
1119414258 14:74459123-74459145 CTCTGTCTCTGGAGGGGAGAGGG + Intergenic
1120118404 14:80648186-80648208 CTCTGAGTCAGGAGAGCAGTTGG + Intronic
1120176708 14:81302019-81302041 CACTGTGCACTGAGGGCAGTTGG + Intronic
1120183364 14:81367793-81367815 CTCTGGGCCTGGAGGGCAGATGG + Intronic
1122419998 14:101569929-101569951 CTCTGTGTACACAGGGGAGTGGG - Intergenic
1202889638 14_KI270722v1_random:143911-143933 ATTTGTGTCAGGAGGGCAGAGGG - Intergenic
1124530434 15:30500750-30500772 ATTTGTGTCTGGAGGGCAGGGGG - Intergenic
1124598368 15:31110514-31110536 CTCTTTGTCTGGAAGGCAGAGGG + Intronic
1124632180 15:31344246-31344268 GCCTGTGTCAGGAGGGGAGTGGG + Intronic
1124768225 15:32506938-32506960 ATTTGTGTCTGGAGGGCAGGGGG + Intergenic
1126359142 15:47827944-47827966 CTCTATGAACGGAGGGAAGTGGG - Intergenic
1127110907 15:55669396-55669418 TGATGTGTCTGGAGGGCAGTAGG - Intronic
1128289065 15:66462978-66463000 TTCTCTGTCCAGAGGGCAGGAGG + Intronic
1128655952 15:69462244-69462266 CTCCGTGTCCAGAAGGAAGTGGG - Intergenic
1129233125 15:74207812-74207834 GTATGTGTGCGAAGGGCAGTTGG - Intronic
1129373164 15:75110451-75110473 CTCTGTGTCAGGTGGGAAGCCGG - Intronic
1132944200 16:2523618-2523640 CTCTGTGTGGGGAGGGCTGTGGG - Intronic
1132968828 16:2674908-2674930 CTGTGTCTCCAGAGGGCAGAGGG - Intergenic
1135588793 16:23690867-23690889 CTCTGAGTCTGGCGGGTAGTAGG + Exonic
1137068519 16:35877104-35877126 CTCAGTGTCTGGCTGGCAGTGGG - Intergenic
1143726353 17:8849567-8849589 CTCAGTGTCCAGCGAGCAGTTGG + Intronic
1144293773 17:13853937-13853959 CGCTGTGTCCTGTGAGCAGTGGG + Intergenic
1145931636 17:28690158-28690180 CTCTGTGTTGGGAGAGCGGTAGG - Exonic
1146002767 17:29141045-29141067 CCCTGTGTGCTGATGGCAGTGGG - Intronic
1146206232 17:30907516-30907538 GTTTGTGTCTGGAAGGCAGTGGG + Intronic
1146259720 17:31413483-31413505 CTCAGTGGCTGGAGGGCAGGGGG - Intronic
1147427001 17:40350682-40350704 CCCTTTGTGGGGAGGGCAGTGGG + Intronic
1150212194 17:63447286-63447308 CTCGGTGCCTGGAGGGCAGGTGG - Intergenic
1151700580 17:75740613-75740635 ATCTGTTTCCAGAGGGCAGAAGG + Intronic
1152240633 17:79159109-79159131 CTCTGTGGCAGGTGGGTAGTGGG + Intronic
1152248834 17:79200906-79200928 CTCTGTGTGCGGCGGGCAGCTGG + Intronic
1152578785 17:81156945-81156967 CCCTGTGTCGGGAGGCCTGTGGG - Intronic
1153307887 18:3649533-3649555 CACAGTGTACGGAAGGCAGTAGG - Intronic
1154009188 18:10560742-10560764 CTCTCTGTCGGTAGGGTAGTAGG - Intergenic
1155041373 18:22068108-22068130 CTCTGAGTTGGGAGGGGAGTAGG - Intergenic
1155087424 18:22471934-22471956 CACTGTGTCTGAAGGGCACTGGG - Intergenic
1156011722 18:32504369-32504391 CATTGTGTCAGTAGGGCAGTAGG - Intergenic
1160178852 18:76617485-76617507 CACTGTGTCCTGAGGGCAGAGGG + Intergenic
1161602570 19:5193482-5193504 CTCTTTGTCTGGGGGGCTGTGGG + Intronic
1163104848 19:15117280-15117302 CTCTCTGTCCTGAGGGCAGTGGG + Intronic
1163485024 19:17580401-17580423 CTCTGAGTTCAGAGGACAGTGGG - Intronic
1164414697 19:28037278-28037300 TTCTGTGTCCTGAGGGGAGAGGG - Intergenic
1165232100 19:34393668-34393690 CCCTGCGTCCTGTGGGCAGTGGG - Intronic
1165702459 19:37948954-37948976 CACTGTGGCAGGAGGGCAGCGGG + Intronic
1165704469 19:37965931-37965953 CTTTGTGTGCGGTGGGCACTTGG + Intronic
1166674538 19:44731998-44732020 CTATGTCTCCGGAGGGCAGGTGG + Intergenic
1167039347 19:47013423-47013445 CAGTGTGTCCTGAGGGCACTGGG + Intergenic
1167376802 19:49116645-49116667 CTCTCTCTGGGGAGGGCAGTAGG + Intronic
1167602726 19:50464115-50464137 CTCTTTGTCCTGAGAGCAATGGG + Intronic
1202665039 1_KI270708v1_random:110678-110700 ATTTGTGTCAGGAGGGCAGAGGG - Intergenic
925386159 2:3463299-3463321 CTGTGTGTCCGGGCTGCAGTTGG - Intronic
926698212 2:15785238-15785260 CCCTGTGTGCCGAGGGCAGCGGG + Intergenic
929067749 2:37996951-37996973 CTCTGGGTCAGGAGGCCAGTTGG + Intronic
934614707 2:95763946-95763968 CCCTGTTCCGGGAGGGCAGTAGG + Intergenic
934646197 2:96060549-96060571 CCCTGTTCCGGGAGGGCAGTAGG - Intergenic
934839600 2:97616632-97616654 CCCTGTTCCGGGAGGGCAGTAGG - Intergenic
938077035 2:128345648-128345670 CTCTGTCACCGGAGTGCAGGAGG + Intergenic
938406419 2:131035463-131035485 CTCTGTGCCCTGTGGGGAGTGGG + Intronic
939129513 2:138217529-138217551 ATATGTGTGTGGAGGGCAGTGGG - Intergenic
946398417 2:219455272-219455294 CACTGTGTCCAGAGAGCAATTGG - Intronic
947143260 2:227039718-227039740 TTTTGTGTCCGGAAGACAGTTGG - Intronic
948426074 2:237887157-237887179 TCCTGTGTGGGGAGGGCAGTGGG + Intronic
948479552 2:238241003-238241025 CCCTTTGTCCGGCGGGCAGGCGG + Intergenic
948778362 2:240301743-240301765 CACTGTGTCCTGGGGGCAATGGG + Intergenic
948830948 2:240598027-240598049 CTCTGTGTCCGGCAGGTAGGTGG - Exonic
948937620 2:241177880-241177902 CCCTGTGCCAGCAGGGCAGTGGG - Intronic
1173151769 20:40572213-40572235 TTCTGTGTCTTGAGGGCAATGGG - Intergenic
1173641888 20:44609258-44609280 CTCTGTGTCCCGAGGGCCAGTGG + Intronic
1173644600 20:44625683-44625705 CTCTGTGTGAGGAGAGGAGTAGG + Exonic
1174185470 20:48703194-48703216 CTCTGTGTCCGTGGTCCAGTTGG + Intronic
1175593402 20:60211809-60211831 CACTGTGTTGGGAGAGCAGTGGG + Intergenic
1176199864 20:63855358-63855380 AGCTGTGGCCGCAGGGCAGTGGG + Intergenic
1178116864 21:29426843-29426865 CTCTTTGTCTGGAGGGGAGAAGG - Intronic
1180155429 21:45975086-45975108 GTTTGTGCCCGGAGGGCAGGTGG - Intergenic
1180200747 21:46222685-46222707 CTCTGTATCCGGCTGGCAGAGGG + Exonic
1180331765 22:11487598-11487620 ATTTGTGTCAGGAGGGCAGAGGG - Intergenic
1180934418 22:19615335-19615357 CTCTGTGTACCGAGGGAGGTGGG + Intergenic
1181533687 22:23531112-23531134 CACTGGGTCCTGAGGGCAGGTGG + Intergenic
1181688168 22:24543428-24543450 CCCTGTGCCCGGAGGGCAGTAGG + Intronic
1182352079 22:29704804-29704826 CTCAGGGTTGGGAGGGCAGTGGG + Intergenic
1183390027 22:37540424-37540446 CTGTGTGTTTGGAGAGCAGTGGG - Intergenic
1184371745 22:44086815-44086837 CTCTGAGTACGGATGGAAGTTGG + Intronic
1184493862 22:44826033-44826055 CTGTGTACCCGGAGGGCAGGGGG - Intronic
1185312576 22:50164520-50164542 CCCGGTGTCCGGTGGGGAGTGGG - Intergenic
949570246 3:5285523-5285545 GTCTGTGTCCACATGGCAGTTGG + Intergenic
949584933 3:5428162-5428184 CTCTGTGTCTGCGGGGCAGAAGG - Intergenic
950221696 3:11201218-11201240 CTCTCTGGCCGTAGGGCAATTGG - Intronic
950567947 3:13782359-13782381 CTCTGTGTGGGGAGGGAGGTCGG - Intergenic
952954580 3:38549188-38549210 CTCTGTGTCTGGAGAGGAGCTGG + Exonic
953090971 3:39725880-39725902 CTCTGTGTCCGGGGGAAAGAGGG - Intergenic
953432347 3:42850552-42850574 CTGTGTGTCAAGGGGGCAGTGGG + Intronic
954129367 3:48552287-48552309 CCCTGAGTCCCAAGGGCAGTCGG - Intronic
954283624 3:49602247-49602269 CTCTGTGTCCCTGGGGCAGCAGG + Intronic
954940621 3:54368987-54369009 CACTGCGTCCGGCCGGCAGTAGG + Intronic
956760465 3:72438909-72438931 CGCTGTGTATGGAGGGCAGACGG + Intronic
962368060 3:134798616-134798638 CTTTGTGTCCAGAAGGCAGGAGG - Intronic
963908179 3:150791503-150791525 CTCTGTGTGTGGAGGGCACATGG - Intergenic
964330086 3:155592582-155592604 CTCTCTGACCAAAGGGCAGTCGG + Intronic
966678391 3:182614005-182614027 ATCTGGGTTGGGAGGGCAGTGGG - Intergenic
966891429 3:184410147-184410169 CACTGTGGCTGGAGTGCAGTGGG - Intronic
969300641 4:6294975-6294997 CTCTGTGTGAGGGTGGCAGTGGG + Intronic
969699936 4:8762416-8762438 GTCTGTGGCTGGAGGGCAGAGGG - Intergenic
969701583 4:8770605-8770627 CTTTGTGGCCAGAGGGCTGTGGG + Intergenic
970196273 4:13553338-13553360 TCCTGTGGCCGGAGGACAGTGGG + Intergenic
970672305 4:18410918-18410940 AGCTGTGACCAGAGGGCAGTTGG + Intergenic
975142395 4:70931769-70931791 CTCTGAGGCTGGAGTGCAGTGGG + Intronic
985268780 4:188175266-188175288 GTCTCTGTCCTGAGGGCTGTGGG - Intergenic
985525513 5:399487-399509 CTCTGTGACTGGAGGGCAAATGG - Intronic
985880222 5:2633653-2633675 ATCTGTGTTCAGAGGGCAGAGGG + Intergenic
987073917 5:14362735-14362757 CTCAGGGTCCCGAGGGAAGTGGG - Intronic
988530572 5:32023722-32023744 CTCTGGGTACAGATGGCAGTGGG + Intronic
988599720 5:32628429-32628451 ATCTAAGTCCAGAGGGCAGTGGG - Intergenic
988731950 5:33981187-33981209 CTCTGTGTAAGGAAGGCAGAGGG - Intronic
990149261 5:52798726-52798748 ATTTGTGTCAGGAGGGCAGAGGG + Intronic
997207509 5:132058725-132058747 CTCTGGGTCCGTGGGGCAATAGG + Intergenic
998729923 5:145062923-145062945 CTGTGTGTGGGGAGGGCAGTGGG + Intergenic
999302499 5:150499910-150499932 CTCTGTGTGCTGAGGCCAGCAGG + Intronic
1000988690 5:167889305-167889327 CACTGTGGACGGAGGGCTGTGGG + Intronic
1001939271 5:175729236-175729258 GCCTCTGTCCTGAGGGCAGTGGG - Intergenic
1002616345 5:180458851-180458873 CTCTCTGTGCGGTGAGCAGTGGG + Intergenic
1002793679 6:453230-453252 CTCTGTGTGCAAAGGGCAGCTGG - Intergenic
1003453218 6:6256671-6256693 CTCTGGGTCGGGAGGACAGTGGG - Intronic
1004982229 6:21038269-21038291 TTCTGTGTGTGGAGGCCAGTAGG + Intronic
1009870807 6:69450445-69450467 TTCTGTGTCCGGTGGGGACTTGG + Intergenic
1010850296 6:80767452-80767474 CACAGTGTCTGGAGGACAGTAGG - Intergenic
1014038084 6:116791247-116791269 GTCTTTGTCCTGTGGGCAGTGGG - Intergenic
1015147670 6:130005590-130005612 CTGTGGGGCAGGAGGGCAGTGGG + Intergenic
1017618227 6:156267481-156267503 CTCTGTATCCTGTGAGCAGTTGG - Intergenic
1018483360 6:164214331-164214353 CTGTGTGTGTGGAAGGCAGTTGG + Intergenic
1022259446 7:28690294-28690316 CTCTGTGTCTGGTGGGCAGAGGG - Intronic
1023102799 7:36736225-36736247 CTCTGTATCTGGAGGGCAAGGGG - Intergenic
1034940670 7:155228309-155228331 CCCTGAGTCCGGAGGGAAGAAGG + Intergenic
1035374103 7:158395939-158395961 CTCTGTGACCAGGGGGCAGAGGG - Intronic
1035600720 8:895416-895438 CTCTGTTTCCGGGGAGCAGGGGG + Intergenic
1035739601 8:1916194-1916216 CTCTGTGTCCTAAGTGCAGACGG + Intronic
1037292531 8:17366485-17366507 CTCTGTGTCCTGATGACTGTTGG - Intronic
1037896253 8:22658285-22658307 CTGTGTGTACGGAGGGCAAAGGG + Intronic
1039718352 8:40134995-40135017 CTCTTCGTCCAGAGGGAAGTAGG - Intergenic
1039868046 8:41522800-41522822 CTCTCTGGCTGGAGTGCAGTGGG - Intergenic
1040489512 8:47906590-47906612 CACTGTGTCTGGAGTGCAGTGGG - Intronic
1043130594 8:76456080-76456102 GACTGTGTGCGGAGGGCAGGGGG - Intergenic
1045455469 8:102374672-102374694 CTATGTGTGCAGAAGGCAGTAGG - Intronic
1045724839 8:105160077-105160099 CTCTGTGTCTGGAAGGTGGTAGG + Intronic
1048330235 8:133466089-133466111 CTCTGTGGGCGGAGGACAGAAGG + Exonic
1049178917 8:141210499-141210521 GTTTGTGTCCGGGTGGCAGTTGG - Intronic
1049373179 8:142277356-142277378 CCCTGTGCCCTGAGGGCACTGGG - Intronic
1049416645 8:142498456-142498478 CTCTGTGTCCTGAGGGCTGGGGG + Intronic
1049617657 8:143582686-143582708 CCCTGTGTCCTGAGTGCTGTGGG - Intronic
1049635928 8:143689420-143689442 CACTGTGGCAGGAGGGCAGTGGG + Intronic
1050285635 9:4099027-4099049 CACTTTGTCTTGAGGGCAGTGGG - Intronic
1050296119 9:4207184-4207206 CTCTGTGTCGGGAGGGGAGGTGG - Intronic
1056591683 9:87969911-87969933 CTCTGTGTCCACAGGTCTGTGGG - Exonic
1059336242 9:113570205-113570227 TTCTGTGTCCTGATAGCAGTGGG + Intronic
1060300043 9:122369784-122369806 CTCTGTCTCCCTAGGGCAGCTGG + Intergenic
1060401186 9:123350440-123350462 GACTGTGTCCTGAGGGCACTGGG - Intergenic
1060876810 9:127089832-127089854 CTCTGTGGCAGGAGGACAGGGGG + Intronic
1061246779 9:129404727-129404749 CACTGGGTCCTGAGGGCAGGTGG - Intergenic
1061484107 9:130911729-130911751 AACTGTGTCCGGAAGGCAGGGGG + Intronic
1061664441 9:132152205-132152227 CTCTGTGTCTGCAGGGCCTTGGG - Intergenic
1062169267 9:135125686-135125708 CTCTGTGTCCAGAAGGCAAAAGG + Intergenic
1062424396 9:136499345-136499367 GTCTGTGTCCGGAAGACAGTGGG - Intronic
1062520606 9:136956179-136956201 CTCCCTGCCCGGAGGACAGTGGG - Intronic
1062564052 9:137156115-137156137 CTCTGTGTCCCGAGGGGAAGCGG - Intronic
1185681737 X:1894070-1894092 TTCTGTGTCCGGCGGGCATGGGG - Intergenic
1185690149 X:2148066-2148088 CTCTGGTTCCTGATGGCAGTTGG - Intergenic
1190194880 X:48308317-48308339 CTCTGTGTCTGCAGTGCTGTGGG + Intergenic
1190200786 X:48358758-48358780 CTCTGTGTCTGCAGTGCTGTGGG + Intergenic
1190210977 X:48447634-48447656 CTCTGTGTCTGCAGTGCTGTGGG - Intergenic
1190667606 X:52709199-52709221 CTCTGTGTCTGCAGTGCTGTGGG + Intergenic
1190671812 X:52749209-52749231 CTCTGTGTCTGCAGTGCTGTGGG - Intergenic
1198529697 X:137539877-137539899 CTCTCTGGCTGGAGTGCAGTTGG + Intergenic
1198852084 X:140975435-140975457 CACTGTGTTGGGAGGGCAGGTGG + Intergenic
1199743922 X:150760051-150760073 CACTGTGCTCGGAGGGTAGTAGG + Intronic
1200051263 X:153433096-153433118 CTGTGTGGCTGGAGGCCAGTGGG + Intergenic
1200142058 X:153907341-153907363 CTCTGTCTCGGGTGGGCAGGTGG - Intronic