ID: 1097937842

View in Genome Browser
Species Human (GRCh38)
Location 12:65273349-65273371
Sequence CCTAACCTGGCCTCCAGGAT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1097937831_1097937842 11 Left 1097937831 12:65273315-65273337 CCCATCTCCTCACTGCCCTTTTT No data
Right 1097937842 12:65273349-65273371 CCTAACCTGGCCTCCAGGATGGG No data
1097937832_1097937842 10 Left 1097937832 12:65273316-65273338 CCATCTCCTCACTGCCCTTTTTA No data
Right 1097937842 12:65273349-65273371 CCTAACCTGGCCTCCAGGATGGG No data
1097937835_1097937842 -5 Left 1097937835 12:65273331-65273353 CCTTTTTACCATCTACTCCCTAA No data
Right 1097937842 12:65273349-65273371 CCTAACCTGGCCTCCAGGATGGG No data
1097937829_1097937842 23 Left 1097937829 12:65273303-65273325 CCTAATGTTCTCCCCATCTCCTC No data
Right 1097937842 12:65273349-65273371 CCTAACCTGGCCTCCAGGATGGG No data
1097937834_1097937842 -4 Left 1097937834 12:65273330-65273352 CCCTTTTTACCATCTACTCCCTA No data
Right 1097937842 12:65273349-65273371 CCTAACCTGGCCTCCAGGATGGG No data
1097937833_1097937842 4 Left 1097937833 12:65273322-65273344 CCTCACTGCCCTTTTTACCATCT No data
Right 1097937842 12:65273349-65273371 CCTAACCTGGCCTCCAGGATGGG No data
1097937830_1097937842 12 Left 1097937830 12:65273314-65273336 CCCCATCTCCTCACTGCCCTTTT No data
Right 1097937842 12:65273349-65273371 CCTAACCTGGCCTCCAGGATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1097937842 Original CRISPR CCTAACCTGGCCTCCAGGAT GGG Intergenic
No off target data available for this crispr