ID: 1097938103

View in Genome Browser
Species Human (GRCh38)
Location 12:65276060-65276082
Sequence AATGTTTACCAGCACACCAC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 488
Summary {0: 3, 1: 13, 2: 40, 3: 127, 4: 305}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1097938096_1097938103 9 Left 1097938096 12:65276028-65276050 CCCCTAGCCCTTTCATCCAGATC 0: 1
1: 0
2: 1
3: 10
4: 113
Right 1097938103 12:65276060-65276082 AATGTTTACCAGCACACCACTGG 0: 3
1: 13
2: 40
3: 127
4: 305
1097938102_1097938103 -7 Left 1097938102 12:65276044-65276066 CCAGATCTGGTTGTTAAATGTTT 0: 2
1: 0
2: 5
3: 24
4: 245
Right 1097938103 12:65276060-65276082 AATGTTTACCAGCACACCACTGG 0: 3
1: 13
2: 40
3: 127
4: 305
1097938098_1097938103 7 Left 1097938098 12:65276030-65276052 CCTAGCCCTTTCATCCAGATCTG 0: 1
1: 0
2: 0
3: 21
4: 203
Right 1097938103 12:65276060-65276082 AATGTTTACCAGCACACCACTGG 0: 3
1: 13
2: 40
3: 127
4: 305
1097938100_1097938103 2 Left 1097938100 12:65276035-65276057 CCCTTTCATCCAGATCTGGTTGT 0: 1
1: 1
2: 2
3: 17
4: 155
Right 1097938103 12:65276060-65276082 AATGTTTACCAGCACACCACTGG 0: 3
1: 13
2: 40
3: 127
4: 305
1097938101_1097938103 1 Left 1097938101 12:65276036-65276058 CCTTTCATCCAGATCTGGTTGTT 0: 1
1: 0
2: 1
3: 14
4: 160
Right 1097938103 12:65276060-65276082 AATGTTTACCAGCACACCACTGG 0: 3
1: 13
2: 40
3: 127
4: 305
1097938097_1097938103 8 Left 1097938097 12:65276029-65276051 CCCTAGCCCTTTCATCCAGATCT 0: 1
1: 0
2: 0
3: 8
4: 165
Right 1097938103 12:65276060-65276082 AATGTTTACCAGCACACCACTGG 0: 3
1: 13
2: 40
3: 127
4: 305

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1097938103 Original CRISPR AATGTTTACCAGCACACCAC TGG Intergenic
901248435 1:7752705-7752727 CATGGTTACCAGCACTCCAAGGG - Intronic
902098983 1:13969459-13969481 AACCATTACCAGCAAACCACTGG + Intergenic
902182489 1:14699713-14699735 AACATTTACTAGCACACCGCTGG - Intronic
902195410 1:14794480-14794502 AACACTTACCAGCACACCACTGG - Intronic
902405125 1:16178559-16178581 AACATTTACCAGCTCACCACTGG + Intergenic
902601846 1:17545262-17545284 CCTGTTTACCAGCACACCACTGG + Intronic
903529026 1:24015410-24015432 AACATTTACCAGCACATAACTGG - Intergenic
904487621 1:30837762-30837784 AACATTTACCATTACACCACTGG - Intergenic
904794336 1:33047742-33047764 AATGTTTACTAGCACAGGACTGG + Intronic
904830407 1:33302838-33302860 GACTTATACCAGCACACCACCGG + Intergenic
905187251 1:36205337-36205359 AACATTCACCAGCACACCACTGG - Intergenic
905967499 1:42111513-42111535 AATGTTTACCAGCTCTCTACTGG - Intergenic
906648694 1:47494824-47494846 AACCTTTACCTGCACATCACAGG + Intergenic
907134159 1:52123277-52123299 AACATTTACCAGCACGCCACTGG - Intergenic
907543250 1:55235752-55235774 AACATTCACCAGCACACCACTGG + Intergenic
907777439 1:57531717-57531739 AAATTTTACCAGCACACCATTGG - Intronic
907825594 1:58013931-58013953 AGAATTCACCAGCACACCACTGG + Intronic
908513677 1:64870912-64870934 AATGTTTACAAAAAAACCACAGG - Intronic
909555694 1:76951314-76951336 AATATTTACCAGCACAACACTGG - Intronic
910442403 1:87266139-87266161 AATGTTTCCCTGAAGACCACAGG + Intergenic
910649242 1:89547266-89547288 AATATTTACCAGCATGCCACTGG + Intronic
911062969 1:93763731-93763753 AATATTTACTGGCACACCAGTGG - Intronic
911602424 1:99860894-99860916 AATCTTTATTAGCACATCACTGG + Intronic
912140106 1:106714049-106714071 AATATTTACCAAAACACAACTGG + Intergenic
912774158 1:112493807-112493829 AATGTTGGCCACCAAACCACAGG + Intronic
912963229 1:114214413-114214435 ACAGTTTACCAGCACCCCACTGG - Intergenic
913190917 1:116412351-116412373 AACATTAACCAGCACACCACTGG + Intergenic
914689876 1:150016358-150016380 AATATTTACTAGCACACCACTGG - Intergenic
916341970 1:163746128-163746150 AATATTTACCAGCACACCACTGG - Intergenic
917153592 1:171970917-171970939 AAATTTGACAAGCACACCACTGG - Intronic
917301564 1:173580018-173580040 AACATTTACCAGCACATCACTGG - Intronic
917308874 1:173656492-173656514 TACATTTACCAGCACACTACTGG - Intronic
917439594 1:175055335-175055357 AAATGTTACCAACACACCACTGG - Intergenic
917479320 1:175397423-175397445 GGTATTTAACAGCACACCACTGG + Intronic
917602464 1:176590446-176590468 AATATTTACTAGCATACCACTGG + Intronic
917960128 1:180135822-180135844 AACATTTTCCAGCACACCATTGG + Intergenic
918108596 1:181435191-181435213 AATGTTTACCAGCACACCACTGG + Intronic
919088922 1:192954962-192954984 AATTTTTACCAGCCCAACATAGG - Intergenic
919856915 1:201712409-201712431 AACATTTACCAGCACAACCCTGG + Intronic
920081819 1:203380200-203380222 AACCTTTACCAGCACATCACTGG - Intergenic
920091613 1:203457017-203457039 AACCTTTGCCAGCACACCACTGG - Intergenic
920700045 1:208210977-208210999 AATATTTACCAGCACGTCACTGG + Intronic
920700260 1:208212692-208212714 AATATTTACCAGCACACCACTGG + Intronic
921081727 1:211744759-211744781 AACATTTACCAGCACACCACTGG + Exonic
921245036 1:213229364-213229386 AACATTTACCAGCCCACCACTGG - Intronic
921975468 1:221198203-221198225 AATATTTACCAGCCCAACACTGG + Intergenic
922058182 1:222062123-222062145 AATATTTACCAGCACACCACTGG - Intergenic
923689497 1:236178473-236178495 CGTCTTTACCAGCACAGCACAGG - Exonic
924452501 1:244190905-244190927 AACATTTACCAGCTCACTACTGG - Intergenic
924824555 1:247525719-247525741 AATGTTAAGCAGAACACCAATGG - Intronic
1063992280 10:11579022-11579044 AACATTTACCAGCACAACACTGG + Intronic
1064104456 10:12489522-12489544 AACATTTACCAGCACACCACTGG - Intronic
1064119962 10:12610010-12610032 AACGTTTACCAGCACACTACTGG - Intronic
1064218652 10:13420933-13420955 ATTGTGTACCAGCAAAGCACAGG + Intergenic
1064270396 10:13859988-13860010 AATATTCACCAGCACCCCACTGG - Intronic
1064325744 10:14349575-14349597 AATGTCTACCAGGACATCAGTGG - Intronic
1064467998 10:15604541-15604563 AACATTTACCAACACACTACTGG - Intronic
1064932859 10:20646459-20646481 AATGATTACCATCAGACCACAGG - Intergenic
1065413003 10:25451094-25451116 AATGTTTACCAAAGCACCACTGG - Intronic
1065763770 10:29007877-29007899 AACATTTACCAGCACCCCACTGG - Intergenic
1065899083 10:30188764-30188786 CACGTTTACCAGCACGTCACTGG + Intergenic
1066069859 10:31796839-31796861 AACATTTACCAGCTCACCCCTGG - Intergenic
1066568323 10:36744294-36744316 AATGCTTACAAGGACACAACTGG + Intergenic
1067773184 10:49142106-49142128 AATATTTACCATCACACTACTGG + Intergenic
1067982468 10:51101960-51101982 AGTATTTGCCAGCACGCCACTGG - Intronic
1068101981 10:52566705-52566727 AACATTTACCAGCACTCCACTGG + Intergenic
1068915689 10:62428828-62428850 AATATTTACTAGCATACCACTGG - Intronic
1069295271 10:66836027-66836049 AACATTCACCAGCACACCAGTGG - Intronic
1069570961 10:69494107-69494129 GAGGTTGCCCAGCACACCACTGG - Intronic
1069894434 10:71671858-71671880 AATTTTGACCAGAACTCCACAGG - Intronic
1070325823 10:75388227-75388249 ACCATTTACCAGCTCACCACTGG - Intergenic
1070766587 10:79060137-79060159 AACATTTACCAGCACACCACTGG + Intergenic
1071007515 10:80899896-80899918 TTTATTTGCCAGCACACCACTGG - Intergenic
1071174595 10:82910043-82910065 TATGTTTACCATGACACTACTGG - Intronic
1071917523 10:90311839-90311861 AATCTCTACCAGAACACAACAGG - Intergenic
1072776854 10:98205606-98205628 AATATTTGCCAGCACACTGCTGG + Intronic
1073636903 10:105208378-105208400 AATATTTACAAGTACACCACTGG - Intronic
1073644132 10:105282246-105282268 AAGATTTACCAGCACATCACGGG - Intergenic
1074168143 10:110904763-110904785 AATGTTCACCAGCAGATCAAAGG + Intronic
1074613968 10:115047909-115047931 AAAATTTACCAACACACCACTGG + Intergenic
1074935522 10:118175984-118176006 TCAGTTTACCAGCACACCATTGG - Intergenic
1075532147 10:123238723-123238745 GCAGTTTACCAGCACACCAGTGG + Intergenic
1078120617 11:8505103-8505125 AATATTTACCAACACACCACTGG + Intronic
1078882858 11:15469779-15469801 AATGTTTACCAGCAAACTACTGG - Intergenic
1080073650 11:28120466-28120488 AACCTTTACCAGAACAGCACTGG - Intronic
1081909840 11:46693912-46693934 GCCATTTACCAGCACACCACTGG + Intronic
1082788816 11:57333071-57333093 AATGTGTCCCAGTGCACCACAGG - Exonic
1082796019 11:57378344-57378366 AACATTTACCAGCATACCACTGG - Intronic
1085025862 11:73236204-73236226 AACATTTACCAGCACATGACTGG - Exonic
1085206431 11:74735635-74735657 AACATTTACCAGCACACCACTGG - Intergenic
1085406748 11:76267634-76267656 AATGTTTGCCAACTCACCACTGG - Intergenic
1085410871 11:76289595-76289617 TACATTTACCAGCACACCACTGG - Intergenic
1085516463 11:77114774-77114796 GCAGTTTACCAGCACAGCACAGG - Intronic
1085667098 11:78423670-78423692 AATATTTGCCAGCACATCATTGG - Intergenic
1086949323 11:92875547-92875569 CTGGTTTACCAGCACACCCCTGG - Intronic
1087020804 11:93601144-93601166 GCAGTTTAGCAGCACACCACAGG + Intergenic
1087180388 11:95136058-95136080 AACATTTACCAGCATACCACTGG - Intergenic
1087311720 11:96551504-96551526 AATGTTTACCAGCACACCACTGG + Intergenic
1088785639 11:113179156-113179178 AATATTCACCAGCATGCCACTGG + Intronic
1088965531 11:114717246-114717268 ACTGTTCATCTGCACACCACTGG - Intergenic
1090256139 11:125286010-125286032 AATATTTACCAGCATGCTACTGG + Intronic
1090823476 11:130366156-130366178 GTTATTTACCAACACACCACTGG + Intergenic
1091776287 12:3187076-3187098 AACGTCTGCCAGCCCACCACTGG + Intronic
1092027204 12:5251631-5251653 AATATTTACCAGCCCACCACTGG + Intergenic
1093051069 12:14505444-14505466 AAAATTTACCTGCTCACCACTGG - Intronic
1094050516 12:26215631-26215653 GACATTTACCATCACACCACTGG + Intronic
1095227637 12:39695802-39695824 GATGTTAAACAGCACAGCACTGG - Intronic
1095493702 12:42762549-42762571 TCATTTTACCAGCACACCACTGG + Intergenic
1095928587 12:47604169-47604191 CTGGTTTACCAGCACACCACTGG - Intergenic
1096407820 12:51356782-51356804 AATGTTCTCCAGTGCACCACTGG + Intronic
1097938103 12:65276060-65276082 AATGTTTACCAGCACACCACTGG + Intergenic
1098196728 12:68010059-68010081 AATGTTTACCACTACACCCAAGG + Intergenic
1098677507 12:73309076-73309098 AACGTTTATCAGGACACCACTGG + Intergenic
1098802824 12:74984173-74984195 AACATTAACCAGCACACCATTGG + Intergenic
1101093545 12:101312860-101312882 AAATTTAACCAGCACACCAGTGG + Intronic
1101258517 12:103004704-103004726 AATATTTTCTAGCACACCTCTGG - Intergenic
1101473434 12:105020978-105021000 ATATTTTACCAGCACACCCCTGG + Exonic
1101510425 12:105388042-105388064 AACATTTACCTGCACACCACCGG + Intronic
1102962796 12:117104208-117104230 CTTGTTTACCAGCTCACCACTGG - Intergenic
1103236255 12:119375226-119375248 AACATTTACCAGCACATCAATGG - Intronic
1103243288 12:119433170-119433192 AACATTCACCAGCACACCACGGG + Intronic
1103594810 12:122018182-122018204 AACATTTACCAGCATACCATTGG - Intergenic
1104564874 12:129871758-129871780 AACATGTACCAGCACACCATGGG + Intronic
1106955042 13:34928008-34928030 AGTGATTACCAGCAAACCTCAGG - Intergenic
1107331718 13:39308502-39308524 AACATTTACCAGCACTCCACTGG + Intergenic
1108123423 13:47214451-47214473 AATATTTACCAGTGGACCACTGG + Intergenic
1109051518 13:57488760-57488782 AATTTTTACTAGCTCACCTCAGG + Intergenic
1109367443 13:61373947-61373969 AACATTTACCAGCACACCATTGG + Intergenic
1110191689 13:72737186-72737208 AACATTCACCAGCACACTACTGG - Intronic
1110368350 13:74712951-74712973 CTTGTCTACCAGCACATCACTGG - Intergenic
1110703888 13:78581934-78581956 AATGATCAACAGCACTCCACAGG + Intergenic
1110777280 13:79422483-79422505 AACATTAACCAGCACACTACTGG - Intergenic
1111488485 13:88937330-88937352 AAGATTTAACAGTACACCACTGG - Intergenic
1111843990 13:93486531-93486553 AATGTTTATTAGCACATCAATGG - Intronic
1111880097 13:93945100-93945122 AACATTTACCAGCACACCACTGG - Intronic
1112184624 13:97115727-97115749 AACATTTATCAGCATACCACTGG - Intergenic
1112588554 13:100742547-100742569 AACATTTACTAGCACACCACTGG + Intergenic
1112639135 13:101252919-101252941 AAAATTTATCAGCACAGCACAGG - Intronic
1112849530 13:103687764-103687786 AATGTTAAGTAGCACAACACTGG + Intergenic
1113328617 13:109307830-109307852 AACATTTATCAACACACCACGGG - Intergenic
1114184539 14:20390517-20390539 GATATTCAGCAGCACACCACTGG + Intronic
1114842584 14:26282641-26282663 AACATATACTAGCACACCACTGG - Intergenic
1116047647 14:39764066-39764088 AACATTTATCAGCACCCCACAGG + Intergenic
1116923022 14:50601413-50601435 ACATTTTGCCAGCACACCACTGG - Intronic
1118732724 14:68679885-68679907 AACATTTACCAGCACACTACTGG - Intronic
1119596458 14:75939135-75939157 AACATTTTCTAGCACACCACTGG + Intronic
1124922609 15:34040989-34041011 AATATCTACCAGCATATCACTGG + Intronic
1125877053 15:43158307-43158329 AATATTTACCAGCACATCAGTGG - Intronic
1126539721 15:49808474-49808496 CTGGTTTACCAGCACACCACTGG + Intergenic
1126744307 15:51810574-51810596 AACATTCATCAGCACACCACTGG + Exonic
1126789944 15:52211853-52211875 CATGTTCACCACCACGCCACGGG + Exonic
1127967885 15:63937369-63937391 GATATTTATCAGCATACCACTGG + Intronic
1129969481 15:79765191-79765213 CACGTTAACCAGCATACCACTGG - Intergenic
1130038225 15:80380817-80380839 AAAATTTACCAGCACACCACTGG + Intronic
1130439791 15:83942213-83942235 AATGTTTAAAAGCACACTTCAGG - Intronic
1130886865 15:88100437-88100459 GAGGTTTACCAGCTCACTACTGG - Intronic
1130942358 15:88521910-88521932 AACCTTTATCAGCGCACCACTGG - Intronic
1131408793 15:92188619-92188641 AGTATTTACTAGCACACAACTGG + Intergenic
1131806585 15:96128370-96128392 AACGCTTCCCAGCACATCACTGG + Intergenic
1133112686 16:3558005-3558027 CCAGTTTACCAGTACACCACTGG - Intronic
1133457675 16:5957113-5957135 AATGTTTACCAGCACACTGTTGG + Intergenic
1133724409 16:8524007-8524029 AACATTCACCAGCACACCACTGG + Intergenic
1133793024 16:9023988-9024010 AACATTTACTAGCACACTACAGG + Intergenic
1133941497 16:10312876-10312898 AACATTTACTAGCACACCACAGG + Intergenic
1135416391 16:22271298-22271320 AATGTTCCCCAGCACACCACTGG - Intronic
1136013235 16:27378408-27378430 TTGGCTTACCAGCACACCACTGG + Intergenic
1138408302 16:56816899-56816921 AACATTTACCAGCACACTATTGG + Intronic
1139638635 16:68274926-68274948 AGTGTGTACCAGCACACCCTTGG - Exonic
1140835011 16:78785423-78785445 ATCATTTACCAGCACACCACTGG - Intronic
1141049994 16:80752695-80752717 AACATTTATCAGTACACCACTGG - Intronic
1143850796 17:9810385-9810407 AACATTTGCCAGCACACCACTGG + Intronic
1144669675 17:17125903-17125925 CATGGTTACCACCACACCAGGGG - Intronic
1145788006 17:27606567-27606589 CACATTTACCAGCACACCACTGG - Intronic
1145894111 17:28442258-28442280 AATGTTTATCAGCACACCATTGG + Intergenic
1147401877 17:40185180-40185202 AATATTTACCAGTACACCACTGG - Intronic
1148037454 17:44678132-44678154 AATCTCTACCAGCACACAAGAGG + Exonic
1148442393 17:47718166-47718188 AACATTTGCCAGCACACCACTGG - Intergenic
1149006586 17:51812508-51812530 AACATTTACTAGCACCCCACTGG + Intronic
1149283667 17:55136708-55136730 AATATTTACCATCACACTACTGG + Intronic
1149596903 17:57869575-57869597 AACATTCACCAGCACACCAGGGG + Intronic
1150190619 17:63233715-63233737 AACTTGTACCAGCACACCACTGG + Intronic
1150480594 17:65506021-65506043 TTGGTTTACCAGCATACCACTGG - Intergenic
1150863343 17:68823697-68823719 CAGGTTTACCAGCACACTCCTGG + Intergenic
1151425390 17:74027861-74027883 AATATTTGGCAGGACACCACTGG - Intergenic
1153109592 18:1568848-1568870 ACCACTTACCAGCACACCACTGG + Intergenic
1155141093 18:23045020-23045042 AGCATTTACCAGCACACCAGTGG - Intergenic
1155324191 18:24649680-24649702 AATGTTTACCAGCACGTCATTGG + Intergenic
1156125596 18:33900789-33900811 AATGTTAGCCAGTAGACCACAGG + Intronic
1156268441 18:35509148-35509170 GATGTTCTCCAGCACACAACGGG - Intergenic
1158448528 18:57542506-57542528 AACGTTTATCAGCACACCACTGG + Intergenic
1159535457 18:69708874-69708896 TATTTTTACCTGCACAGCACTGG + Intronic
1159572059 18:70126761-70126783 AGTGGGCACCAGCACACCACTGG + Intronic
1159605906 18:70474628-70474650 CCAGTTTACCAGCACAACACTGG - Intergenic
1161257578 19:3318041-3318063 CATGTTAGCCAGCACACCACAGG + Intergenic
1161841923 19:6687118-6687140 AACTTTTACCAGCACACCACGGG - Intronic
1162508816 19:11104745-11104767 AATTCTTACCCCCACACCACTGG + Intronic
1165242229 19:34478050-34478072 GACATTTACCAGCACACCACTGG + Intergenic
1166423503 19:42655973-42655995 AATATTTACCAGCTGTCCACAGG + Intronic
925546211 2:5019664-5019686 AACATTTACCAGCAAACCAGTGG - Intergenic
926086161 2:10021623-10021645 AACATTTACCTGCACACCACAGG - Intergenic
929299685 2:40288732-40288754 CTAGTTTACCAGCACACCAGTGG + Intronic
929394181 2:41503205-41503227 AACATTTACCAACACACCACTGG + Intergenic
929912505 2:46102180-46102202 AGTGCTTGCCAGGACACCACTGG + Intronic
930224845 2:48781519-48781541 CTGGTTTACCAGCACAGCACTGG - Intergenic
932087988 2:68779146-68779168 ACTATCTACCAGCACACCGCTGG - Intronic
932355324 2:71063716-71063738 AACACTTACCAGCACACCACTGG - Intergenic
932833962 2:75017880-75017902 AATATTCACCAGCACATTACTGG + Intergenic
932842637 2:75097861-75097883 AAGTGTTACCAGCATACCACTGG - Intronic
933968210 2:87447972-87447994 AACATTTGCCAGCACACCTCTGG + Intergenic
936049054 2:109209330-109209352 AACGTTTGCCAGCACACCACTGG - Intronic
936325587 2:111502532-111502554 AACATTTGCCAGCACACCTCTGG - Intergenic
938552251 2:132393249-132393271 TCAGTTTACCAGCACACCGCTGG + Intergenic
938945071 2:136204965-136204987 TACATGTACCAGCACACCACTGG - Intergenic
941184609 2:162306018-162306040 TACATTCACCAGCACACCACAGG + Intronic
941214409 2:162687679-162687701 GATATTTATTAGCACACCACTGG + Intronic
941335020 2:164231322-164231344 AACGTTTATCAGCACACCTCTGG + Intergenic
942711965 2:178847017-178847039 AATGCTTACCAGCACTTTACAGG - Intronic
942995950 2:182260586-182260608 AACATTTACCATCATACCACAGG - Intronic
943040279 2:182796362-182796384 AAACTTTTCCAGCTCACCACTGG + Intergenic
943879370 2:193120192-193120214 AACATTCACCTGCACACCACTGG - Intergenic
944358339 2:198820630-198820652 CCAGTTTACCAGCACACCCCTGG - Intergenic
945258557 2:207823234-207823256 AATGCTTTCCATCACACCAGCGG + Intergenic
946104606 2:217358365-217358387 AATGTTTATCACGACAGCACAGG + Intronic
947589608 2:231378091-231378113 AATGTTTACCAGCACTCCACTGG + Intergenic
1169640967 20:7751796-7751818 ATTGTTTACCAGCCCACCCAAGG + Intergenic
1169767453 20:9162899-9162921 AATGTATACCAGCATACCCCCGG - Intronic
1170002099 20:11626177-11626199 AGCATTTACCAGCATACCACTGG - Intergenic
1170592990 20:17785329-17785351 AATATTTACCAGCATACCACTGG + Intergenic
1170729198 20:18957639-18957661 AATATTTGCCAGCACACCACTGG - Intergenic
1172195898 20:33091225-33091247 AATGCTTACCAGCATACCTCTGG - Intronic
1173048378 20:39534955-39534977 AATGTTTACCAGAACACCACTGG + Intergenic
1173734626 20:45350683-45350705 AACATTTACTGGCACACCACTGG - Intergenic
1174461682 20:50687477-50687499 AACCTTTGCCAGCATACCACTGG - Intronic
1174567766 20:51479145-51479167 AACGTTTACTAGCACATCACTGG + Intronic
1174725197 20:52854267-52854289 TAAATGTACCAGCACACCACTGG + Intergenic
1174758809 20:53186299-53186321 AAGATTTACCAGCTCACCAGTGG + Intronic
1174770354 20:53293664-53293686 AAAATTTACCAGCACAGCACTGG - Intronic
1175410461 20:58764346-58764368 AATGTTTGCCAGCACAGTGCAGG - Intergenic
1176983414 21:15408767-15408789 CATGTTTCCCAGCACCCCATAGG - Intergenic
1177196744 21:17911428-17911450 AACACTTACCAGCACCCCACTGG + Intronic
1178547730 21:33507149-33507171 AATGTTTATCAGCAGACAAATGG + Intronic
1179470687 21:41608117-41608139 AATTTATACCAGCACATCACAGG + Intergenic
1180033457 21:45228778-45228800 AGCATTTACTAGCACACCACTGG + Intergenic
1181444113 22:22955800-22955822 AACTTTTCCCAGCACACCAGTGG - Intergenic
1181790207 22:25259451-25259473 AACATTTGCTAGCACACCACTGG - Intergenic
1181826021 22:25516463-25516485 AACATTTGCTAGCACACCACTGG - Intergenic
1182117625 22:27766248-27766270 AATATTTTCCAGCAGTCCACAGG - Intronic
1182741815 22:32573143-32573165 CCAGTTTGCCAGCACACCACTGG + Intronic
1183233100 22:36595478-36595500 AACATGTACCAGCACACCACTGG + Intronic
1183412363 22:37662410-37662432 CATGTTTCTCAGCGCACCACTGG - Intronic
1184903288 22:47461344-47461366 AACATTCACCAGCACACCCCTGG + Exonic
1185358158 22:50387583-50387605 AACATTTACCAACATACCACTGG - Intronic
950726725 3:14921742-14921764 TAGGTTTACGAGCAGACCACTGG - Intronic
951019647 3:17768286-17768308 AATATTGGCCAGTACACCACTGG - Intronic
951109506 3:18785443-18785465 AATGTTGACCAGTCCACCCCCGG - Intergenic
951249301 3:20375624-20375646 AACAGTTACCAGCACATCACTGG + Intergenic
951516960 3:23570410-23570432 AACATTTACCAGTACACTACTGG - Intronic
951692463 3:25410887-25410909 AATGTTTAGGAGCATACTACTGG + Intronic
952974927 3:38685708-38685730 AACACTTACCAGCACACCACTGG + Intergenic
953234961 3:41098060-41098082 AATATTTGCCAGCATACAACTGG - Intergenic
953777994 3:45839628-45839650 AATATTTACCATCATACCACTGG - Intronic
954362160 3:50127622-50127644 AATGTTTACCCACATTCCACTGG - Intergenic
955134330 3:56200912-56200934 AACGTTTACCAGCACATCATGGG + Intronic
955284818 3:57629924-57629946 AATATTTACCAGCACATTACTGG - Intronic
955532068 3:59884401-59884423 AATATTTACCAGCACACCACTGG + Intronic
955730110 3:61976066-61976088 AATGTTTTCCAGCACATTGCAGG - Intronic
956186041 3:66562810-66562832 AATGCTTCCCAGCGTACCACAGG - Intergenic
956446246 3:69329085-69329107 AACATTTACCAGCATACCAGTGG + Intronic
956691297 3:71880210-71880232 AACATTTACCAGCACACTATTGG + Intergenic
957767112 3:84639486-84639508 CATTTTTACCAGCACCTCACTGG - Intergenic
958427876 3:94000289-94000311 AATATTTAACAACACATCACTGG + Intronic
959532583 3:107450594-107450616 AATGCCTCTCAGCACACCACTGG - Intergenic
959645371 3:108693579-108693601 AACCTTTACCAGCATACCACTGG + Exonic
959867440 3:111287091-111287113 AACATTTACCAGCACAACACTGG + Intergenic
960722950 3:120642485-120642507 AATATTTACCAGCACACCACTGG - Intronic
961411027 3:126720446-126720468 GAAATTTACCAGCACACGACTGG - Intronic
961890519 3:130126878-130126900 AATGGGCACCAGCACACCGCAGG - Intergenic
961993116 3:131213352-131213374 AATGTTTTCCAGGAGACCAGAGG + Intronic
962146477 3:132845027-132845049 AATATTTACCGGCACACCACTGG + Intergenic
962457828 3:135581457-135581479 AACATTCACCAGCACACCACTGG + Intergenic
962897795 3:139731547-139731569 ACTGTGTGCCAGCACACTACTGG - Intergenic
963273379 3:143307281-143307303 AACACTTACCAGCACACCACTGG + Intronic
963900583 3:150729020-150729042 AACATTTACCAGCACACCTCTGG - Intergenic
964048339 3:152359410-152359432 AACATTTACCAGGATACCACTGG - Intronic
964174432 3:153808747-153808769 CTTATTTACCAGCACACTACTGG + Intergenic
964941640 3:162164569-162164591 AACATTTACCAGCAGACCATTGG - Intergenic
965748362 3:171949700-171949722 AACATTTACCAGCACACCACTGG - Intergenic
965840805 3:172903491-172903513 AAGTTTTACCATCACAGCACAGG - Intronic
966274389 3:178147268-178147290 AATGTTTACCAGCACATCATTGG + Intergenic
966515669 3:180818340-180818362 AATATTTACCAGCACACAACTGG + Intronic
967044059 3:185720220-185720242 AATATTTACCAGCATAGCACTGG - Intronic
967281453 3:187827772-187827794 AACATTTTCCAGCACACCAGTGG - Intergenic
969179694 4:5428939-5428961 GACATTTACCAGCAAACCACTGG - Intronic
969453104 4:7286127-7286149 ACTGTTTACCAGCTCATCAGGGG - Intronic
969760761 4:9179758-9179780 AATGTGTCCCAGCAGACCAGTGG - Intergenic
969929513 4:10616864-10616886 AAAATTTGCCAGAACACCACTGG + Intronic
970239125 4:13989684-13989706 AACGATTGCCAGCAAACCACCGG - Intergenic
970437697 4:16051418-16051440 AATGTTTCCCAGCACTCAAAAGG - Intronic
970642257 4:18080155-18080177 AATATTGACCAGCATACCAATGG + Intergenic
971033551 4:22667580-22667602 GCTGGTTACCAGCACAGCACTGG + Intergenic
972611861 4:40663047-40663069 AACATCCACCAGCACACCACTGG + Intergenic
972722734 4:41716694-41716716 AAGGATTGCCAGCAAACCACTGG + Intergenic
972807431 4:42544479-42544501 AATGATGACTAGCAAACCACTGG + Intronic
973119840 4:46508591-46508613 AACATTTACCAGTACACCACTGG + Intergenic
974154253 4:58050552-58050574 AATGTGAACCAGCAGAGCACGGG - Intergenic
975782876 4:77858226-77858248 AACTTTTACCAACACACCACTGG + Intergenic
975893873 4:79062594-79062616 TATGTTCACCGGCATACCACTGG + Intergenic
976129465 4:81869621-81869643 AGCATTTACCAACACACCACTGG + Intronic
976533574 4:86184961-86184983 AACATTTACCAGCACACCATTGG - Intronic
976749373 4:88438829-88438851 GATATTTACCAGCACACCAATGG + Intronic
976945382 4:90759468-90759490 AATGTTTACCAGCACAATTCTGG - Intronic
977097437 4:92764157-92764179 ACCGTTCAGCAGCACACCACTGG + Intronic
977103367 4:92846992-92847014 AATGTTTAAAAGGATACCACTGG - Intronic
977958411 4:103056569-103056591 AGCATTTACCAGCACACCATTGG - Intronic
978298200 4:107233779-107233801 AATATTCATCACCACACCACTGG + Intronic
978498178 4:109382380-109382402 AACATTTACCAGCACACCAGTGG + Intergenic
978718606 4:111876819-111876841 ACCATTTACCAGCATACCACTGG - Intergenic
978798505 4:112732133-112732155 AACATCTACCAGCACACCACTGG + Intergenic
978819712 4:112951658-112951680 AATGTTTACTAGCACACCACTGG - Intronic
979354135 4:119682538-119682560 AACGTTTACCAACACACCTCTGG + Intergenic
979358768 4:119736634-119736656 AACGTTTACCAGCACACCACTGG - Intergenic
981354230 4:143768695-143768717 TGAGTTTATCAGCACACCACCGG - Intergenic
981887742 4:149697566-149697588 CAAATTTACCAGCACACCATTGG + Intergenic
982220483 4:153120969-153120991 AACATTTACCAGCACACCACTGG + Intergenic
982405185 4:155011699-155011721 AAACTTTACCAGCTCACCCCTGG + Intergenic
984635308 4:182104049-182104071 AATATTTACCAGCACTTCGCTGG - Intergenic
984756091 4:183326874-183326896 AACATTTACCAGCACACTGCAGG - Intergenic
985750568 5:1671836-1671858 AATATTTACAATCACGCCACGGG - Intergenic
989181258 5:38579527-38579549 AATGTAAACCAGCACACCGAAGG + Intronic
989452314 5:41601043-41601065 AGCATTTACCAGCACACCACTGG + Intergenic
990494826 5:56337043-56337065 AATATTTACCAGCACACCACTGG + Intergenic
990494849 5:56337198-56337220 AACATTTACCAGCACACCAATGG + Intergenic
990785979 5:59420343-59420365 AGTGTTAACCTGCACATCACTGG - Intronic
990810665 5:59719166-59719188 AATATTTACCAGCATACCAATGG - Intronic
991400467 5:66245965-66245987 AAAGATTGCCAGCAAACCACAGG - Intergenic
992534955 5:77690627-77690649 AATATTTGCCAGCACTTCACTGG + Intergenic
993919265 5:93780309-93780331 AATGTTTCCCAACATACCCCTGG - Intronic
996205591 5:120731577-120731599 AAAATTTACCAGCACATCATTGG + Intergenic
996431721 5:123387395-123387417 TATGCTTACCACCACACTACAGG + Intronic
997093258 5:130881636-130881658 AATATTTGCCACCACACCACTGG + Intergenic
997131239 5:131278614-131278636 AATATTTATCAGCAGACCACTGG + Intronic
997595752 5:135106377-135106399 AACATTTACCAGCACGCCACTGG + Intronic
997890148 5:137668903-137668925 AACATTTACCAGCACACCACTGG + Intronic
997911159 5:137874930-137874952 GACATTTACCAGCACACCACTGG - Intronic
998414323 5:141934896-141934918 AACATTTACCAGCACACTACTGG + Intronic
1000030259 5:157395533-157395555 AATGTTTATCAACTCAACACAGG - Intronic
1000304827 5:159985672-159985694 GCTATTTACCAGCACACCAAAGG + Intergenic
1001172385 5:169432742-169432764 AATATTTATCGGCAAACCACTGG + Intergenic
1002380764 5:178827827-178827849 AGCATTTACCAGCACACCACTGG + Intergenic
1003378767 6:5603584-5603606 AAAGTGTGCCAGCAAACCACTGG - Intronic
1003692965 6:8372908-8372930 GGTATTTACCAGCACACCACTGG - Intergenic
1004828927 6:19456047-19456069 AAAATTTACCAGCAAACCAAGGG + Intergenic
1006478673 6:34274281-34274303 AATGTTGCCAAGGACACCACAGG + Intergenic
1006784834 6:36659355-36659377 CTGGTTTACCAGCACACTACTGG - Intergenic
1006841905 6:37033862-37033884 CATTTTTACCAGCACCTCACTGG + Intergenic
1007483432 6:42164811-42164833 AACATTTACCAGCACACCACAGG + Intronic
1008422022 6:51312146-51312168 AGTATTTATCAGCACATCACTGG - Intergenic
1009421086 6:63465725-63465747 AACTTTCACCAGCACACCACAGG + Intergenic
1009860891 6:69330559-69330581 GATGTTTACCAGGACAACAGCGG - Exonic
1009948556 6:70368142-70368164 AACATTTGCCAGCACACCACTGG - Intergenic
1010072252 6:71757166-71757188 ATTATTTACCAGCACACCACTGG - Intergenic
1010840054 6:80638444-80638466 AACATTTACCAACACACCACTGG + Intergenic
1011026103 6:82871347-82871369 AACATTTACCAGCACACTACTGG - Intergenic
1011258356 6:85447027-85447049 AACATTTACCAGCACACCACTGG - Intergenic
1011361716 6:86532823-86532845 AATATATGCCAGCACACCACTGG - Intergenic
1011765672 6:90616794-90616816 AATCTTAACCAGCTCAGCACAGG - Intergenic
1012380284 6:98612741-98612763 AATATTTACCAACCCACCCCTGG + Intergenic
1013514118 6:110870097-110870119 AACGTTTACCAGCATGCCTCTGG - Intronic
1013724952 6:113082998-113083020 AACGTTTACCAGGACACGGCTGG + Intergenic
1013738581 6:113256984-113257006 CTGGTTTACCAGCATACCACTGG + Intergenic
1014239522 6:118999677-118999699 AACATTTACCAGCATACAACTGG - Intronic
1015004561 6:128263345-128263367 AACATTTACCAGCAGACTACTGG - Intronic
1015554097 6:134443158-134443180 AGCACTTACCAGCACACCACTGG + Intergenic
1016062831 6:139648073-139648095 AAAGATTGCCAGCAAACCACCGG + Intergenic
1016402627 6:143696994-143697016 GATGTTTGCCACCACAACACTGG + Intronic
1017330709 6:153195139-153195161 AACATTTACCAGCACACCACTGG - Intergenic
1017586454 6:155930788-155930810 AATATTTACCAGCATACCTCTGG - Intergenic
1018208294 6:161456065-161456087 AATATTAACCATCACAACACAGG - Intronic
1019054673 6:169214389-169214411 AATCGCTGCCAGCACACCACGGG - Intergenic
1019323662 7:426762-426784 GACGTTTGCCAGCACAGCACGGG - Intergenic
1020601913 7:10286273-10286295 ATCATTTACCAGCACAGCACTGG - Intergenic
1020648396 7:10844057-10844079 AACATTTATCAGTACACCACTGG - Intergenic
1020957924 7:14765844-14765866 AACATTTACCAGCACACTATTGG - Intronic
1023125383 7:36949746-36949768 AATGTTTAGCAGCATATCTCTGG + Intronic
1023203249 7:37721123-37721145 AATGTTCTGCAGCACATCACAGG - Intronic
1023663889 7:42499721-42499743 AAAGTATAGCAGGACACCACAGG - Intergenic
1024343310 7:48288669-48288691 AATATTTACCAGCCCAACACTGG + Intronic
1024819593 7:53311691-53311713 AATATTTACCAGCATAACAATGG + Intergenic
1028095345 7:86753787-86753809 AATATTTACCAGCACACCACTGG - Intronic
1028838423 7:95399805-95399827 GATGATTCCTAGCACACCACAGG - Intergenic
1029093012 7:98063230-98063252 AACATTTACCAGCACACCACTGG + Intergenic
1029588499 7:101491341-101491363 AACACTTACCAGCACACCATTGG + Intronic
1030313934 7:108095007-108095029 AACATTTACCAGCTCACCACTGG - Intronic
1030979462 7:116169221-116169243 AATATTTACCACCACACTACTGG + Intergenic
1031028706 7:116711859-116711881 AACATTTACCAGCACATCACTGG - Intronic
1031404259 7:121364950-121364972 AATAGTTAACAGCACACCACTGG - Intronic
1031769824 7:125829438-125829460 AATGTTTATCACCACAGCAATGG - Intergenic
1031993538 7:128213157-128213179 AACAGTTTCCAGCACACCACTGG + Intergenic
1032687594 7:134251349-134251371 AAAGCTTGCCAGCAAACCACCGG + Intronic
1032943708 7:136825510-136825532 AACATTTACCAGCAAAGCACTGG + Intergenic
1034111709 7:148543442-148543464 AACATTTACCAGCATATCACTGG - Intergenic
1034124331 7:148657350-148657372 AACATTTACCAGCATGCCACTGG - Intergenic
1036685435 8:10906274-10906296 AACATTTACCAGCACACCACCGG + Intronic
1037042070 8:14248144-14248166 AAAATCTACCAGCTCACCACTGG - Intronic
1037493136 8:19414189-19414211 AATATTTACCAGCACATCTCTGG + Intronic
1037552422 8:19987635-19987657 TGTATTTACCAGCACAACACTGG + Intergenic
1038662960 8:29512960-29512982 AACATTTACCAGCATACCACTGG + Intergenic
1039150797 8:34502955-34502977 AACGTTTCCCAGGACACCAGTGG - Intergenic
1040413160 8:47175606-47175628 CACATTTACCAGCACACCACTGG + Intergenic
1040542304 8:48371346-48371368 AACATTTACCAGCATAGCACTGG - Intergenic
1040580171 8:48691367-48691389 TACATTTACCAGCACACCACTGG - Intergenic
1042218205 8:66448496-66448518 CCAGTTTACTAGCACACCACTGG - Intronic
1043028224 8:75098662-75098684 AATGTCTAGCACCAAACCACTGG + Intergenic
1043885761 8:85598095-85598117 AACATTTACCAGCACACCACTGG - Intergenic
1044230845 8:89776037-89776059 TAGCTTTACCAGCCCACCACAGG + Intronic
1044400386 8:91763995-91764017 CAGGTTTACCAGCACAACATTGG + Intergenic
1044619502 8:94175152-94175174 AGCCTTTACCAGGACACCACTGG + Intronic
1044970791 8:97617377-97617399 AACATTTACCAGCACACCGCTGG - Intergenic
1045352321 8:101353058-101353080 AACATTTACCAGCACACAACTGG + Intergenic
1045680205 8:104650789-104650811 AATGTTTAGTGGCACATCACTGG + Intronic
1046869794 8:119193134-119193156 AACATTTACCAACACATCACTGG + Intronic
1046969111 8:120201498-120201520 TACATTTACCAGCACACCCCTGG + Intronic
1047035182 8:120930421-120930443 TTTGTTTACCAGCACACCACTGG + Intergenic
1047123538 8:121933191-121933213 AATATTTACCAGCACACCACTGG + Intergenic
1047153260 8:122288403-122288425 AAAGATTGCCAGCAAACCACTGG + Intergenic
1047166628 8:122446496-122446518 AACTTTTACCTGCACACCACAGG + Intergenic
1047297668 8:123585613-123585635 AATCATCTCCAGCACACCACTGG - Intergenic
1047684368 8:127289519-127289541 AATTTTTACAAGTACTCCACTGG - Intergenic
1048372873 8:133794960-133794982 AACATTTACCATCACACCACTGG - Intergenic
1048485044 8:134839764-134839786 AATATTTATCAGCACATTACTGG + Intergenic
1048504207 8:135006158-135006180 AATGATCACCAGCACATCAGTGG - Intergenic
1049170705 8:141159030-141159052 GATGTTTACCAGCACCAAACTGG - Intronic
1050164080 9:2746289-2746311 GATGATTACCTGCAAACCACCGG + Intronic
1050266984 9:3901493-3901515 ATACATTACCAGCACACCACTGG + Intronic
1051522220 9:18001850-18001872 TCTCTTTACCAGCTCACCACTGG - Intergenic
1051861189 9:21626945-21626967 AATATTTACCTGTACATCACTGG + Intergenic
1052181572 9:25534869-25534891 AATAATTACCATCAGACCACAGG + Intergenic
1052749912 9:32479334-32479356 AATATTAACCAGCACAGCACTGG + Intronic
1055401233 9:75926318-75926340 ACTATTTATCAGCACATCACTGG - Intronic
1055492971 9:76825170-76825192 AACATTTACCAGCAGACCACTGG - Intronic
1056721691 9:89077479-89077501 AACATTTACCAGCACACCACTGG + Intronic
1057387684 9:94618918-94618940 CCAGTTTACCAGCACATCACTGG + Intronic
1058454858 9:105129550-105129572 AATACTTACCAGCACACTGCTGG + Intergenic
1058754830 9:108074603-108074625 AATATTTACCAACAAACCATTGG + Intergenic
1059579205 9:115525409-115525431 AACATTTACCAGCATACCACTGG - Intergenic
1059661060 9:116400539-116400561 TATATTTACCAGTACAGCACTGG + Exonic
1059725109 9:117000758-117000780 AACATTTACCAGCACAACACTGG - Intronic
1059731451 9:117061012-117061034 TCAGTTTACCAGCATACCACTGG + Intronic
1059734176 9:117085301-117085323 AACAATTACCAGCACACCACTGG - Intronic
1060398385 9:123332534-123332556 GCAGTTTACCAGCACACCACTGG - Intergenic
1061906342 9:133701285-133701307 AGCTGTTACCAGCACACCACAGG + Intronic
1186017278 X:5212208-5212230 TATGTTTACCAGGACAACTCTGG + Intergenic
1186777742 X:12882664-12882686 AACATTTACCATCACACCACTGG + Intronic
1186784942 X:12948553-12948575 AACATTTACCAGCACATGACAGG - Intergenic
1187199505 X:17121294-17121316 AAGGTTTACCAACACACCACTGG - Intronic
1187716172 X:22104623-22104645 AACCTTTACTAGCACATCACTGG + Intronic
1187773925 X:22733400-22733422 AATATTTACCAGCACACCACTGG + Intergenic
1187833742 X:23409559-23409581 AAAGTTTATCAGCACACAATTGG - Intergenic
1188293708 X:28419209-28419231 AAGGATTGCCAGCAAACCACTGG + Intergenic
1188589885 X:31820795-31820817 TACATCTACCAGCACACCACTGG - Intronic
1188869726 X:35359233-35359255 AGTGGTTCCCAGCATACCACAGG - Intergenic
1189277595 X:39798001-39798023 GTTGTTCACCAGCTCACCACAGG - Intergenic
1189680989 X:43515744-43515766 AACATTTACCAGCACACTGCTGG + Intergenic
1189889545 X:45585044-45585066 AACATTTACCAGCATACCACTGG + Intergenic
1189969212 X:46400754-46400776 AACATTTACCAGCACACCACTGG - Intergenic
1190105560 X:47558611-47558633 AACATTTACCAGCACACCATTGG + Intergenic
1190479645 X:50863243-50863265 AATATTTACCAGCATACCATTGG - Intergenic
1191636051 X:63378278-63378300 CAGGTTTACCAGCACACCACTGG - Intergenic
1191943270 X:66502703-66502725 AATGTATACCATAACACCAAAGG - Intergenic
1192408773 X:70913914-70913936 AATGTTCACCAGCAGACTACTGG + Intergenic
1192442785 X:71187048-71187070 AATGTCTTCGAGCACATCACTGG - Intergenic
1192544261 X:72000136-72000158 AACACTTACCAGAACACCACCGG + Intergenic
1194220775 X:91187592-91187614 AATGTTTAGGAGAAAACCACTGG + Intergenic
1194589091 X:95774528-95774550 AATGTTTAACAGCTCATCAGAGG - Intergenic
1195416322 X:104623576-104623598 AATACTTAACAACACACCACTGG + Intronic
1195852776 X:109301233-109301255 AACATTTACCAGCACATCCCTGG + Intergenic
1196004957 X:110826108-110826130 AAGGATTTCCAGCAAACCACCGG + Intergenic
1196114870 X:111988091-111988113 AACATTTACCAGAACACCACTGG + Intronic
1196679307 X:118454684-118454706 AACATTTACTAGTACACCACTGG - Intergenic
1197651613 X:129071618-129071640 CCAATTTACCAGCACACCACAGG + Intergenic
1198119891 X:133581450-133581472 AATATTTACCAGCTCACCACTGG - Intronic
1199544778 X:148996294-148996316 ACATTTTACCAGCACACCACTGG - Exonic
1199951009 X:152706271-152706293 AAGGTTGACCAGCACAGCCCTGG - Intergenic
1199953309 X:152722895-152722917 AAGGTTGACCAGCACAGCCCTGG - Intergenic
1199956373 X:152745555-152745577 AAGGTTGACCAGCACAGCCCTGG + Intergenic
1199958675 X:152762190-152762212 AAGGTTGACCAGCACAGCCCTGG + Intergenic
1200043541 X:153387653-153387675 AACCTTAACCAGCACACCACAGG - Intergenic
1200557280 Y:4651333-4651355 AATGTTTAGGAGAAAACCACTGG + Intergenic