ID: 1097945017

View in Genome Browser
Species Human (GRCh38)
Location 12:65357988-65358010
Sequence GCCTACACTTAAAAAAGAGT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 158
Summary {0: 1, 1: 0, 2: 0, 3: 15, 4: 142}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1097945014_1097945017 19 Left 1097945014 12:65357946-65357968 CCTTTTCCTAGTGTATTCTTAGG 0: 1
1: 0
2: 1
3: 25
4: 226
Right 1097945017 12:65357988-65358010 GCCTACACTTAAAAAAGAGTAGG 0: 1
1: 0
2: 0
3: 15
4: 142
1097945012_1097945017 23 Left 1097945012 12:65357942-65357964 CCCTCCTTTTCCTAGTGTATTCT 0: 1
1: 0
2: 3
3: 39
4: 446
Right 1097945017 12:65357988-65358010 GCCTACACTTAAAAAAGAGTAGG 0: 1
1: 0
2: 0
3: 15
4: 142
1097945016_1097945017 13 Left 1097945016 12:65357952-65357974 CCTAGTGTATTCTTAGGAAGAAA 0: 1
1: 0
2: 2
3: 14
4: 280
Right 1097945017 12:65357988-65358010 GCCTACACTTAAAAAAGAGTAGG 0: 1
1: 0
2: 0
3: 15
4: 142
1097945013_1097945017 22 Left 1097945013 12:65357943-65357965 CCTCCTTTTCCTAGTGTATTCTT 0: 1
1: 0
2: 4
3: 69
4: 411
Right 1097945017 12:65357988-65358010 GCCTACACTTAAAAAAGAGTAGG 0: 1
1: 0
2: 0
3: 15
4: 142
1097945011_1097945017 24 Left 1097945011 12:65357941-65357963 CCCCTCCTTTTCCTAGTGTATTC 0: 1
1: 0
2: 4
3: 23
4: 317
Right 1097945017 12:65357988-65358010 GCCTACACTTAAAAAAGAGTAGG 0: 1
1: 0
2: 0
3: 15
4: 142

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1097945017 Original CRISPR GCCTACACTTAAAAAAGAGT AGG Intronic
902750759 1:18508908-18508930 GCCTTCATTTAAAAAATTGTAGG + Intergenic
907184147 1:52596491-52596513 GCCTAGACTTAAGAAAGTGATGG + Intergenic
909732563 1:78912762-78912784 CCCTACACTTTAAAAAAAATTGG + Intronic
912826861 1:112912677-112912699 GCCTTCTCTGAAAAAAGAGAAGG + Exonic
913293716 1:117298861-117298883 GGCTACAACTAAATAAGAGTAGG - Intergenic
915884401 1:159707435-159707457 GCCTAAAATTGAAAAAGAGAGGG + Intergenic
916529871 1:165646792-165646814 ACCTTCACTTAAAACAGAGCAGG - Intronic
916650290 1:166828818-166828840 GCCTAAACTCCAAAAGGAGTAGG - Intergenic
919537133 1:198801280-198801302 GACAACACTTAAAAAAAAATTGG - Intergenic
920168351 1:204052661-204052683 ACATACATTTAAAAAAGATTAGG + Intergenic
920949382 1:210558013-210558035 GGCTACACTTTAAAAAGAACTGG + Intronic
921827688 1:219692277-219692299 GCCTGCACTTAGGAAGGAGTTGG + Intronic
921855239 1:219975132-219975154 TCCTACACTGAAAAAGGAGAGGG + Intronic
922274452 1:224064291-224064313 GACTACTCTTCAAAAAGATTTGG - Intergenic
1064282183 10:13960848-13960870 CCCTTCACTTAAAAAAAAGGAGG - Intronic
1067673887 10:48352338-48352360 ATCTATACTTAAAAAGGAGTTGG - Intronic
1067988249 10:51178336-51178358 GCATACATTTAAAAAATATTGGG + Intronic
1072042576 10:91622847-91622869 GCCCAGACAGAAAAAAGAGTGGG + Intergenic
1073701224 10:105929089-105929111 GCAGACATTTAAAAAAGAATTGG + Intergenic
1074147557 10:110730117-110730139 GACTAGTCTTAAAAAAGAGAAGG - Intronic
1078555738 11:12324645-12324667 GCCTAGTCTTGAACAAGAGTTGG + Intronic
1089241271 11:117082723-117082745 GAATACACTTAAAAAAAATTGGG + Intronic
1091492013 12:940759-940781 GACTACACCTAGAAAAGAATAGG + Intronic
1092519073 12:9248003-9248025 GCCTACTTTTAAAAGAAAGTAGG + Intergenic
1094056215 12:26272237-26272259 GGCAACACTTAAAACAGAGAGGG - Intronic
1094311994 12:29094167-29094189 CCCTACAATTAGAAGAGAGTGGG + Intergenic
1094752879 12:33433872-33433894 GCCTAGGTTTAACAAAGAGTAGG - Intronic
1094794797 12:33959217-33959239 GCCTGCAATTAAAATAGATTAGG + Intergenic
1095798128 12:46242950-46242972 TGCTAAACTTAAAAAAGAGAAGG - Intronic
1097469420 12:59969906-59969928 GCTTACAGTTAAAATAGAATAGG - Intergenic
1097945017 12:65357988-65358010 GCCTACACTTAAAAAAGAGTAGG + Intronic
1099153322 12:79143059-79143081 TCCTACATTTAAAAAAAAGATGG + Intronic
1101006104 12:100402319-100402341 GCCTGCAGTTAAAAAAGAAAAGG - Exonic
1103873495 12:124108573-124108595 GCCTAGACTTAAGAAAGACATGG - Intronic
1105519836 13:21122382-21122404 TCCTATACTTAAAAAAAATTTGG + Intergenic
1105583112 13:21719693-21719715 ACCTACACTTAATAAAAAGCCGG + Intergenic
1107332152 13:39312508-39312530 TCATACACTTAAAAAAAAATAGG + Intergenic
1112408002 13:99137843-99137865 GCTTACATTTAAAAAATAATCGG + Intergenic
1113246770 13:108405102-108405124 GCCAACACTTACCAAAAAGTGGG + Intergenic
1115927687 14:38454549-38454571 GCCTACATTTAATCAAGAGAAGG + Intergenic
1117028715 14:51648399-51648421 GCCTACACTTAAAATAACCTGGG + Intronic
1121704927 14:95984537-95984559 GCTTACAGTGAAAAAAAAGTTGG + Intergenic
1122563085 14:102631051-102631073 GCCTACACTTCAAAAAGAACTGG - Intronic
1124889827 15:33722590-33722612 GCCTAAACCAAAAACAGAGTAGG + Intronic
1130278487 15:82497698-82497720 GCCTCCACTTCACAAAGTGTTGG - Intergenic
1131372079 15:91890902-91890924 GCCTTTACTTAAAAATGAATGGG - Intronic
1134426589 16:14154438-14154460 GACTACATTTTAAAAAGATTCGG - Intronic
1135613424 16:23888536-23888558 GCACACACTTAAAAAAGAAATGG - Intronic
1140380571 16:74483456-74483478 GCCTAGAGTTAAAACAGACTTGG - Intronic
1148004072 17:44411097-44411119 GTCTACACTTAAAGAGAAGTGGG - Intronic
1149409992 17:56395280-56395302 CCCTACACTTGAAAAGGAGTGGG + Intronic
1152791062 17:82280146-82280168 GCCTACATTTAAAAAAAAAAAGG + Intergenic
1153761994 18:8340389-8340411 ACCTACGCTAAAAAAAGATTAGG - Intronic
1154130297 18:11731073-11731095 GCCTAAACTCCAAAAAGAATGGG + Intronic
1156162120 18:34372288-34372310 GCCTACACCTACAAAGGAATCGG + Intergenic
1157241325 18:46012472-46012494 ATCTACAATTAAAAAAGAGTTGG + Intronic
1160171328 18:76557999-76558021 GCTTACATTAAAAAAAGAGGAGG + Intergenic
1163090259 19:15014562-15014584 GACTACATTTAAAAAAGCATTGG + Intronic
1164725076 19:30460787-30460809 GCCCACACATAAAAGAGAGTTGG + Intronic
925654020 2:6125548-6125570 GCGTACACTTCACAAAGAGGTGG + Intergenic
927167088 2:20334378-20334400 GCCTACATTAAAAACAGGGTGGG + Intronic
929087541 2:38183279-38183301 GCCTACATTTTAAAAAGAATTGG - Intergenic
931598881 2:63982256-63982278 GCCTACCTCTAAAAAACAGTGGG - Intronic
932605110 2:73160199-73160221 GCCTCCACTTCACAAATAGTTGG - Intergenic
934591718 2:95557912-95557934 GGCTAGTCTTAAAAAAGAGTAGG - Intergenic
940307807 2:152245315-152245337 GCCTAGATTTAGAAAAGATTTGG - Intergenic
941573216 2:167197285-167197307 TTCTACACTTCAAAAAAAGTAGG + Intronic
942909541 2:181226518-181226540 GCTTCCACTTAAAGAATAGTAGG + Intergenic
943916812 2:193645326-193645348 GCTTACACCAAAAAAAGTGTTGG - Intergenic
944244588 2:197518185-197518207 TCCTACATTAAAAAAAAAGTTGG + Intronic
945054133 2:205853280-205853302 ACCTACACTTACACAAAAGTGGG + Intergenic
945107247 2:206327730-206327752 GACTGCCCTTGAAAAAGAGTAGG - Intergenic
946441150 2:219697274-219697296 GCCTAGACTTAAGAAAGTGATGG + Intergenic
947784141 2:232799791-232799813 GGCTACTATTAAAAAAGTGTTGG - Intronic
947800111 2:232923928-232923950 GCCTTCCCTTATAAAAGAGGTGG + Intronic
1168995761 20:2132021-2132043 CACAACATTTAAAAAAGAGTGGG - Intronic
1169456172 20:5754448-5754470 GCCTAAACTCCAAAAAGAGGTGG + Intronic
1171827290 20:29931730-29931752 ACCTACACATAAAAAATAGGAGG + Intergenic
1171829511 20:29974814-29974836 GCCTACACATAAAAACTAGGCGG + Intergenic
1171830226 20:29988411-29988433 ACCTACACATAAAAACTAGTCGG + Intergenic
1171832232 20:30027335-30027357 ACCTACACATAAAAAAGAGGCGG + Intergenic
1171832587 20:30034399-30034421 GCCTACACATAAAAACTAGGCGG + Intergenic
1172018223 20:31892690-31892712 GTGTACCCTTGAAAAAGAGTTGG + Intronic
1178140720 21:29680513-29680535 GCCTACTCTTGAAGAATAGTAGG - Intronic
1178426877 21:32485691-32485713 GTCTCCACTTAGACAAGAGTGGG - Intronic
1180577643 22:16794521-16794543 GCATACACTTTAAATAGATTAGG + Intronic
1182042016 22:27245466-27245488 GCCTACTCTTGGGAAAGAGTAGG + Intergenic
1183760655 22:39813260-39813282 TGCTACACTCACAAAAGAGTTGG - Intronic
1184505071 22:44895621-44895643 GCCCACACTTAAGAAAGTGGTGG + Intronic
951328104 3:21330085-21330107 GCCTACATTTAAGAAACAGTTGG - Intergenic
952987215 3:38796610-38796632 GCCTTAACATAAAAAAGAATGGG - Intergenic
957112241 3:75978181-75978203 GCCTCCACTTAAAAACTGGTTGG + Intronic
957668299 3:83266144-83266166 ACCTACACTTAAAAAGGAAAAGG + Intergenic
959875864 3:111381049-111381071 CCCTACAGCTAAAAGAGAGTGGG + Intronic
963201996 3:142595804-142595826 GCCCACACTCAAACAAAAGTGGG - Intergenic
965382278 3:168004724-168004746 GCCAATACATAAAAAGGAGTAGG - Intergenic
967269566 3:187721563-187721585 GCCTACACTTCAAAAAGGGATGG + Exonic
967350998 3:188513813-188513835 GCCCTTACTTATAAAAGAGTTGG + Intronic
969121416 4:4914146-4914168 GCCTGAACTTAAACAACAGTAGG - Intergenic
971968119 4:33589354-33589376 GTCTACACTTAACAAATATTTGG + Intergenic
972296768 4:37746527-37746549 GCCAACTCTTAAATAAGAGCTGG + Intergenic
974426594 4:61750218-61750240 GCAAACACCTAAAAAATAGTAGG - Intronic
977804365 4:101279161-101279183 GCCTAGAATTAAAAAAGAAAAGG + Intronic
980425716 4:132625440-132625462 GAATACACATAAAAAAGTGTTGG - Intergenic
980940771 4:139272074-139272096 GCCTACACCTCAACTAGAGTGGG + Intronic
981088762 4:140710915-140710937 ACCTACACTTAGAAAAGCGCTGG - Intronic
981866128 4:149421323-149421345 ACTTACACTGAAAAAAAAGTGGG + Intergenic
982790951 4:159591013-159591035 TCCTACACTTAAGAAAAAGAGGG - Intergenic
983060759 4:163156984-163157006 TTCTACACATAACAAAGAGTAGG + Intronic
984440650 4:179765419-179765441 GGCTAAGCCTAAAAAAGAGTTGG - Intergenic
986901314 5:12437526-12437548 GCCTACATTTAAGAACCAGTGGG + Intergenic
987750454 5:22032319-22032341 GCCTACACTTAATATATAATGGG - Intronic
992692096 5:79250760-79250782 GCCAACATTAAAAAAAAAGTAGG - Intronic
993163920 5:84326505-84326527 CCCTACACTTAAAAATGGTTAGG + Intronic
994537097 5:101046376-101046398 CCTAGCACTTAAAAAAGAGTAGG - Intergenic
994573840 5:101550998-101551020 GCCGACCCTTTAAAATGAGTTGG + Intergenic
995041064 5:107588557-107588579 GCATACACTTTAAAATGACTTGG + Intronic
995821191 5:116234907-116234929 GCCGCCACTTAGAAAAGAGTTGG + Intronic
998868872 5:146532915-146532937 GCCATCACTTAAAAATGAATGGG - Intergenic
999703432 5:154249508-154249530 GCATAGGATTAAAAAAGAGTAGG - Intronic
999777206 5:154820918-154820940 GACTACACTTGAAAAAGTCTGGG + Intronic
1000605597 5:163324316-163324338 TCCTACACATTAAAGAGAGTGGG - Intergenic
1002867661 6:1137142-1137164 GCGTACACTTAACAAAGATAAGG + Intergenic
1004785074 6:18959463-18959485 ACCTACCTTTAAAAAAGAGGGGG - Intergenic
1005271943 6:24175404-24175426 GACTACACTGAAAACTGAGTGGG + Intronic
1007291171 6:40788063-40788085 GCCTACAATGAATAAACAGTGGG - Intergenic
1007799908 6:44383645-44383667 GCATACATTTAAGAAAGATTAGG + Intergenic
1010669308 6:78668282-78668304 GCCTACAGTTAAGAAACAGATGG + Intergenic
1012270263 6:97200792-97200814 GCTTACACTGATAAAAGAGTAGG + Intronic
1012849366 6:104428531-104428553 GCCTACAATCTAAAAGGAGTGGG - Intergenic
1013407143 6:109853455-109853477 GCCTACACTTAGTACAGAGGAGG + Intergenic
1014842397 6:126235847-126235869 CCCTGAACTTAAAAAAAAGTTGG + Intergenic
1015400941 6:132787390-132787412 GCCTACACTCAAAGGAAAGTGGG + Intronic
1017153384 6:151301352-151301374 GCATTCACTTAAAAAATAATGGG - Intronic
1017161470 6:151369667-151369689 ACATACACTTAAAAAACAGGTGG + Intronic
1018444273 6:163841076-163841098 GCCTAGACCTAAAAAACATTAGG + Intergenic
1023098936 7:36692969-36692991 TCCTACTCTTAAAAAAGTGTAGG + Intronic
1024575525 7:50760748-50760770 AGCTACACTGAAACAAGAGTGGG + Intronic
1025624170 7:63203829-63203851 GCATACACTTAGAAAAGTTTAGG + Intergenic
1032008200 7:128321456-128321478 GCCTACCTCTTAAAAAGAGTGGG - Intronic
1038376544 8:27045730-27045752 GCCTAGACTTAAGGAAGAGGTGG + Intergenic
1043888117 8:85625826-85625848 TCGTACACTTAAAATAGAATCGG + Intergenic
1046843556 8:118888824-118888846 GACTACATTTAAAAAAGAATAGG + Intergenic
1046925661 8:119785265-119785287 TCCTACATTTAAGAAAAAGTAGG + Exonic
1046959251 8:120093067-120093089 GCCTACTCTGAAACCAGAGTGGG + Intronic
1047098499 8:121650119-121650141 GCCTACACATAATATATAGTTGG - Intergenic
1047956625 8:129981456-129981478 GTCTCCACTTAAAAAAGGGTGGG - Intronic
1048616302 8:136079259-136079281 GGGTACAGGTAAAAAAGAGTGGG - Intergenic
1052910874 9:33880240-33880262 GCCTACACTGGAAAAAATGTAGG - Intronic
1055474630 9:76649676-76649698 GGCTACTCTTAAAAATGAGCAGG - Intronic
1059725115 9:117000884-117000906 GCCATCACTGAACAAAGAGTTGG + Intronic
1188519516 X:31022066-31022088 GCCTATACTTAGAAAGGAGTGGG + Intergenic
1189203473 X:39217758-39217780 CTCTACTCTGAAAAAAGAGTGGG - Intergenic
1191196997 X:57735074-57735096 GCATACATTTAAAAAATAGCTGG + Intergenic
1195061883 X:101204234-101204256 GCTTACACTAGAAAAAGAGAAGG - Intergenic
1196142209 X:112275932-112275954 GCTTACTCTTAAAAAAGTGGAGG - Intergenic
1198816748 X:140599657-140599679 GCCTACACCACAAATAGAGTAGG - Intergenic
1199923265 X:152432633-152432655 GCATACAATAAAAAAAGAATGGG + Intronic