ID: 1097946397

View in Genome Browser
Species Human (GRCh38)
Location 12:65373675-65373697
Sequence ATTAAGAAACCTAATGAGCA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 221
Summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 208}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1097946397 Original CRISPR ATTAAGAAACCTAATGAGCA TGG Intronic
900084216 1:880831-880853 TTGAATAAACCTATTGAGCAAGG - Intergenic
900848130 1:5120204-5120226 TTTAAAAAACAAAATGAGCAGGG + Intergenic
903444473 1:23412893-23412915 ATTAAGAAAACTAAAAAGGAAGG + Intronic
904629094 1:31828201-31828223 ATTAAGAAGCCTGATGGGCTGGG - Intergenic
907433353 1:54427879-54427901 ATTAAAAAACAAAATTAGCAGGG - Intergenic
908135340 1:61126642-61126664 ATTAATAAAAATAATGAACAAGG + Intronic
908436437 1:64111507-64111529 CTTAAGAACCCTCAGGAGCATGG + Intronic
909900162 1:81124223-81124245 AATTATAAACCTTATGAGCAAGG - Intergenic
911219409 1:95231871-95231893 ATTAAGAAATCAACTGAGAAAGG + Intronic
911864904 1:103006201-103006223 ATAAATAAAACTAATGATCATGG + Intronic
911990526 1:104691460-104691482 ATAAAGAAATTTAATGAGGATGG + Intergenic
912044873 1:105441716-105441738 ATTGAGAAACCTAAGGGCCATGG + Intergenic
914212478 1:145592869-145592891 ATTAAGAAACCTGAAGATGAGGG + Intergenic
915123225 1:153645694-153645716 TTTCAGAAACCTAAGGATCAGGG - Exonic
915857328 1:159403375-159403397 ATTAATAAACCAAATGTGTAAGG + Intergenic
916641823 1:166737523-166737545 ATTCAGATATCGAATGAGCAAGG + Intergenic
916743452 1:167666198-167666220 TTTAATAAACCAACTGAGCATGG + Intronic
921215024 1:212929240-212929262 AATAAGAAACTAAATGACCACGG - Intergenic
924244368 1:242068196-242068218 CTGAATAAACCTATTGAGCAAGG - Intergenic
924604714 1:245522858-245522880 AATATGAATCCTAAAGAGCAAGG - Intronic
1064668912 10:17688123-17688145 ATTAAGAACCTTAAGGAACAAGG + Exonic
1066548423 10:36527262-36527284 ATTAAGAAATAGACTGAGCACGG - Intergenic
1068996307 10:63209008-63209030 ATTAAGAAAAATTATGAACAAGG + Intronic
1070097435 10:73351724-73351746 ATTAAAAAACATAATGGGCTGGG - Intronic
1071251220 10:83821985-83822007 ATAATCACACCTAATGAGCAAGG + Intergenic
1071355910 10:84794878-84794900 ATTAAGAAACACATTCAGCAAGG - Intergenic
1073896771 10:108169866-108169888 ATTAAGAAACCTATTAATTAGGG + Intergenic
1074392927 10:113072939-113072961 ATTAAGAAACCTCAAAACCATGG - Intronic
1076116668 10:127906272-127906294 ATTCATAAGCCTAATGAGCTGGG + Intergenic
1077202433 11:1317801-1317823 ACTAAGAAGCCTAATCAGCTAGG + Intergenic
1077633942 11:3829168-3829190 GTTAAGAAACCTGCTGAGTAAGG + Intronic
1085738420 11:79059191-79059213 ATTAAGAAACCTACTTTGAAAGG - Intronic
1086094683 11:83038522-83038544 ATTAAGAAAAATAATGAGGCTGG + Intronic
1087771667 11:102217284-102217306 ATTTAGAAAAATAATGAGAAAGG + Intronic
1088286266 11:108191740-108191762 GTTAAGAAACCAAGTGGGCATGG + Intronic
1091513116 12:1150559-1150581 CTTAAGATTCCTAATGAGAATGG + Intronic
1095700104 12:45182422-45182444 TTTTAGAAACCTAAAGAGCTCGG - Intergenic
1097623131 12:61965659-61965681 AGTAAGAAGTCTAATTAGCAGGG + Intronic
1097946397 12:65373675-65373697 ATTAAGAAACCTAATGAGCATGG + Intronic
1098242567 12:68483223-68483245 ATAAAGATACCTAATTAACAAGG - Intergenic
1098969291 12:76833047-76833069 ATTAAGTAACTTAATAAGCTGGG - Intronic
1099057340 12:77860244-77860266 ACTAAGAAACTTAAGGATCAAGG + Intronic
1100450983 12:94706220-94706242 ATTAAAAAACCTAAAGGACAGGG - Intergenic
1101042839 12:100773962-100773984 AATATGAAAACAAATGAGCATGG - Intronic
1101366204 12:104072937-104072959 ATTAAGAAACCAAATCGGCCGGG - Intronic
1105287478 13:19017337-19017359 ATTAAGAAGTCTAATGAAAAAGG + Intergenic
1105674732 13:22658490-22658512 ATAAAGACACTTAATAAGCAAGG - Intergenic
1107201717 13:37728315-37728337 ATTAATAAACAAAATCAGCAAGG + Intronic
1109458098 13:62619803-62619825 ATTAAAAAAAAGAATGAGCAAGG + Intergenic
1110068313 13:71138714-71138736 ATTAAGAAAGCCAGTGAGCTGGG - Intergenic
1110086036 13:71381036-71381058 ATTAAGAAACAGAATTAGCCAGG + Intergenic
1110316142 13:74109759-74109781 CTTAAGAAATATAAAGAGCAAGG + Intronic
1111463829 13:88581314-88581336 GTAAAGAAACCAAATGAACAAGG + Intergenic
1111910196 13:94302651-94302673 TTTACAAAACCTAATGAGAATGG - Intronic
1112226819 13:97547662-97547684 ACTAAGATACCTAATAAGAAAGG - Intergenic
1112488495 13:99841196-99841218 ATTCAGCAACCTGAAGAGCACGG + Intronic
1112823690 13:103366408-103366430 ATTAAGGAACATAAAGGGCATGG - Intergenic
1112910182 13:104472801-104472823 ATTAAGGAAACTAAAGAGAAAGG + Intergenic
1114400963 14:22410151-22410173 ATTAAGAAAAGTAAAGAGGAAGG + Intergenic
1114592818 14:23883639-23883661 ATTATGAAACATAAAGAACAGGG - Intergenic
1115935246 14:38544796-38544818 ATTAAGATCCCTAATCAGCTGGG + Intergenic
1116176371 14:41475350-41475372 ATAAGGAAACCTAATGAGCCGGG - Intergenic
1116760950 14:49012916-49012938 ATAAAGAAAATAAATGAGCAAGG - Intergenic
1117020216 14:51562753-51562775 ATTAAGAAACACAATTTGCATGG + Intronic
1117105378 14:52393023-52393045 ATTAAGAAACCAGCTGGGCATGG - Intergenic
1118058167 14:62104823-62104845 TTTAAGACACCTAATGAGGTAGG - Exonic
1118660131 14:67999884-67999906 TTTAAGGAACTAAATGAGCAAGG + Intronic
1119058255 14:71446248-71446270 ATTAGAAACCCAAATGAGCATGG - Intronic
1120381746 14:83789460-83789482 ATTAAGAAAGCCAAAGACCATGG + Intergenic
1120532650 14:85652070-85652092 ATTAAAAAAAGCAATGAGCAAGG + Exonic
1122021506 14:98841605-98841627 ATCAAGGAACCTGATGTGCAGGG + Intergenic
1122727724 14:103769784-103769806 ATCAAGATACCTTATGAACACGG + Intronic
1124984643 15:34595064-34595086 ATTCTGAAACCTAATAAACAAGG - Intergenic
1133382849 16:5345627-5345649 TTTAAGAAGCCCAACGAGCACGG - Intergenic
1133632839 16:7638240-7638262 CTTAAGAAAGCTAATGAGAAGGG - Intronic
1134363496 16:13554766-13554788 ATTAAGAAAACAAATGAACTGGG - Intergenic
1136100777 16:27994091-27994113 ACTAAGAAAATTAAGGAGCATGG - Intronic
1138966466 16:62090454-62090476 ATTATAAAACCAAATGAGCATGG + Intergenic
1140487272 16:75303531-75303553 ATTAATAAACTGAATGAGCTGGG + Intronic
1140846987 16:78899962-78899984 TTTAACAAACCTAATTATCAAGG - Intronic
1141606579 16:85157410-85157432 ATTTAGTAACCTTATGAGAAAGG + Intergenic
1143608066 17:8002568-8002590 ATTAAGGACCCTAATCAGCTTGG + Intergenic
1146596621 17:34174823-34174845 ATTAAGAAAACTAAAGAGATGGG + Intronic
1148549292 17:48541263-48541285 TTAAAGAAACCTAAGGAGGATGG + Intronic
1149403874 17:56327157-56327179 ATGAAGAAACCAAGTGAGTATGG - Intronic
1150501632 17:65656567-65656589 AATAAGTAAACAAATGAGCATGG - Intronic
1150748625 17:67838167-67838189 AATAAGTAAACAAATGAGCATGG + Intronic
1151158537 17:72144959-72144981 AGTAAGATACCAAATCAGCAAGG - Intergenic
1152274140 17:79344475-79344497 ATTGAGAAGCCCAATGAGGAAGG - Intronic
1152909728 17:82994998-82995020 ATTAAAAATCCTAAAAAGCAAGG + Intronic
1153831892 18:8930966-8930988 ATTATGAAAGGTCATGAGCAGGG - Intergenic
1156617093 18:38799776-38799798 ACTAAGAAAATTAAGGAGCATGG - Intergenic
1158451461 18:57569707-57569729 ATAAAGAGCCCTAGTGAGCATGG - Intronic
1158823096 18:61183965-61183987 ACTAATATACCTAATGACCAAGG + Intergenic
1165294496 19:34915756-34915778 TCTAAGAAGCCTAGTGAGCATGG + Intergenic
1165306202 19:35004521-35004543 AGTAAGAAAACAAGTGAGCAGGG - Intronic
1165647055 19:37449572-37449594 ATGAAGAAACATAATGCTCAAGG - Intronic
1165663184 19:37600815-37600837 ATAAAGAAACTTGATGGGCAGGG - Intronic
1165726446 19:38116211-38116233 ATTAAGAAACATAAAGAGACCGG + Intronic
1168670856 19:58240056-58240078 ATAAAGAAACCTAAGCACCAAGG - Intronic
925183630 2:1832519-1832541 TTTAGGAAACAGAATGAGCAGGG - Intronic
925627526 2:5856172-5856194 AAAAAGAAACTGAATGAGCAAGG + Intergenic
928206138 2:29285237-29285259 AATAAGAAAGCCACTGAGCACGG - Intronic
931946984 2:67320349-67320371 TTTAAGAAACCTAAACAGTATGG - Intergenic
932376934 2:71244869-71244891 ATAAACAAATCTAATGAGCCAGG + Intergenic
936488437 2:112947489-112947511 ACCAAGAAAACTAAGGAGCATGG - Intergenic
937460667 2:122083097-122083119 AGTCAGAAACTTAATTAGCAAGG + Intergenic
938749730 2:134317210-134317232 ACTAAGAAACCAAACAAGCAGGG - Intronic
942081027 2:172399694-172399716 TTTAAGAACCCTGATGAACAAGG + Intergenic
942117243 2:172740040-172740062 AATATGTAACCAAATGAGCATGG - Intronic
945346094 2:208718550-208718572 ATTATTAAACTTAATGAGAAAGG - Intronic
945957324 2:216098559-216098581 ATGAAGCCACCTAAAGAGCAGGG - Intronic
946758968 2:222974387-222974409 AGTAAAACTCCTAATGAGCATGG - Intergenic
947005639 2:225508416-225508438 ATTCAGAAACCAAAGAAGCAGGG - Intronic
947303069 2:228710286-228710308 ATTAAGAAAATTAATAGGCAAGG - Intergenic
947334999 2:229072942-229072964 ATGAACAAACCTACTCAGCAAGG + Intronic
948871577 2:240801927-240801949 ATTTACAAAACTAATGACCATGG + Intronic
1169633491 20:7661012-7661034 AGTAATAAACCTAATAAGTAAGG + Intergenic
1172561145 20:35889693-35889715 ATTAAGAAACAGAATATGCATGG - Intronic
1172741776 20:37174312-37174334 ACAAATAAACCAAATGAGCAAGG - Intronic
1173235163 20:41238858-41238880 AGTAAGAAACCTAATTTGAAAGG + Intronic
1175646488 20:60677304-60677326 ATTAAAAAACATATTTAGCACGG - Intergenic
1180334458 22:11563602-11563624 TTGAATAAACCTATTGAGCAAGG - Intergenic
1182157826 22:28092324-28092346 ATTAAGGATCCTGATGAACAAGG - Intronic
1182934743 22:34210380-34210402 ATTAAGAAATCTAATCAGCCTGG + Intergenic
951469236 3:23037566-23037588 AGTAGGAAACTTAATGAGCGAGG - Intergenic
951680799 3:25292636-25292658 ATTAAGAAAGCTAAAGAGGAAGG - Intronic
952127021 3:30312918-30312940 ATTATGAAAACAAATGACCATGG - Intergenic
952294981 3:32053676-32053698 ATTAAAAAAAATAATGAGGATGG + Intronic
953833312 3:46321624-46321646 AGTAAGAAACCAAAAGAGGAAGG + Intergenic
954840527 3:53507691-53507713 AAAAACAAACCAAATGAGCAAGG - Intronic
955382715 3:58452966-58452988 ATTAAGAAACCCACTGAGGCTGG - Intergenic
955447687 3:59031579-59031601 TTAAAGAAACCTAGTGACCATGG + Intronic
955763070 3:62310152-62310174 ATAAAGAAAACTAATGATGAAGG + Intergenic
960304168 3:116040890-116040912 ATTAAGAAAACAAATTAGCCAGG - Intronic
961016044 3:123469205-123469227 ATTTATAAACCTCAAGAGCAGGG + Intergenic
963398951 3:144772368-144772390 AATAAGAAACATAATGCGAATGG + Intergenic
964559367 3:157976693-157976715 ATCAAGAAACCAAATGCTCAGGG - Intergenic
964852432 3:161109147-161109169 ATTAACAAACCAACTGTGCAGGG + Intronic
964861697 3:161209533-161209555 ATGAAGAAACCTAATTAGTATGG - Intronic
966590929 3:181682210-181682232 CTTAACAACCCTAATGATCAGGG - Intergenic
966650909 3:182299997-182300019 ATTTAAAAACCTTCTGAGCAAGG + Intergenic
967490391 3:190083979-190084001 TTTAAAAAACATAATGAGAATGG - Intronic
967770111 3:193325317-193325339 ATAAAGAAACCAAGTGGGCAGGG - Intronic
968243265 3:197112889-197112911 ATTAAGAAACCAAATACGCTGGG - Intronic
968265168 3:197357087-197357109 AGGGGGAAACCTAATGAGCAAGG + Intergenic
970109282 4:12619388-12619410 TTTAAGTAATCTAATGAGCCAGG + Intergenic
970314120 4:14813171-14813193 AATAATAATACTAATGAGCATGG + Intergenic
971520231 4:27540772-27540794 ATTAAAAAAATTAATGAGAATGG - Intergenic
972230823 4:37070928-37070950 GTTAAGAAACCAGATGAACAGGG + Intergenic
972836660 4:42878889-42878911 ATTAAGAAAACTTATCAGCAGGG + Intergenic
973057171 4:45675225-45675247 ACTAAGAAACAAAATGATCATGG - Intergenic
974873871 4:67677969-67677991 ATTAAGAAAGTTAAGGAGCCTGG - Intronic
975332074 4:73127724-73127746 ACTAATAAACATAATAAGCAAGG + Intronic
977044025 4:92046702-92046724 ATAAAGAAATATAATGAACATGG - Intergenic
978220830 4:106272316-106272338 ATTAAGAAACGTATGTAGCACGG - Intronic
980631470 4:135440997-135441019 ATTAACAGACCTAATGAGAGAGG + Intergenic
986723814 5:10579717-10579739 TTAAAGAAACCTAGTGAGAAAGG + Intronic
986995215 5:13599901-13599923 CTTATGAAACCAAATTAGCACGG - Intergenic
987257622 5:16172765-16172787 ATTTAGAAAAGTAATGACCATGG + Intronic
987493377 5:18611361-18611383 ATTCAGAATCTTAAAGAGCAAGG + Intergenic
993973527 5:94449002-94449024 AATATGACACCTAATGGGCAGGG + Intronic
994805292 5:104439379-104439401 ATTAAGAAAACCAATAAGGAAGG + Intergenic
994977782 5:106832071-106832093 ATTAAGGAACTTAATGACAAAGG + Intergenic
996296897 5:121929618-121929640 ATCAAGAAACATAATGTGAATGG - Intergenic
996882381 5:128314298-128314320 ATAAATAAACCTAATTAGAAGGG - Intronic
999690778 5:154144157-154144179 AATAAGGAACATAATAAGCATGG + Intronic
1003708102 6:8558000-8558022 ATTAAGAAAATTAATCTGCATGG - Intergenic
1004589576 6:17036322-17036344 ATTAAGAAACTCAATCAGGAGGG - Intergenic
1004905667 6:20235015-20235037 ATTAAGAGACCTTGTGAGAAGGG - Intergenic
1004919035 6:20358899-20358921 AGGAAGAAACCTAGTGGGCAAGG + Intergenic
1004974827 6:20952907-20952929 ATGAAGAATCCTAATGAGAATGG - Intronic
1005526963 6:26660236-26660258 AATCAGAAACATAATCAGCAAGG - Intergenic
1006486516 6:34347270-34347292 ATTAAGTAACATCATGAGCCAGG + Intronic
1009633695 6:66235082-66235104 ACTAAGAAAACTAATGTGCTTGG - Intergenic
1010118483 6:72343604-72343626 ATTAAGAAAAAGAATGAGCCAGG - Intronic
1010662251 6:78584696-78584718 ATTAAGAAACATTATCACCATGG + Intergenic
1011389057 6:86831229-86831251 ATTAAAGAAACTAATAAGCAAGG - Intergenic
1011618784 6:89222583-89222605 ATTAAAAAACCTCAAGATCAAGG - Intronic
1012338899 6:98093807-98093829 ATTGTGAAACCCACTGAGCAAGG + Intergenic
1014305862 6:119741417-119741439 ATTAAGAAAATTAAAGGGCAAGG - Intergenic
1014928021 6:127297922-127297944 ATCAAGAAAACTAAGGAGCATGG - Intronic
1016355085 6:143209829-143209851 AATAAGCAAGCTAATGAACAAGG - Intronic
1017372869 6:153734058-153734080 ATTAAGAATCCTAAAAATCAGGG + Intergenic
1019255985 7:51449-51471 ATTGAGAACCCTAATAAGTATGG + Intergenic
1019263750 7:100050-100072 CTTAAGAAACCAAAGGATCAAGG + Intergenic
1022127404 7:27371783-27371805 ATTGAGTAACCTATTAAGCATGG - Intergenic
1022774721 7:33514362-33514384 ATTAAGAAAGTTAATGAATATGG + Intronic
1022970279 7:35510765-35510787 ACTAAGCTACCTAATGGGCATGG - Intergenic
1024001523 7:45192833-45192855 CTCAAGAAACTTAATGATCATGG + Intergenic
1028015519 7:85706320-85706342 ATCAAAAAATGTAATGAGCAAGG - Intergenic
1030536000 7:110768014-110768036 ATTAACAGACCTCATGGGCAGGG - Intronic
1031049648 7:116932089-116932111 ATTTAGAGACCTCATTAGCAAGG - Intergenic
1034733310 7:153406554-153406576 AGTAAGAAACCGAGTGAGCAAGG - Intergenic
1036720406 8:11169266-11169288 ACTAAGAAAATTAAGGAGCATGG - Intronic
1036950450 8:13134154-13134176 ATTAGGAAGCCTAATGTGAAGGG + Intronic
1037661053 8:20927236-20927258 AAAAAGACACCTAATCAGCAGGG - Intergenic
1038075242 8:24065921-24065943 CTTAAGACACAAAATGAGCATGG - Intergenic
1039217991 8:35294348-35294370 ATTAAGAAAATTATTGAGAAAGG - Intronic
1039627543 8:39069561-39069583 CTTAAAAAACCTTATGAGGAAGG + Intronic
1040606364 8:48936042-48936064 ATTAATATGCCTAATTAGCAGGG - Intergenic
1041100130 8:54388108-54388130 ATTAAGAATCTTAGTGAGGAAGG - Intergenic
1041806318 8:61853696-61853718 GTTAAGAAAAATAATGAACATGG - Intergenic
1042288514 8:67141305-67141327 ATTGCGTGACCTAATGAGCATGG + Intronic
1047136426 8:122083742-122083764 ATTAAGAAACTTAAAAAACAAGG + Intergenic
1051201520 9:14631604-14631626 ATGATGAAACCTAATGAGAAAGG - Intronic
1052465214 9:28821365-28821387 ATTATAAAAACAAATGAGCAAGG + Intergenic
1055338045 9:75252713-75252735 GTAAAGAAATCTAATGAGAAGGG - Intergenic
1055812627 9:80167102-80167124 ATTAAAAATCTTAATGAGGAAGG + Intergenic
1059424116 9:114210214-114210236 AATATGTAACCAAATGAGCAAGG - Intronic
1059724632 9:116994247-116994269 AATATGTAAGCTAATGAGCATGG + Intronic
1060173891 9:121483029-121483051 ATTTCGAAACCTAAAGAGCTAGG + Intergenic
1061525640 9:131159264-131159286 ATTAAGAACCATAATGAACAAGG - Intronic
1187424103 X:19161570-19161592 ATTAAGAATCTTAATGAGGCTGG + Intergenic
1188076016 X:25776037-25776059 TTTAAGAACCTTAATGAGCCAGG + Intergenic
1188196587 X:27241968-27241990 ACTAAGAGACCTAAGGACCAGGG + Intergenic
1189599119 X:42602736-42602758 TTTAAGAAATGTAATGTGCATGG - Intergenic
1192219751 X:69189766-69189788 ATAAAGAAATCTAATGCTCAGGG - Intergenic
1194082342 X:89484637-89484659 ATTAAAAAACATAATGAGAGGGG - Intergenic
1197135531 X:123055358-123055380 ATTTGGAAAACTAATCAGCAGGG - Intergenic
1200435009 Y:3140823-3140845 ATTAAAAAACATAATGAGAGGGG - Intergenic