ID: 1097947014

View in Genome Browser
Species Human (GRCh38)
Location 12:65380291-65380313
Sequence TTGGGGGGTCCTGATATAGT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 77
Summary {0: 1, 1: 0, 2: 1, 3: 3, 4: 72}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1097947007_1097947014 5 Left 1097947007 12:65380263-65380285 CCAACTTGCCAGAACTGGAGTAT 0: 1
1: 0
2: 1
3: 6
4: 101
Right 1097947014 12:65380291-65380313 TTGGGGGGTCCTGATATAGTTGG 0: 1
1: 0
2: 1
3: 3
4: 72
1097947008_1097947014 -3 Left 1097947008 12:65380271-65380293 CCAGAACTGGAGTATTTTTGTTG 0: 1
1: 0
2: 2
3: 16
4: 210
Right 1097947014 12:65380291-65380313 TTGGGGGGTCCTGATATAGTTGG 0: 1
1: 0
2: 1
3: 3
4: 72

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1097947014 Original CRISPR TTGGGGGGTCCTGATATAGT TGG Intronic
900994364 1:6112489-6112511 CTGGGTGGTCCTGATGTGGTCGG - Intronic
902876280 1:19342700-19342722 TTGGTGAGTCCTGTTTTAGTGGG + Intronic
903003765 1:20284773-20284795 TTTGGGGGTACTGAGATAATAGG + Intergenic
906818854 1:48907748-48907770 GAGGGGGCTCATGATATAGTTGG + Intronic
911809471 1:102256605-102256627 TTGTGGGGTGCTAATATAATTGG - Intergenic
913691803 1:121286647-121286669 TTGTGGGATCTTGTTATAGTAGG - Intronic
914145741 1:144993307-144993329 TTGTGGGATCTTGTTATAGTAGG + Intronic
914807382 1:151001614-151001636 TTTGGGGGTTCTGATACAGCAGG - Intronic
916265433 1:162885805-162885827 ATGGGGGTTCTTGATAAAGTAGG + Intergenic
916308628 1:163369142-163369164 TTGGTAGGTCCTGCTATAGCAGG + Intergenic
919728969 1:200900924-200900946 TTAGGGGGTCCTGAGAGAGGGGG - Exonic
919779036 1:201211005-201211027 TTGGGGGCTCCTGAGAGAATAGG + Exonic
1066447454 10:35496587-35496609 TTGGGGGGTGCTGAGACAGGAGG + Intronic
1067937238 10:50623174-50623196 TGGGGGGATCCCGAAATAGTGGG + Intronic
1075305481 10:121364003-121364025 TGTGGGGGGCCTGATATGGTTGG + Intergenic
1079487058 11:20946110-20946132 ATGGGTATTCCTGATATAGTGGG + Intronic
1079729681 11:23924145-23924167 TTGGGGGGTTGTGATAAAATCGG + Intergenic
1080305894 11:30835439-30835461 TTGGGGGGTGCTGATATAAATGG - Intronic
1083238852 11:61370938-61370960 TTTGGGGGTCCTGAGATGTTTGG - Intergenic
1086112659 11:83216865-83216887 TTGGGGTGTCCTGTTTTAGAGGG - Intronic
1097947014 12:65380291-65380313 TTGGGGGGTCCTGATATAGTTGG + Intronic
1102449332 12:113029155-113029177 TTTGGGGGTCCTGAGATAACAGG + Intergenic
1104311909 12:127660890-127660912 TTGGGGTGGCCTGAGAGAGTGGG + Intergenic
1114696895 14:24633974-24633996 TTGGGGGGTCTTGGTAGAATGGG + Intronic
1118425396 14:65655071-65655093 TTGGGGGGACAGCATATAGTTGG - Intronic
1120308344 14:82798940-82798962 TTGGTGCTTCCTGATATAGAAGG - Intergenic
1127600493 15:60530987-60531009 TTGGGGGGTCTTGAATTATTGGG + Intronic
1130397284 15:83513675-83513697 ATGGAGGGTCATGATTTAGTGGG - Intronic
1149973328 17:61241120-61241142 TTGGGGGACCCTCATATAGTGGG + Intronic
1152021293 17:77781471-77781493 TTGGGGGGGCCTGCTGGAGTGGG - Intergenic
1152242587 17:79168069-79168091 TTACGGGGTCCTGAAACAGTGGG + Intronic
1152863199 17:82708019-82708041 TTGGGGGGCCCTGCTGTGGTAGG + Intergenic
1156030588 18:32707916-32707938 TTGAGGATTCCTGATACAGTAGG + Intronic
1167058932 19:47131262-47131284 TTGGGGAGTCCTGAGAGAGCGGG + Intronic
1167418380 19:49389166-49389188 TTTGGGGGTCTTGATTTATTCGG - Intronic
940130478 2:150375776-150375798 CTGGGGGATTCTGATATATTTGG - Intergenic
942944080 2:181654619-181654641 TTGGGAGGACATGATATGGTAGG - Intronic
946229054 2:218280392-218280414 CTGGGGGGTCACGATGTAGTGGG + Intronic
1174032851 20:47644673-47644695 TTGGGGAGTCCTGAAATAAAAGG - Intronic
1174718563 20:52786317-52786339 GTGGGTGGTGGTGATATAGTAGG + Intergenic
1180010385 21:45046074-45046096 TTGCTGTGTCCTGACATAGTGGG + Intergenic
1182125373 22:27811832-27811854 TTGGGTGCTCCTGATGGAGTGGG - Intergenic
1182519813 22:30878933-30878955 TTGGGGGCACCAGATAGAGTGGG + Intronic
1183191337 22:36323738-36323760 TTGGGGGGTCCTGGCCTAGGAGG - Intronic
949564248 3:5230371-5230393 TTGGGGACCCCTGATCTAGTGGG - Intergenic
950972213 3:17200613-17200635 TTGGGGACTGCTGCTATAGTTGG + Intronic
958884363 3:99709189-99709211 TTGGGGAACACTGATATAGTGGG - Intronic
959274458 3:104260536-104260558 TTAGTGGGTATTGATATAGTTGG + Intergenic
968599097 4:1500788-1500810 TCGGGGGGTCCTGAGGGAGTCGG - Intergenic
969877732 4:10148405-10148427 TTGAGGAGTCCTGATCTAGCTGG - Intergenic
970038631 4:11770604-11770626 TTGGGGACTCCTGATCTAGAAGG - Intergenic
974615289 4:64272043-64272065 TTGGGGAATCCTGATGAAGTTGG - Intergenic
975748789 4:77501229-77501251 TTGGGGGGTCCTGTGATAACTGG + Intergenic
983811226 4:172065091-172065113 TTGGGGACTGCTGATATAGTGGG - Intronic
994943249 5:106352071-106352093 TTGGGGGGTGCTAATATAAATGG + Intergenic
999673201 5:153975279-153975301 GTGGGGGCTCCAGATATGGTGGG - Intergenic
1013655547 6:112243067-112243089 CTGGAGGGTCCAGATAGAGTAGG + Intronic
1016462812 6:144296115-144296137 TTGGGGAGCCCTGTTCTAGTGGG - Intronic
1018422687 6:163652994-163653016 TTTGGGAGTCCTGAGATAGCAGG - Intergenic
1018729339 6:166637119-166637141 TTGGGGAGTGCTGATATGCTAGG + Intronic
1020796456 7:12683594-12683616 TTGGGGGGGTCTGAAATAGGAGG + Intergenic
1021519360 7:21523735-21523757 TTGTGGGGTCCTGAAATTGCTGG + Intergenic
1021688727 7:23212105-23212127 TTGGGGGGTCCTCAGTTAGGGGG - Intergenic
1026705247 7:72685411-72685433 TTCAGGGGATCTGATATAGTTGG - Intronic
1027684263 7:81262770-81262792 TTGGGGGGTTCTAATATAAGAGG + Intergenic
1034007624 7:147491305-147491327 GTGGGGGGTCGTGGTATAGGAGG - Intronic
1039715765 8:40107066-40107088 TTGGGGGGGCTTGAGATTGTTGG - Intergenic
1039857759 8:41431125-41431147 TTGGGGAGACCTGATGTAATTGG + Intergenic
1042398451 8:68317768-68317790 TTGGGGGCCCCTGCTTTAGTTGG + Intronic
1044558426 8:93589411-93589433 TCGGAGAGTCCTGAGATAGTGGG - Intergenic
1057012689 9:91619784-91619806 TTGGGGATTCCTGACACAGTTGG - Intronic
1059277669 9:113109412-113109434 ATGGGGGGTCCTGCTGTGGTGGG + Intergenic
1059278582 9:113115139-113115161 ATGGGGGGTCCTGCTGTGGTGGG - Intergenic
1187066198 X:15840698-15840720 GTGGGGGGTGGTGATGTAGTTGG - Intronic
1187632940 X:21195149-21195171 TTGTGGGGTCCTGTGATCGTGGG - Intergenic
1193624153 X:83795409-83795431 TTGGGGGGTCTTGGTATAGTGGG - Intergenic
1193699003 X:84741035-84741057 TTGGTGGGTCCTGAAAAATTAGG - Intergenic