ID: 1097951155

View in Genome Browser
Species Human (GRCh38)
Location 12:65429464-65429486
Sequence ATGTGTTTGGAGAGGTAGGC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 568
Summary {0: 1, 1: 2, 2: 14, 3: 60, 4: 491}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1097951148_1097951155 15 Left 1097951148 12:65429426-65429448 CCAGTGTGGTTGAAGCACAAGGG 0: 1
1: 0
2: 1
3: 19
4: 188
Right 1097951155 12:65429464-65429486 ATGTGTTTGGAGAGGTAGGCAGG 0: 1
1: 2
2: 14
3: 60
4: 491
1097951146_1097951155 26 Left 1097951146 12:65429415-65429437 CCAAGAGAAGACCAGTGTGGTTG 0: 1
1: 1
2: 2
3: 22
4: 224
Right 1097951155 12:65429464-65429486 ATGTGTTTGGAGAGGTAGGCAGG 0: 1
1: 2
2: 14
3: 60
4: 491

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1097951155 Original CRISPR ATGTGTTTGGAGAGGTAGGC AGG Intronic
900298778 1:1966190-1966212 ATGAGTGTGGAGAGGGAGGCGGG + Intronic
900536881 1:3183080-3183102 ATGACTTTGGAGATGCAGGCTGG - Intronic
900575173 1:3379339-3379361 GTGTGTTGGGAGAGGTGTGCTGG - Intronic
901126769 1:6934763-6934785 GTATGGTTGGAGAGGAAGGCAGG + Intronic
901761023 1:11471717-11471739 CTGTGCTTGGAGAGCTGGGCTGG - Intergenic
902813236 1:18901508-18901530 CTAGGTTTGGAGAGGTAGGTGGG - Intronic
903314150 1:22487877-22487899 ATGAATCTGGAGAGGCAGGCAGG - Intronic
904022161 1:27475308-27475330 ATGTGATTGGAGAGATGGGTAGG - Intronic
904056811 1:27676235-27676257 ATGTGTTGGGTGAGGTATGGGGG + Intergenic
904066833 1:27758903-27758925 ATGAGGTTGGAGAGATGGGCAGG - Intronic
904177979 1:28644779-28644801 ATGAGTTTGGAGAGGTAGGCAGG + Intergenic
904263714 1:29305747-29305769 ATGAGGCTGAAGAGGTAGGCAGG + Intronic
904805070 1:33125393-33125415 ATGAGGTGGGAGAGGTGGGCAGG - Intergenic
905183951 1:36182928-36182950 ATGGGGTTGGAGAGGTGGGCAGG + Intergenic
905712638 1:40119557-40119579 ATGAGTTTGGAGAGATAGGTAGG - Intergenic
907777886 1:57536719-57536741 AGGAGTTTGGAGAGGAAGACAGG - Intronic
908251796 1:62271683-62271705 AGGTGTGTGGAGAGGTAAGGAGG + Intronic
909187478 1:72506593-72506615 TTGAGATTGGAGAGGTAGGAAGG + Intergenic
910227940 1:84955521-84955543 AGGGGTCTGGAGAGGCAGGCAGG + Intronic
911482055 1:98456010-98456032 ATGTCTTGGGAGAGGTAGTGAGG - Intergenic
911568285 1:99491139-99491161 GTGTGTTGGGAGAGGAAGGAGGG - Intergenic
912424068 1:109570759-109570781 ATGAGGGTGAAGAGGTAGGCAGG + Intronic
912921793 1:113875439-113875461 ATGTGCTTGGATAGGTTGGGTGG - Intergenic
913060241 1:115197822-115197844 ATGAGGTTGGAGAGGTGGGTAGG - Intergenic
913159348 1:116131406-116131428 ATGAGTCTGGAAAGGAAGGCAGG + Intronic
913384213 1:118241888-118241910 TTGTGTTTGGAGTGGAAGGTGGG - Intergenic
914433210 1:147638593-147638615 ATGAGGCTGGAGAGGTGGGCAGG + Intronic
915079988 1:153345509-153345531 ATGGGTATGTAGAGGTGGGCAGG - Intronic
915452888 1:156019080-156019102 ATTTTTTTGGAGAAGCAGGCAGG - Intronic
915704309 1:157829157-157829179 ATGAGGTTGGAGGAGTAGGCAGG + Intergenic
915899064 1:159833470-159833492 ATGAGGTGGGAGAGGTAGGAAGG - Intronic
916667694 1:166981483-166981505 ATGTGTGTAGAGAGGGAGGGAGG + Intronic
916764794 1:167849952-167849974 ACGTGTTTGGAGAGCTAGTTTGG + Intronic
917277969 1:173351120-173351142 GTGAGGCTGGAGAGGTAGGCAGG - Intergenic
917695718 1:177521171-177521193 ATGAGTTCGAAGAGTTAGGCAGG - Intergenic
918011429 1:180590555-180590577 AAGTGAATAGAGAGGTAGGCAGG + Intergenic
918101315 1:181377439-181377461 ATGTGTTTAGAGATGAATGCTGG + Intergenic
918181452 1:182088448-182088470 ATGTGGGTGCAGAGGTGGGCAGG - Intergenic
918405228 1:184205701-184205723 ATGAATCTGGAAAGGTAGGCGGG + Intergenic
919197332 1:194303191-194303213 ATGTGGTTGGAGAGATAGACAGG - Intergenic
919481779 1:198098985-198099007 ATGAGTTTGGAGAGGTAGGATGG + Intergenic
920030855 1:203036589-203036611 ATGAGCTTGGGGGGGTAGGCTGG + Intronic
920171034 1:204072759-204072781 ATCTGTTTGGAGGGGTTGGGAGG + Intergenic
920242630 1:204564390-204564412 AAGAGTTTGCAGATGTAGGCAGG + Intergenic
920656716 1:207881987-207882009 ATGAGACTGGAGAGTTAGGCAGG - Intergenic
920979782 1:210822325-210822347 ATGAGGATGGAGAGGCAGGCAGG + Intronic
922399009 1:225232528-225232550 ATGAATCTGGAAAGGTAGGCAGG - Intronic
922656897 1:227392958-227392980 ATGTTTTTGGAGAGATGGGGTGG - Intergenic
923073527 1:230588589-230588611 AGGTGTGTGGATAAGTAGGCAGG + Intergenic
923284121 1:232475196-232475218 ATGAGGTCGGAGAGGTAGGAAGG - Intronic
924700301 1:246444564-246444586 TTGTGAATGGAGAGGTAGGAAGG + Intronic
924743918 1:246815109-246815131 ATGAAGTTGGAGAGGTAGGTGGG + Intergenic
1063667654 10:8073868-8073890 ATGTGTCTGGAGAGGGCGGCCGG - Exonic
1064409293 10:15091477-15091499 ATGTGGTTGAAGAGGTCAGCAGG - Intergenic
1065411622 10:25435573-25435595 GTGAGTTTGGAGAGGTCGTCAGG + Intronic
1065967926 10:30784010-30784032 AGGGGCTTGGAGAGGGAGGCTGG + Intergenic
1066650560 10:37651207-37651229 TGGTGGTTGGAGAGGGAGGCAGG + Intergenic
1067918819 10:50431411-50431433 ATGTGTTTTGAGAACTAGGTGGG + Intronic
1068701243 10:60022471-60022493 ATGTGGTTATACAGGTAGGCAGG + Intergenic
1068813531 10:61283723-61283745 AGGAATTTGGAGAGGCAGGCAGG - Intergenic
1068976258 10:63013377-63013399 ATGAGGTTGGAGAGCTAGGCTGG + Intergenic
1069891143 10:71653143-71653165 ATGTGGCAGGAGAGGGAGGCTGG - Intronic
1070080389 10:73180374-73180396 ATGAGATTAGAGAGGTAGGTGGG + Intronic
1070276584 10:75013060-75013082 ATGTCTTTGGGGAAGGAGGCTGG - Intronic
1070623998 10:78035993-78036015 ATGTGTTTGGAAAGGTAGCCTGG + Intronic
1070721946 10:78763046-78763068 ATGGGGTTGGTGAGGCAGGCTGG - Intergenic
1072219112 10:93312804-93312826 ATGTGTTTGGAGTTGGAGGAAGG - Intronic
1072551316 10:96479732-96479754 ATGTGTCTGGAGAAGTTAGCTGG - Intronic
1073938246 10:108661085-108661107 ATCTGTTGGGACATGTAGGCTGG + Intergenic
1074925910 10:118070479-118070501 ATGTGGCTGGAGAGATAGGTGGG + Intergenic
1076035887 10:127197657-127197679 ATGTGTCTGGAGAGGTGGGTGGG - Intronic
1077513091 11:2981900-2981922 ATGAGTGTGGGGAGGTAGACAGG - Intronic
1077892360 11:6428571-6428593 ATGAGACTGGAGAGGGAGGCAGG - Intergenic
1078411355 11:11122466-11122488 ATGGGTTTGGAGTGGTGGGGAGG - Intergenic
1079489128 11:20967882-20967904 ATGAATTTGGAGAAGTAGGCAGG - Intronic
1079741278 11:24064554-24064576 ATTTGATTGGAGAGGTAAGACGG - Intergenic
1080171684 11:29311134-29311156 ATGGGTTCAGAGAGGTAGACAGG + Intergenic
1080580374 11:33637471-33637493 ATGGGGCTGGAGAGGAAGGCAGG - Intronic
1080756663 11:35206778-35206800 ATGTGTTTGAATGGCTAGGCAGG + Intronic
1080787658 11:35490312-35490334 ATGGGGTTGGAGTGGTAGGCAGG - Intronic
1081003304 11:37701990-37702012 ATGAGTGTAGTGAGGTAGGCAGG - Intergenic
1081004015 11:37711159-37711181 ATGTGTGTGCAGGGGTAGGGTGG - Intergenic
1081263940 11:40995835-40995857 ATGAATTTGGAGATATAGGCTGG - Intronic
1081267851 11:41048981-41049003 ATGAGTTTGAAGAGTTAGGCAGG + Intronic
1081382059 11:42428874-42428896 ATGAGTTTGGAGAGATAGTTAGG + Intergenic
1082059310 11:47847070-47847092 CTGAGGCTGGAGAGGTAGGCAGG - Intronic
1082130862 11:48487794-48487816 ATGGATTTGGGGAGGTAGCCTGG + Intergenic
1082245924 11:49922281-49922303 ATGGATTTGGGGAGGTAGCCTGG - Intergenic
1082564361 11:54658667-54658689 ATGGATTTGGGGAGGTAGCCTGG + Intergenic
1082677710 11:56128481-56128503 GTGTGTTTGGAGAGTTGGGTGGG + Intergenic
1082804519 11:57439171-57439193 TTTTGTTTTGAGAGGTAGTCTGG + Intergenic
1083364195 11:62131438-62131460 AGGTGTCTGGAGGGGCAGGCTGG + Intronic
1083377127 11:62233136-62233158 ATCTATTTGGAGAGGCAGACAGG - Intergenic
1084415230 11:69028345-69028367 CTGAGTTTGGAGAGGAAAGCAGG - Intergenic
1084425475 11:69081703-69081725 CTGGGTTGGGAGAGGAAGGCGGG + Intronic
1084650575 11:70486973-70486995 AGGTCTGTGGAGAGGAAGGCCGG + Intronic
1085056866 11:73409688-73409710 AGGCATTTGGAGAGGTAGGTGGG + Intronic
1085361315 11:75890112-75890134 ATGGGGCTGGAGAGCTAGGCAGG + Intronic
1085567551 11:77528115-77528137 ATGTGTTTGTGGGGATAGGCTGG - Intronic
1086044189 11:82513313-82513335 GTGAGGCTGGAGAGGTAGGCGGG + Intergenic
1087666245 11:101052516-101052538 ATGTGTTTAGAGATGTAGGCTGG + Intronic
1087886117 11:103484700-103484722 AAGTGTTTTGGGAGGGAGGCAGG - Intergenic
1088109325 11:106244232-106244254 AAATGTTTGGAAAGGTAGGCAGG + Intergenic
1088616478 11:111634765-111634787 ATGTGATTGGAAAGGAAGACGGG - Intronic
1089789393 11:120931854-120931876 ATGAGGCTGGAGAGGCAGGCAGG - Intronic
1090086905 11:123658170-123658192 ATGAGTGTGGAGAGATAGCCAGG - Intergenic
1092200413 12:6578755-6578777 ATGAGTATGGACAGGGAGGCAGG + Intronic
1093385765 12:18551428-18551450 ATGTGGGAGGGGAGGTAGGCAGG - Intronic
1093549510 12:20390831-20390853 CTGTGTTTGTAGTGATAGGCTGG - Intronic
1094051054 12:26221088-26221110 ATGTGTTTGCAGCAATAGGCAGG - Intronic
1095279411 12:40332821-40332843 ATGTGTTTGGGGAGCTATGGTGG + Intronic
1095336605 12:41035823-41035845 ATGAGGTTGGAGAGGTAAGAGGG + Intronic
1096054488 12:48640145-48640167 ATAAGGCTGGAGAGGTAGGCTGG + Intergenic
1096129274 12:49144653-49144675 ATGAGATTGGAGAGGTAGCCAGG + Intergenic
1096862570 12:54540391-54540413 ATGTGTTTGGTGAGGCAAGAGGG + Intronic
1097131322 12:56812658-56812680 GTGTGTGTGGATAGGTAGGTAGG - Intergenic
1097228344 12:57492906-57492928 ATGAGTTTTGAGAGGCAGGTGGG + Intronic
1097951155 12:65429464-65429486 ATGTGTTTGGAGAGGTAGGCAGG + Intronic
1098073423 12:66700324-66700346 ATGAGGCTGGGGAGGTAGGCAGG + Intronic
1098891490 12:76014046-76014068 ATGAGTTTGGAGCCATAGGCCGG - Intergenic
1099920221 12:88948263-88948285 ATGTGTTTGGAAAAGAAGGAAGG + Intergenic
1099938899 12:89161395-89161417 ATCACTTTGTAGAGGTAGGCTGG - Intergenic
1100003945 12:89871534-89871556 ATGAGTTTGAAGAGTCAGGCAGG + Intergenic
1100056632 12:90519578-90519600 ATGTATGTGGAGAGGGAGGATGG - Intergenic
1100398152 12:94202810-94202832 ATGAGTTTGAAGAGGAAGGCAGG + Intronic
1100878647 12:98992113-98992135 ATAAGTTTAGAGAGGTGGGCAGG - Intronic
1101291718 12:103377399-103377421 CTGTCATTGGAAAGGTAGGCTGG - Intronic
1101545686 12:105710284-105710306 ATGAAGTTGGAGAAGTAGGCAGG - Intergenic
1101647338 12:106643373-106643395 ATGAGGTGGGAGAGGCAGGCAGG + Intronic
1101840722 12:108325742-108325764 GTGTGTTTAGAGAGGCAGGATGG - Intronic
1102310440 12:111840900-111840922 ATGAGGTTGGAGATGTGGGCAGG - Intergenic
1103175238 12:118857795-118857817 GTGTGGTTGAAGAGGTAGCCTGG + Intergenic
1103381209 12:120495814-120495836 AGCTGTCTGGAGAGGTAGGAAGG - Intronic
1103397563 12:120619693-120619715 ATGAGGTCAGAGAGGTAGGCAGG - Intergenic
1104182881 12:126399440-126399462 ATGTGGCTGGAAAGGTGGGCAGG - Intergenic
1104211075 12:126688925-126688947 ATGAGGATGGAGAGGTGGGCAGG + Intergenic
1104449785 12:128859622-128859644 ATGTGGCTGGAGAGGGAGACAGG + Intronic
1105974318 13:25459825-25459847 ATGTCACTGGGGAGGTAGGCTGG + Intronic
1106337321 13:28796009-28796031 AGGTGTGTGGCGAGGTACGCCGG + Intergenic
1106651476 13:31694930-31694952 AATTGGTTGGAAAGGTAGGCTGG - Intergenic
1106847846 13:33755942-33755964 ATGTGGTTAGGGAGGCAGGCAGG - Intergenic
1106989251 13:35397154-35397176 ATGTGTTCTAAAAGGTAGGCAGG - Intronic
1107111216 13:36700080-36700102 ATGAGTCTAGAGAGGTGGGCAGG + Intergenic
1107115978 13:36745808-36745830 ATGTTGTTGGAGAGGAGGGCTGG - Intergenic
1108215252 13:48177435-48177457 ATGAGCCTGGAAAGGTAGGCAGG + Intergenic
1108536934 13:51392453-51392475 CTAGGTTTAGAGAGGTAGGCAGG - Intronic
1108592300 13:51922810-51922832 ATGCGATTGGAGATGGAGGCAGG - Intergenic
1109339070 13:61031044-61031066 ATGGGTTCTGAGAGGTAGGTGGG - Intergenic
1109464843 13:62716819-62716841 AGGTGATAGGAGAGGTAGGAGGG - Intergenic
1112101171 13:96190929-96190951 ATGGGATTGGAGAGGTGGCCAGG + Intronic
1112606309 13:100910147-100910169 ATGAAGCTGGAGAGGTAGGCAGG + Intergenic
1112759453 13:102677490-102677512 ATAAGTCTGGAGAGGTAGGCAGG - Intronic
1113295715 13:108956547-108956569 ATGAGATTGGAGAAGTAGCCAGG - Intronic
1114066736 14:19066334-19066356 CTGTGTTTGAACAGGTAGGTTGG + Intergenic
1114095530 14:19333693-19333715 CTGTGTTTGAACAGGTAGGTTGG - Intergenic
1115616830 14:35103222-35103244 ATGAAGTTGGAGAAGTAGGCAGG - Intronic
1115756245 14:36528217-36528239 ATTAGTTTGGAGAGATAGGTTGG - Intergenic
1116446042 14:45013033-45013055 ATGAGGCTGGAGAGGTAGGCTGG - Intronic
1116783655 14:49265227-49265249 ATGAGATTAAAGAGGTAGGCAGG + Intergenic
1116953630 14:50900793-50900815 ATGAGGCTGGAGAGGGAGGCAGG + Intronic
1117200193 14:53382410-53382432 GGGTGTTTGGAGAGGCAGGCAGG - Intergenic
1117939930 14:60952224-60952246 ATATGTTTGGAAAGGTGGGTTGG + Intronic
1118130796 14:62961217-62961239 GTGAGTCTGAAGAGGTAGGCAGG - Intronic
1118824383 14:69367155-69367177 CTGAGTTTTGACAGGTAGGCAGG + Intergenic
1119663489 14:76467582-76467604 TTGTGTTTGGGGAGGCAGACTGG + Intronic
1119765575 14:77185512-77185534 AGGTCTTTGGAGAGATAGGTGGG + Intronic
1120311411 14:82832547-82832569 ATGTAGTTGGAAAGGTAGCCAGG - Intergenic
1121124864 14:91399465-91399487 AGGTGTTGGGAGGGGTTGGCAGG - Intronic
1121158182 14:91707131-91707153 ATGAGTTTGGAGAAGCTGGCAGG - Intronic
1122491453 14:102118792-102118814 ATGTATGGGGAGGGGTAGGCAGG - Intronic
1124100379 15:26687504-26687526 AGGGGATGGGAGAGGTAGGCAGG - Intronic
1124452711 15:29811153-29811175 ATGTGGCTAGAGGGGTAGGCAGG + Intronic
1124993199 15:34696199-34696221 ATGTGGTTGGATGGGTAGTCTGG + Intergenic
1125118423 15:36122922-36122944 ATGTCTTTGGTGAGGTCTGCAGG + Intergenic
1125144438 15:36450578-36450600 ATGTGATTAAAGAGGTGGGCAGG - Intergenic
1125790476 15:42361740-42361762 ATGGGCCTGGACAGGTAGGCAGG - Intronic
1126507267 15:49419667-49419689 AAGAGGTTGGAGAGGCAGGCAGG - Intronic
1127324725 15:57883956-57883978 ATGTGTGGGGAGTGGGAGGCAGG - Intergenic
1128549916 15:68591411-68591433 ATGTGGCTGGACAGGCAGGCAGG + Intronic
1128838123 15:70827850-70827872 ATGTGTATGGAGCGGGAGGGAGG + Intergenic
1130536147 15:84786389-84786411 ATGAGTTTGGAGGAGTAGGAGGG + Intronic
1130709109 15:86261946-86261968 ATGAGATTTGAGAAGTAGGCGGG - Intronic
1131302411 15:91211062-91211084 ATGAAGTTGGAGAGGTGGGCAGG + Intronic
1131372450 15:91894219-91894241 ATGAGGTTGGAGAGGAGGGCAGG + Intronic
1131788443 15:95938063-95938085 ATGCGTTTGAATAGGTAGGCTGG - Intergenic
1131941545 15:97572017-97572039 TTGTTTTTGGAAAGGGAGGCAGG + Intergenic
1133467942 16:6045988-6046010 AGTTGTGTGGAGAGGTAGGAAGG + Intronic
1133563529 16:6971427-6971449 ATGGGTTTGGAGGGGTTGGCAGG + Intronic
1134017491 16:10899224-10899246 GTGGGTTTGGAGAGGGAGGAAGG - Intronic
1134323085 16:13181504-13181526 ATGTGTCTGGAGAAGTTGGTAGG + Intronic
1134375639 16:13670285-13670307 ATGAGGCTTGAGAGGTAGGCAGG - Intergenic
1134543877 16:15092860-15092882 ATGAGGTGAGAGAGGTAGGCAGG - Intronic
1134620545 16:15685795-15685817 ACGTGTTTGGAGAGGAACCCAGG - Intronic
1135265665 16:21023655-21023677 ATGAGATTGCAGAGGCAGGCGGG + Intronic
1135361455 16:21819007-21819029 ATGAGGTGAGAGAGGTAGGCGGG - Intergenic
1135608173 16:23840744-23840766 ATGGGTTGGGAGAGGAAGGATGG + Intronic
1136246183 16:28977576-28977598 ATGAGTGTGGAGAGGTAGGCAGG + Intronic
1136261077 16:29076388-29076410 ATGAGGTGAGAGAGGTAGGCAGG + Intergenic
1137486417 16:48895177-48895199 ATGAATCTGGAGAGGCAGGCAGG + Intergenic
1137737439 16:50735445-50735467 ATGGGTTTGCAGAGGTAGGTAGG + Intergenic
1137790985 16:51174568-51174590 ATGAGTTTGGAGAGGGAGGCTGG - Intergenic
1137961300 16:52884600-52884622 ATGTGGCTGGAGAAGTAGGTGGG + Intergenic
1139242803 16:65411680-65411702 TTATGTTTGGATATGTAGGCGGG - Intergenic
1139709578 16:68765494-68765516 ATTTTTTTGGAAAGGTAGGGGGG + Intronic
1140507181 16:75481085-75481107 ATGTTTTTGTAGAGACAGGCAGG - Intronic
1141134125 16:81454856-81454878 ATCTGGATGGAGAGGTAGGATGG + Intronic
1141279574 16:82618842-82618864 ATGAATTTGGAGAGGGAGACAGG + Intergenic
1144262997 17:13541502-13541524 ATGTGTTTGGGAAGGTGGACAGG - Intronic
1145769226 17:27480268-27480290 ATGTGTTAGGTGGGGGAGGCAGG - Intronic
1146272160 17:31491626-31491648 ATGTGATTGGAGAGCAAGCCAGG + Intronic
1146428014 17:32762305-32762327 ATGAGGTGGGAGAGGTGGGCTGG + Intronic
1148768377 17:50052738-50052760 ATGTGTTGGGAGAGCCAGGAAGG + Intergenic
1149356291 17:55843398-55843420 ATGAGTCTGGAGAGGTAGATGGG - Intergenic
1150543544 17:66129287-66129309 AAGTATTTGGAGAGGTAGAGAGG - Intronic
1150564747 17:66328870-66328892 AAGAGGCTGGAGAGGTAGGCAGG + Intronic
1150729170 17:67677025-67677047 TTGTGTTTTGTGAGGCAGGCAGG + Intronic
1151569329 17:74918249-74918271 ATGGGTGTGGGGAGGCAGGCTGG - Intronic
1151903979 17:77035789-77035811 ATGGGAGTGGAAAGGTAGGCAGG + Intergenic
1152991690 18:369163-369185 ATGTGCATTGAGTGGTAGGCTGG - Intronic
1153673001 18:7430249-7430271 ATGCATTTGAAGAGGTTGGCAGG + Intergenic
1154043863 18:10885665-10885687 AAGTGTTTGGAGAGGTATTGGGG + Intronic
1154392584 18:13953100-13953122 ATGTGTTTGTACAGGTATGAGGG + Intergenic
1155349143 18:24889344-24889366 ATGAGGTTGGAGAGATAGGTAGG + Intergenic
1155420972 18:25655493-25655515 AGGGTTCTGGAGAGGTAGGCAGG - Intergenic
1156036483 18:32771639-32771661 ACGCGTTTGGAGAGGGAGCCGGG + Intronic
1157095477 18:44682279-44682301 AGGTATTTGGAGAGGAAGGGCGG + Intronic
1157400037 18:47379566-47379588 ATGAGGTTGGACAGATAGGCAGG - Intergenic
1157542168 18:48518790-48518812 AGGAGTTGGGAGGGGTAGGCAGG + Intergenic
1158710465 18:59832580-59832602 AGGTGGCTGGAGAAGTAGGCAGG + Intergenic
1158973487 18:62689660-62689682 ATTTGTTTGGGAAAGTAGGCAGG + Intergenic
1160121120 18:76131183-76131205 ATGAGGCTGGAGAGGCAGGCAGG - Intergenic
1160730357 19:639236-639258 GTGTGTTTGGGCAGGTAGGTGGG - Intergenic
1160872044 19:1282122-1282144 ATGTGAATGGAGAGGAAGGATGG + Intergenic
1161228542 19:3160266-3160288 ATGAGATGGGAGAGGGAGGCAGG - Intronic
1162131497 19:8528857-8528879 ATGAGTTTGTACAGGAAGGCAGG + Intronic
1162232711 19:9281079-9281101 ATGATGTTGGAGAGGTGGGCAGG + Intergenic
1165216450 19:34277192-34277214 ATGAGGCTGGAGAGGTGGGCAGG + Intronic
1165334316 19:35158363-35158385 TTGGGGTTGGAGAGGTGGGCTGG - Exonic
925734963 2:6955913-6955935 GTGTGGTTGGAGAGGTGGACAGG - Intronic
925775339 2:7329920-7329942 ATGTTTTAGGATAGGTAGGGTGG + Intergenic
926367163 2:12144000-12144022 ATGTGGCTGGAGAAGAAGGCAGG + Intergenic
926540990 2:14181654-14181676 ATATGTTTGGAAAGGAAGGAAGG - Intergenic
927426067 2:22982600-22982622 ATGAGGTTGGAGAGGAAGGTAGG - Intergenic
928286690 2:29996180-29996202 ATGTGATTTGAGAGGCAGTCTGG - Intergenic
928637391 2:33261705-33261727 ATGGTTTTGGAAGGGTAGGCTGG + Intronic
928682602 2:33717668-33717690 ATGGGACTGGAGAGTTAGGCAGG + Intergenic
929622021 2:43364828-43364850 ATGAGGTTGGAGAGGTAGGCTGG + Intronic
929978306 2:46655845-46655867 ATTTTTTTGTAGAGGCAGGCTGG - Intergenic
930417779 2:51110795-51110817 ATGAGATTGGAGAATTAGGCAGG - Intergenic
930486944 2:52022613-52022635 ATGAGGTTAGAGAGGTTGGCAGG - Intergenic
930602784 2:53460974-53460996 ATGTGTTCAGTGAGGTTGGCTGG - Intergenic
930847262 2:55919214-55919236 ATGAGGTTACAGAGGTAGGCAGG + Intronic
931618060 2:64181630-64181652 GTGTGTATGGAGCGGGAGGCAGG + Intergenic
932372860 2:71207394-71207416 ATGAGGTTGGAGAGGCAGGTGGG + Intronic
934844671 2:97655193-97655215 GTGGGTCTGGAGAGGAAGGCAGG - Intergenic
934902444 2:98171541-98171563 ATGAGTCTGGAGAGGGAAGCAGG + Intronic
936053935 2:109246601-109246623 CTGTGTGTGGAAAGGAAGGCTGG - Intronic
936466199 2:112753440-112753462 ACGAGGTTGGAGAGGTAGGCAGG - Intronic
937145329 2:119639301-119639323 ATGTGGCTGGAGAGCCAGGCAGG - Intronic
937519433 2:122693613-122693635 ATGTTTTTGAAGAGCTAGTCGGG - Intergenic
938378457 2:130823578-130823600 ATCTGTGTGGGGAGCTAGGCCGG + Intergenic
938484133 2:131686428-131686450 CTGTGTTTGAACAGGTAGGTTGG + Intergenic
939190418 2:138911283-138911305 ATAAGACTGGAGAGGTAGGCAGG + Intergenic
939814641 2:146878734-146878756 ACCTGTTTGGAAAGCTAGGCTGG + Intergenic
941079194 2:161040714-161040736 GTGTGTTTGGAGGGGTAGGGGGG + Intergenic
941502335 2:166295239-166295261 TTGTGATGGCAGAGGTAGGCAGG + Intronic
941582064 2:167310633-167310655 GTGTGGTTGGGGAGGTAGCCAGG + Intergenic
941982298 2:171472069-171472091 ATGATACTGGAGAGGTAGGCTGG - Intronic
944192144 2:197014895-197014917 CTGTGTGTGGAGAGGTGGGGTGG - Intronic
944824541 2:203468284-203468306 TGGGGTTTGGGGAGGTAGGCAGG - Intronic
944957916 2:204833903-204833925 ATGAATTTGGAGAGGTAGGTGGG - Intronic
945181226 2:207093340-207093362 ATGATATTGGAGAGGTAGCCAGG - Intronic
945650621 2:212554398-212554420 ATGAATCTGGAGAGGTAGGATGG + Intergenic
946660487 2:221993840-221993862 ATGTGGCTGGAAAGGTAGGTAGG + Intergenic
946678694 2:222190343-222190365 ATGGGCTTGGAAAGGTAGCCAGG - Intergenic
947372791 2:229465721-229465743 ATTAGGTTGGAGAGGTAGCCAGG + Intronic
947905316 2:233757128-233757150 ATGAGCTTGGACAGGTGGGCTGG + Intronic
947956269 2:234194952-234194974 AGGAGTCTGGAGAGGTACGCAGG + Intergenic
948440615 2:237984960-237984982 ATTTGTTTGAAGAGGTTGGGAGG + Intronic
949027099 2:241771492-241771514 ACGTGTGTGGGGAGGAAGGCGGG + Intergenic
1168786747 20:545867-545889 ATATGGTGGGAGAGGTGGGCAGG + Intergenic
1168787978 20:556342-556364 ATGAGATGGGAGAGGTTGGCAGG + Intergenic
1169595858 20:7197414-7197436 ATGAGATTGGAGAGGTAGGGTGG + Intergenic
1170225278 20:13985256-13985278 ATGAGGCTGGAGTGGTAGGCAGG - Intronic
1170407902 20:16058848-16058870 ATGAGTTTGTAGAGGTATGAGGG - Intergenic
1170447079 20:16439427-16439449 ATGAGGTTGGAGAGGTGGGCAGG - Intronic
1172416343 20:34771605-34771627 ATGAGTTTAAAGAGGTAGACAGG - Intronic
1172426108 20:34857175-34857197 ATGAGGTGGGAGGGGTAGGCTGG - Intronic
1172491471 20:35341945-35341967 ATGAGTTTGGAGAGGTGGTCTGG + Intronic
1172600346 20:36178685-36178707 TTGTGTTTGGGGAGGTGGGTGGG + Intronic
1173583145 20:44161411-44161433 ATGTGTGTGGAGAGGCAGCAGGG + Intronic
1173784508 20:45782937-45782959 TTGAGGTTGGAGAGGTAGGCAGG - Intronic
1173805426 20:45921818-45921840 ATGGGCTTGGAGAGGAAGGTAGG - Intergenic
1174065393 20:47860924-47860946 ATGTGTTTGGTGAGTGAGGAGGG - Intergenic
1174132117 20:48352590-48352612 ATGTGTATTGAGATGTGGGCAGG - Intergenic
1174400105 20:50271338-50271360 ATGTGTCTGGTGAGGTTGTCTGG + Intergenic
1176522132 21:7832259-7832281 ATCCATTTGGAGATGTAGGCAGG - Intergenic
1176926121 21:14751293-14751315 AGGAGTTTAAAGAGGTAGGCAGG - Intergenic
1178656152 21:34462271-34462293 ATCCATTTGGAGATGTAGGCAGG - Intergenic
1178767154 21:35465250-35465272 ATGAGTATGGATATGTAGGCCGG - Intronic
1179613658 21:42567993-42568015 ATGTGTCTGGGAAGGAAGGCCGG + Intronic
1180067559 21:45420253-45420275 ATGTGTTTGCAGGGCTGGGCAGG + Intronic
1180200425 21:46220769-46220791 AGGGGCTTGGAGAGGTAGCCAGG + Intronic
1180221887 21:46364367-46364389 TTGTGTTTGGACGGGCAGGCTGG + Intronic
1180485218 22:15788918-15788940 CTGTGTTTGAACAGGTAGGTTGG + Intergenic
1181063201 22:20291832-20291854 GTGTGTGTGAAGAGGGAGGCAGG - Intergenic
1181725927 22:24810845-24810867 ATGAGATGGGAGAGGCAGGCAGG + Intronic
1182011815 22:27007338-27007360 ATGGGTTTGGAGAGATAAGCAGG - Intergenic
1182035694 22:27196605-27196627 TTCTGTTTGGAGAGGTAAACTGG + Intergenic
1182246533 22:28962675-28962697 CTGTATTTGGGGAGGTATGCAGG + Intronic
1182603749 22:31487972-31487994 ATGTTTTTGAAGAGGTTGACAGG - Intronic
1182746094 22:32606604-32606626 ATGGGTTTGGAGCAGAAGGCAGG - Intronic
1183558104 22:38547412-38547434 CTGAGCTTGGAGAGGCAGGCTGG + Intronic
1184147035 22:42617782-42617804 ATGAGGCTGGAGAGGGAGGCGGG - Intergenic
1184262064 22:43323676-43323698 ATGTGTTTGGATAGAAAGGTGGG - Intronic
949675333 3:6447215-6447237 ATGTGTCTGGAGAGGTCAGCTGG - Intergenic
950088702 3:10279559-10279581 ATGTGCTTAGACAAGTAGGCGGG - Exonic
950983269 3:17331904-17331926 ATGAGGTTGGAGAGGTGGCCAGG + Intronic
951437928 3:22686693-22686715 ATGAATTTTGAGAGGCAGGCAGG - Intergenic
951905177 3:27699184-27699206 ATGAGATTGGAGAAGTAAGCAGG - Intergenic
952077869 3:29720068-29720090 GTGACTTTGGAAAGGTAGGCAGG - Intronic
952161277 3:30695778-30695800 ATGTGAATGGAGAGGAAGTCAGG - Intergenic
952659542 3:35828554-35828576 ATGTATTTGGAGCACTAGGCAGG + Intergenic
953016648 3:39083235-39083257 ATTTGATTGGAGGGGTAGGCAGG + Intronic
953104960 3:39868501-39868523 AAGGGTTTGGAGAGGTACCCAGG - Intronic
955763049 3:62309966-62309988 ATGAGTTTAGAGAAGTAAGCAGG + Intergenic
955923857 3:63986478-63986500 ATCTGCTTGGAGAGACAGGCAGG + Intronic
957132200 3:76237800-76237822 ATGAGATTGGAGCGGTAAGCAGG + Intronic
957291727 3:78285619-78285641 ATGTTTTTGGAGAGGTAGAGTGG + Intergenic
957709924 3:83843003-83843025 ATGAGGTTGGAGAGTCAGGCTGG - Intergenic
958177417 3:90014116-90014138 ATGTCTTTGAAAAAGTAGGCTGG + Intergenic
958672622 3:97223774-97223796 ATGTGGTTGGAGAGGTAGGCAGG + Intronic
958854561 3:99368868-99368890 ATGTGTCTGCAGAGGTATGTTGG + Intergenic
958899824 3:99872569-99872591 ATGTGTTTGTGGGGGCAGGCAGG - Intronic
959837850 3:110942079-110942101 ATGTGTAGGGAGAGGAAGGTAGG + Intergenic
960116013 3:113893318-113893340 ATGTGGGTGGAGAGGTGGGAAGG - Intronic
961917575 3:130393166-130393188 ATGAGGTTGGCGAGGTGGGCAGG - Intronic
962437138 3:135377603-135377625 TGGTGCTTGGAGAGGTGGGCAGG - Intergenic
963005672 3:140724292-140724314 ATCTGTGTGGAAAGTTAGGCAGG + Intergenic
963575448 3:147055999-147056021 ATTAGTTTGGAGAATTAGGCAGG - Intergenic
963851905 3:150217653-150217675 AGGTGTTTGGGGAGGTGGGGAGG + Intergenic
964351843 3:155810686-155810708 ATGAGCTTGGAGAGACAGGCAGG - Intergenic
965521639 3:169673656-169673678 ATATGTTTGGAAAGATAGGTTGG + Intergenic
965542832 3:169887644-169887666 ATGTGTGTGGAGAGGGAGTGAGG - Intergenic
965615554 3:170588427-170588449 ATGTCAGTGGAGAGGTAGGCAGG - Intronic
965736043 3:171822222-171822244 CTGTACTTGGGGAGGTAGGCGGG + Intergenic
966331716 3:178822101-178822123 ATGAGTTTGCAAAGGTAGGTAGG - Intronic
966778856 3:183566229-183566251 GTGGGATGGGAGAGGTAGGCAGG + Intergenic
967788118 3:193519359-193519381 ATGGAGTTGGAGAGGAAGGCAGG - Intronic
967929588 3:194681153-194681175 ATGAGGTTGGAGACATAGGCAGG + Intergenic
969136603 4:5034287-5034309 GTGTGTTTGGTGAGAAAGGCAGG - Intergenic
969233599 4:5849577-5849599 ATGTGTTTGCAGAGGCTGGCAGG - Intronic
969826618 4:9763014-9763036 AGTTGTTTAGAGAGGTAGGCCGG - Intergenic
969943221 4:10756087-10756109 ATGAGGATGGGGAGGTAGGCAGG - Intergenic
970551647 4:17187707-17187729 ATGAGATTGGAAAGGTAGACGGG - Intergenic
970627343 4:17902161-17902183 ATGTGGCTGGATAGGTGGGCAGG + Intronic
970803358 4:20002969-20002991 ATGAGTCTGGAGAGGTAGGCAGG - Intergenic
971178948 4:24309443-24309465 GTGAGGTTGCAGAGGTAGGCAGG + Intergenic
971393625 4:26208800-26208822 ATTTGTTTGGGGAGACAGGCTGG - Intronic
971394181 4:26213585-26213607 ATGAGAATGGAAAGGTAGGCGGG + Intronic
971495901 4:27264959-27264981 GTGAGTTTGGGGAGGCAGGCAGG + Intergenic
972862635 4:43189899-43189921 ATGAGTTTGGAAAGCTGGGCAGG - Intergenic
973908052 4:55550485-55550507 ATGAGGTTGGAGAGGTAGGGAGG - Intergenic
974894266 4:67919864-67919886 GTGAGCTTGGAGAGGTAAGCAGG + Intronic
975701768 4:77074781-77074803 AGGTGTTTCGGGAGGTAGGATGG - Intronic
976879234 4:89898599-89898621 ATGAGGTTGGGGAGGTAGGCAGG - Intronic
977320706 4:95512070-95512092 ATGGGTCTGGAGAAGGAGGCAGG + Intronic
977689475 4:99889667-99889689 ATGTGGCTGGAGAGGAAGGATGG + Intronic
978046077 4:104129399-104129421 ATGTGCATGGAGTGGCAGGCAGG - Intergenic
978322238 4:107510463-107510485 CTGTGTATGGAGAGGTAGTTAGG + Intergenic
978352749 4:107837517-107837539 ATGGGTGTGGCGAGGCAGGCAGG + Intronic
978458574 4:108924565-108924587 ATGTGACTGGAGAAGAAGGCTGG - Intronic
979286970 4:118937202-118937224 ATGTACTTGGACATGTAGGCGGG - Intronic
981677750 4:147359519-147359541 ATGTGTTGGGGGAGGTAACCCGG - Intergenic
982003392 4:151042135-151042157 ATTAAGTTGGAGAGGTAGGCAGG + Intergenic
982090317 4:151874996-151875018 ATGTATTAAGAAAGGTAGGCAGG + Intergenic
982216562 4:153087430-153087452 GGAGGTTTGGAGAGGTAGGCAGG + Intergenic
983116209 4:163819598-163819620 AGGGATTTGGAGAGGTAGGAGGG - Intronic
983160579 4:164408958-164408980 ATGTGGATGGAGAGTTAGTCTGG - Intergenic
983441048 4:167785256-167785278 ATGGATGTGGAGGGGTAGGCTGG - Intergenic
984157640 4:176211106-176211128 GTGTGTCAGGAGAGTTAGGCGGG - Intergenic
984575784 4:181446716-181446738 ATGAGGTTGGAGAGGTAGACAGG + Intergenic
985732176 5:1555524-1555546 TGGTGTTTGCAGAGGGAGGCAGG - Intergenic
985829216 5:2215618-2215640 CTGTGTTGGCAGAGGTGGGCAGG + Intergenic
987147466 5:15006193-15006215 ATGAGTGTGGAGAAGTAGGCAGG - Intergenic
989088662 5:37704791-37704813 GTGTCTTTGGAGAGTGAGGCAGG + Intronic
989813989 5:45712944-45712966 GTTTGTTTGGAGATGTTGGCAGG - Intergenic
990474074 5:56144532-56144554 ATGAGGTTGGAGAGGGAGGCAGG + Intronic
990986959 5:61649553-61649575 GTGAGGTTGGAGAGGTAGGCAGG - Intronic
991528633 5:67591674-67591696 ATGTGTTTGGCGTGGGAGACAGG + Intergenic
992290817 5:75277715-75277737 ATGTCTTAGGTGAGGCAGGCAGG - Intergenic
992384214 5:76268110-76268132 ATGAGTGTGGAGAAGCAGGCTGG + Intronic
993031536 5:82712306-82712328 ATGTGTTTGGAAAGAGAGGAGGG + Intergenic
993139418 5:84011628-84011650 ATGACATTGGAGAGGTATGCAGG - Intronic
993487840 5:88508349-88508371 ATGAGTCTGGAAAGGTAGACAGG + Intergenic
993563450 5:89441839-89441861 ATTTGATTGGAGAAGGAGGCAGG - Intergenic
993847215 5:92959045-92959067 ATGAATTTGGATAGATAGGCAGG - Intergenic
993930740 5:93935555-93935577 ATGAGGTTGGAGAGGTGGGCAGG + Intronic
994809784 5:104500589-104500611 ATGTGTTTGGAGAGGAAGCCAGG - Intergenic
995507853 5:112879318-112879340 ATGTGTTTGGGGGGGGGGGCTGG + Intronic
995561975 5:113391847-113391869 ATGGGTGTGGAGAGGGAGGTAGG + Intronic
996164970 5:120212609-120212631 ATGTGTTTGGAGCCTTTGGCAGG - Intergenic
996248699 5:121299616-121299638 ATGAGTTTGGAGAGGGTGGTGGG - Intergenic
997311412 5:132886809-132886831 GTGTGACTGGAGAGATAGGCAGG - Intronic
997858315 5:137392945-137392967 ATGTGTTAGGAGAAAGAGGCTGG - Intronic
997930595 5:138069532-138069554 CTGAGTTTGCAGAGGAAGGCAGG + Intergenic
998052349 5:139046422-139046444 ATGAGATTGGAGAGGTATGTGGG - Intronic
998403875 5:141862916-141862938 ATGGGTTGGGGGTGGTAGGCAGG - Intronic
998742699 5:145223008-145223030 ATGTGGCTGAAGAGGTAGGTGGG + Intergenic
998834442 5:146190318-146190340 ATGGGTCAGCAGAGGTAGGCAGG + Intergenic
998903989 5:146884136-146884158 ATGTGTTTCTACTGGTAGGCTGG - Intronic
998954615 5:147426372-147426394 ATCAGGTTGGGGAGGTAGGCAGG + Intronic
999174982 5:149625748-149625770 GTGTGTGTGGAGAGGTGGGAGGG - Intronic
999637132 5:153634562-153634584 ATGTGGTGGGAGAGATAGGCAGG + Intronic
999653318 5:153788490-153788512 ATGAGGTTGGAGAGGCTGGCAGG - Intronic
1000168967 5:158682803-158682825 ATATGCTTGGAGAGATAAGCAGG + Intergenic
1000720925 5:164705601-164705623 CTGTGTTGGTAGAGGTAGGATGG + Intergenic
1001277207 5:170359641-170359663 TTGGGGCTGGAGAGGTAGGCAGG - Intronic
1001791118 5:174458652-174458674 ATGTGTGTGGGGAGGTAGGGAGG - Intergenic
1002334677 5:178469626-178469648 ATGTGGTTGGACATGAAGGCAGG - Intronic
1002966033 6:1967128-1967150 ATGTTTTTAGCGAGGGAGGCAGG - Intronic
1003403696 6:5811093-5811115 ATGTGGTTGCAGAGGCAGGCAGG + Intergenic
1003447239 6:6195788-6195810 TTGTTTTTGCAGAGGTAAGCAGG - Exonic
1003469720 6:6417935-6417957 ATGTGTGTGCACAGGTATGCAGG - Intergenic
1003725495 6:8757898-8757920 ATATGTATGAAGAGGAAGGCAGG + Intergenic
1005808014 6:29493272-29493294 AAGCTTTTAGAGAGGTAGGCAGG + Intergenic
1006946086 6:37785333-37785355 AGGTGTCTGGAGAGGTGGGCAGG + Intergenic
1007181462 6:39932143-39932165 AGGTGCTTGGAGAGCTAGGATGG - Intronic
1007256364 6:40532048-40532070 ATGAGATTGGAAAGGTAGGTGGG - Intronic
1007974538 6:46087025-46087047 ATGTGTATGGTGAGCTAGGATGG - Intergenic
1008522157 6:52372468-52372490 ATGTTTCTAGAGAGGCAGGCTGG + Intronic
1010331659 6:74630130-74630152 AGGTGTTTGGGGAGGGAGGGAGG - Intergenic
1010427817 6:75746549-75746571 ATGAGATTGGAGAGGTAAGCAGG + Intergenic
1011780579 6:90785078-90785100 ATAAGATTGGAGAGGAAGGCTGG - Intergenic
1012011251 6:93788737-93788759 ATGTGTTAGGAGACCAAGGCAGG - Intergenic
1013060077 6:106625195-106625217 ATGACACTGGAGAGGTAGGCAGG - Intronic
1013949097 6:115757895-115757917 ATGTGTTTGAATATGTTGGCAGG + Intergenic
1014036227 6:116769588-116769610 TTGAGCTTGGAGAGGTAGGCAGG - Intergenic
1014871455 6:126601625-126601647 AAGTATTTGGAGATGCAGGCAGG - Intergenic
1015631566 6:135236900-135236922 AGGTGTTAGGAGAGGCAGGAAGG - Intergenic
1015769619 6:136755218-136755240 ATGCGGCTGGAGAGGGAGGCAGG - Intronic
1015809731 6:137149761-137149783 ATGGGACTGGAAAGGTAGGCAGG - Intronic
1015991206 6:138945315-138945337 ATGTGTGTGGAGAAGTTGGTGGG + Exonic
1016023400 6:139259356-139259378 ATGAAGTTGGAGAGGTAAGCAGG - Intronic
1019631941 7:2054086-2054108 CTGTGTTGGGGGAGGTGGGCTGG - Intronic
1019781230 7:2941096-2941118 ATGTGTTTGGGGAGGAACACAGG - Intronic
1020466597 7:8486649-8486671 ATGAGTTTGGAGAGGCAGGCAGG - Intronic
1020772287 7:12409596-12409618 TTGAGTTTGAACAGGTAGGCAGG - Intergenic
1021229505 7:18068849-18068871 ATGAGTTAAGAGAAGTAGGCAGG - Intergenic
1022945381 7:35278861-35278883 ATGTGTGTGGAGATGGATGCAGG + Intergenic
1022996703 7:35763296-35763318 ATGAGCTTGGAAAGGCAGGCAGG + Intergenic
1023060121 7:36318579-36318601 ATTTGTTTTGAGATGGAGGCTGG - Intergenic
1023079368 7:36513258-36513280 AGGTGTTTGGAGACCAAGGCGGG - Exonic
1023422992 7:40003735-40003757 ATGGGATTGGAGAAGTAGGCAGG - Intronic
1023465453 7:40449590-40449612 TTTTGTTTGGAATGGTAGGCAGG - Intronic
1023658302 7:42448379-42448401 GTGTGTCTGGGGAGGTGGGCTGG + Intergenic
1023768344 7:43532510-43532532 ATGAGTTTGGAGAGGCACCCAGG - Intronic
1024007937 7:45241246-45241268 ATGGGCTTGGAGGGGCAGGCAGG + Intergenic
1024391476 7:48817945-48817967 ATGTATTTGAAGGGATAGGCTGG + Intergenic
1025873106 7:65453455-65453477 ATGTGTTTTGAGGGGGAGGGAGG - Intergenic
1028513500 7:91650764-91650786 ATGCGATTGGAAAGGTAGGCAGG - Intergenic
1028579118 7:92386871-92386893 AAGTATTTACAGAGGTAGGCTGG - Intronic
1028695041 7:93699441-93699463 ATGGGGCTGGAGAGGTAGACAGG + Intronic
1029558249 7:101285410-101285432 ATGTGTCTGGAGAGGCACACGGG - Intergenic
1029805558 7:102992286-102992308 ATGTGTTTGGAAAGGTGGGTTGG - Intronic
1030510679 7:110479202-110479224 ATGAGGTTGGAGAAGTAGGCAGG - Intergenic
1030511101 7:110482791-110482813 ATGAGGTTGGAGAAGAAGGCAGG - Intergenic
1030879439 7:114858892-114858914 ATGAGCTTGGAGAGGAAGGTGGG + Intergenic
1030984910 7:116230311-116230333 TTGTGTTTGGAAAGGTAGAGGGG + Intronic
1031015419 7:116570404-116570426 ATTAGATTGGAGAGATAGGCAGG - Intergenic
1032315659 7:130836167-130836189 ATGTGATCAGAGAGGTTGGCAGG - Intergenic
1032798778 7:135301405-135301427 ATGTGTTTGGAGGAGTAAGCTGG - Intergenic
1032878185 7:136060127-136060149 ATTTTGTTGGAGAGGTAGGCAGG + Intergenic
1033219080 7:139516128-139516150 AAGTGTTTGGAGACCAAGGCAGG + Intergenic
1034730492 7:153382875-153382897 TTGTGTATGGAGAGGTTGCCAGG - Intergenic
1035214931 7:157358461-157358483 ATGGGTCTGGAGAGGGAGGAAGG - Intronic
1035375029 7:158402111-158402133 GTGTGTTTGGAGGGGGTGGCTGG - Intronic
1035690967 8:1559377-1559399 ATTTGTTTGCTGAGGCAGGCTGG + Intronic
1035797409 8:2371075-2371097 ATGTGTTTGGAGGGGTTGACAGG - Intergenic
1037275780 8:17176748-17176770 GTGAGTTTGGAGAGAAAGGCAGG + Intronic
1037352880 8:17981149-17981171 ATGAGTCTGGAGAGGCAGGAAGG - Intronic
1037436472 8:18869148-18869170 GTGAGTGTGGAGAGGTAGGGAGG - Intronic
1037713870 8:21379805-21379827 AGGTATTTGGAGATGTATGCGGG + Intergenic
1039078832 8:33716157-33716179 ATGTGGTTTGAGAGTTAGTCAGG + Intergenic
1039748563 8:40455816-40455838 GTGTGTTTGGTGAGGGAGCCAGG - Intergenic
1039865817 8:41500459-41500481 GTGGATTTGGAGAGGTAAGCAGG + Intronic
1040093659 8:43421725-43421747 TTATGTGTGCAGAGGTAGGCTGG + Intergenic
1040700926 8:50064625-50064647 ATGAGGTTGGAGGTGTAGGCAGG - Intronic
1040913178 8:52541929-52541951 ATGTGGCTGGAAAGGTAGGTTGG - Intronic
1041231371 8:55756623-55756645 ACCTGTGTGGAGAGGTAGCCTGG + Intronic
1042953043 8:74220623-74220645 ATGTGTGTGGTGGGGTAGGGTGG + Intergenic
1043401595 8:79890652-79890674 GTGTGTTTGGGGAGGTGGGGTGG - Intergenic
1043737011 8:83761243-83761265 ATGTGTTTGAAGGGATAGGAAGG - Intergenic
1044260393 8:90113028-90113050 ATGAGGTTGGAGAGGTAGGCAGG + Intergenic
1044332293 8:90935253-90935275 ATGAGTTTGGACAGATGGGCAGG - Intronic
1044530904 8:93306525-93306547 ATGTGGTTGCAGAGGCAGGCAGG - Intergenic
1044941862 8:97351690-97351712 ATGTGTTTGGTAAGGGAGGTTGG + Intergenic
1045051864 8:98334755-98334777 ATGAGGCTGGAGAGGTAAGCTGG - Intergenic
1045082816 8:98647120-98647142 TTGTGTTTGGAGAGGCAGAAGGG - Intronic
1045233721 8:100330822-100330844 ATGAAGTTGGAGAGGTGGGCAGG - Intronic
1045258294 8:100548260-100548282 ATGAATTTGGAGAGGTAGGCAGG - Intronic
1046685926 8:117226820-117226842 ATGTGATTGGAAAGGTAGGCAGG + Intergenic
1047698763 8:127429569-127429591 ATGGGGTTGGAGAGGTAAGTTGG - Intergenic
1048817866 8:138350923-138350945 ATGACTTTGGGGAGGTAAGCAGG - Intronic
1049194132 8:141306375-141306397 ATGTGTTTCTAGAGAGAGGCTGG - Intronic
1050029389 9:1369168-1369190 ATGTGCATGGAGAGGAAGACAGG + Intergenic
1050271480 9:3950430-3950452 ATGAGGCTGGAGAAGTAGGCGGG - Intronic
1050465367 9:5917409-5917431 ATGAAGCTGGAGAGGTAGGCAGG + Intronic
1051189865 9:14500052-14500074 ATGTGGCTAAAGAGGTAGGCAGG - Intergenic
1052024759 9:23562299-23562321 ATGTGTGTGGAGGGGTGGGATGG - Intergenic
1052317026 9:27125844-27125866 ATGTGTTGAGAGAGGTGGGATGG - Intronic
1052546342 9:29885699-29885721 GTGAGTTTAGACAGGTAGGCAGG + Intergenic
1052609283 9:30750054-30750076 ATTTTTTGGGTGAGGTAGGCAGG + Intergenic
1055472660 9:76628827-76628849 GTGTGTTTGGAGAAGTGGGTTGG - Intronic
1057901673 9:98953706-98953728 CTGGGTTTGGAGAGCTTGGCTGG + Intronic
1058077953 9:100669567-100669589 GTGTGTGTGGGGAGGTAGGCGGG + Intergenic
1059188185 9:112296540-112296562 ATGTTTTTGGAGTTGTAGGGAGG - Intronic
1059210561 9:112511014-112511036 GTGTGTCAAGAGAGGTAGGCAGG + Intronic
1059449449 9:114361176-114361198 ATGTGGCTGGAGAGGCAGGCAGG - Intronic
1060018102 9:120104662-120104684 ATGCGTGTGGAGAGGGAGGTTGG + Intergenic
1060072056 9:120558560-120558582 ATGTGGTTGGAGAGGTGGACAGG - Intronic
1060202554 9:121660053-121660075 GTGTGACTGGAAAGGTAGGCAGG + Intronic
1060387202 9:123241916-123241938 ATGAGGTTGGTGAGGTAGGCAGG - Intronic
1060584890 9:124779814-124779836 ATGGGCTTGGAGAGGAAGGCGGG - Intronic
1060673333 9:125490013-125490035 AGGAGTGTGGTGAGGTAGGCAGG - Intronic
1060840351 9:126788599-126788621 ATGAGGCTGGAGGGGTAGGCAGG - Intergenic
1060905408 9:127300482-127300504 TTGTTTTTTGAGACGTAGGCTGG + Intronic
1062114357 9:134799955-134799977 ATGTGTCTAGAGAGGTGGCCGGG - Intronic
1062679699 9:137772207-137772229 TTGTGCTTGGAGAGGTGTGCTGG - Intronic
1186206459 X:7205530-7205552 CTGTGTCTGGAGGGGTTGGCTGG + Intergenic
1186494517 X:10001534-10001556 ATGTGTTTGGAGAAATATGGAGG + Intergenic
1186963573 X:14763063-14763085 CTGAGCTTGGAAAGGTAGGCTGG + Intergenic
1187191422 X:17038813-17038835 ATGAGGTCGGAGAGGGAGGCAGG + Intronic
1187289591 X:17940310-17940332 ATGAGCCTGGAGAGGGAGGCAGG + Intergenic
1187865077 X:23716624-23716646 ATATAGTTGGAAAGGTAGGCTGG + Intronic
1188034712 X:25304670-25304692 ATGAATTTGGAGAGGTAGATGGG + Intergenic
1188340766 X:28998455-28998477 ATGTTTATGGAGAGGGAGGTGGG + Intronic
1189261117 X:39679521-39679543 ATGTTTTTGGAGGGTTGGGCTGG - Intergenic
1189705893 X:43758392-43758414 ATGAGGTTGGAGAGATAGACAGG - Intergenic
1189901006 X:45706274-45706296 ATTAATTTGGACAGGTAGGCAGG - Intergenic
1191882977 X:65860689-65860711 ATGGGTGGGGAGAGGTAGGTAGG + Intergenic
1192176406 X:68888641-68888663 ATGTGGTCAGAGAGGGAGGCAGG + Intergenic
1192197046 X:69035351-69035373 ATGTGGTTGGAGAGGTACGCAGG - Intergenic
1192244350 X:69360450-69360472 ATGAAACTGGAGAGGTAGGCTGG + Intergenic
1192425353 X:71070076-71070098 AAGTGTTTAGAAAGGTAGACTGG + Intronic
1192468729 X:71378000-71378022 AAATGTTTGGTGGGGTAGGCGGG + Intronic
1193577244 X:83214556-83214578 AAGTGTTTGGAGAGGTGGCAGGG + Intergenic
1193598851 X:83483287-83483309 ATGTGTTTGTGGAGGTATGAGGG + Intergenic
1194254943 X:91624057-91624079 ATGTGCTGGGTGTGGTAGGCAGG + Intergenic
1194598700 X:95892569-95892591 GTGTGTTGGGGGAGGAAGGCGGG + Intergenic
1194933019 X:99912229-99912251 ATGTGTGTGTAGTGGCAGGCAGG - Intergenic
1195381962 X:104279549-104279571 ATGAGGTTGGAGAGGTGGACAGG + Intergenic
1195841474 X:109180618-109180640 AGGTGTTTGGAGATGTGTGCTGG - Intergenic
1196020418 X:110985215-110985237 ATGAGGTTGCAGAGGAAGGCAGG - Intronic
1196185950 X:112745141-112745163 ATGAGGTTGGAGAGGTGAGCAGG - Intergenic
1196595571 X:117541803-117541825 ATGTGTTTGGAAAGAGAGACTGG - Intergenic
1196666914 X:118326650-118326672 ATGTGTTTGGAGAAGTAAGCAGG - Intergenic
1198006952 X:132504644-132504666 ATGTGTCTGAAGACTTAGGCAGG + Intergenic
1198229826 X:134678261-134678283 ATGAGTTTGGAGAGGTTGGTAGG - Intronic
1198320446 X:135514424-135514446 ATGAGTTTGAAGAGGTGAGCCGG - Intergenic
1198429862 X:136554439-136554461 AGAAGTCTGGAGAGGTAGGCAGG + Intronic
1198469938 X:136936846-136936868 ATGAGTCTGGAGAGATAGGTGGG + Intergenic
1198738738 X:139817469-139817491 ATGGGGCTGGAGAGGGAGGCAGG + Intronic
1198821295 X:140651036-140651058 ATGTGCTTGGACAGGGAGGATGG - Intergenic
1199290940 X:146104610-146104632 ATGAGTTTGGAGATTCAGGCAGG + Intergenic
1199471082 X:148197389-148197411 AAGTGTTTTGAGAAGTAGCCTGG + Intergenic
1199688076 X:150281953-150281975 ATGTGGTTGGGGAAGAAGGCAGG - Intergenic
1200573729 Y:4863660-4863682 ATGTGCTGGGTGTGGTAGGCAGG + Intergenic