ID: 1097951169

View in Genome Browser
Species Human (GRCh38)
Location 12:65429614-65429636
Sequence CAGTGGGCCCAGTGGGAACA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 365
Summary {0: 1, 1: 0, 2: 0, 3: 35, 4: 329}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1097951169_1097951175 25 Left 1097951169 12:65429614-65429636 CCATGTTCCCACTGGGCCCACTG 0: 1
1: 0
2: 0
3: 35
4: 329
Right 1097951175 12:65429662-65429684 TTCTCTCCAGTTTTATTAGTGGG 0: 1
1: 0
2: 2
3: 26
4: 344
1097951169_1097951174 24 Left 1097951169 12:65429614-65429636 CCATGTTCCCACTGGGCCCACTG 0: 1
1: 0
2: 0
3: 35
4: 329
Right 1097951174 12:65429661-65429683 TTTCTCTCCAGTTTTATTAGTGG 0: 1
1: 0
2: 6
3: 24
4: 376

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1097951169 Original CRISPR CAGTGGGCCCAGTGGGAACA TGG (reversed) Intronic
900938846 1:5784800-5784822 CTGTGGGGCCAGGGGGACCAGGG - Intergenic
901666977 1:10831647-10831669 CTGTGGGCCCAGTGGGCCCTGGG + Intergenic
902775424 1:18671505-18671527 CAGTGGGCCAGGTGGGAGGAGGG + Intronic
904318708 1:29682661-29682683 CAGTGGGGTCAGAGGGAGCAGGG - Intergenic
905028222 1:34865591-34865613 CCCTGGGCCCAGTGGGCAGAGGG + Exonic
905513676 1:38544875-38544897 CAGGGGACCCAATGAGAACAAGG - Intergenic
906477719 1:46181049-46181071 AGGTGGGCCCAGGGGAAACAAGG + Intronic
907237307 1:53061603-53061625 CTGTGGGCCCAGGGCCAACAGGG + Intergenic
907780185 1:57559642-57559664 CAGTGGGTCCAGTGGGTCCCCGG + Intronic
911883407 1:103269268-103269290 CAGTGGGTCCAGTGGGTCCCCGG + Intergenic
911980289 1:104558401-104558423 CAGTGGGTCCAGTGGGTCCCCGG + Intergenic
912130069 1:106589242-106589264 CAGTGGGTCCAGTGGGTTCCTGG - Intergenic
913225315 1:116693721-116693743 CAGTGGACAGAGTGTGAACAGGG + Intergenic
915507754 1:156368242-156368264 CAGTGGGCACACAGGGAACCTGG + Intergenic
915929215 1:160048378-160048400 CAGTTGGCCCAGAAGGAGCAGGG - Intronic
916285153 1:163098321-163098343 CAGTGGGTCCAGTGGGTCCCTGG + Intergenic
916929130 1:169556680-169556702 CTGTGGGCCCAGAGGGAAAGTGG - Exonic
918045399 1:180938178-180938200 CAAGGGACACAGTGGGAACAGGG - Intronic
918755886 1:188338981-188339003 CAGTGGGTCCAGTGGGTCCCTGG - Intergenic
918909518 1:190547726-190547748 TAATGGGCCCAGTGGGAATTAGG + Intergenic
919982483 1:202650962-202650984 CACTGGGCAGAGTGGGAAGAAGG + Intronic
920226947 1:204446137-204446159 CAGTGAGCCTGGTGGGCACACGG + Exonic
920264096 1:204709053-204709075 TAGAGGGTCCAGTGGGAGCATGG + Intergenic
921219533 1:212963326-212963348 CAGTGGCCCCAGTGGGCAGGGGG - Intronic
922876058 1:228940700-228940722 CAGGGGACCCAGTGGGACGAGGG - Intergenic
923341284 1:233009033-233009055 CAGTGTGGCCAGTAGGAGCAAGG + Intronic
1064169425 10:13017157-13017179 CAGTAGGCAAAGTGGAAACAGGG + Intronic
1064545861 10:16449327-16449349 CAGTGGGTCCAGTGGGTCCCTGG - Intronic
1067125711 10:43513756-43513778 CAGTGGGTCCAGTGGGTCCCCGG - Intergenic
1068447040 10:57137407-57137429 CAGTGGGTCCAGTGGGTCCCTGG + Intergenic
1069440453 10:68423782-68423804 AAGTGGGCCCAGCGGTAACGAGG + Intronic
1070259184 10:74837698-74837720 CAGTGGGGCCAGTGGGATGTTGG + Intronic
1070757466 10:79002349-79002371 CAGAGGGACCTGTGGGCACAGGG - Intergenic
1072711481 10:97718416-97718438 CAGAGGGCCCATTGAGAGCAGGG - Intergenic
1073557181 10:104464710-104464732 CAGTGGGTCCAGTGGGACCCCGG + Intergenic
1073656805 10:105425425-105425447 AAGTGGGTCCAGTGGGTACCTGG - Intergenic
1076307205 10:129473881-129473903 CAGTGGGGCCAGAGGAAAGATGG + Intronic
1076522415 10:131089387-131089409 CAGTGGGCCGAGTGAGATAACGG + Intergenic
1076814890 10:132909765-132909787 CGGTGAGCTCAGTGGGAAAAGGG + Intronic
1077046578 11:549350-549372 CTGTGGCTACAGTGGGAACAGGG + Intronic
1077083800 11:737411-737433 CAGTGAGACCAGAGGGAACACGG - Intergenic
1077181761 11:1220120-1220142 CAGAGGGCCCATTGGGAACTGGG - Intergenic
1077647911 11:3942547-3942569 GAGTGGGCCTAGCTGGAACATGG + Intronic
1081608889 11:44546662-44546684 CAGTGGGTCCAGTGGGTCCCCGG + Intergenic
1083615401 11:64023674-64023696 GAATGGGCCCAGTGGGAAGGAGG - Intronic
1083994521 11:66265565-66265587 CAGTGGGCCCTGAGGAAGCATGG - Intronic
1084605793 11:70170920-70170942 CAGTGGGGCCAGGGGGAAGGAGG - Exonic
1084840110 11:71839769-71839791 CAGTGTCCACAGTGGGAATATGG - Intergenic
1086559077 11:88146206-88146228 CAGTGGGGTCAGTGGTAAGATGG + Intronic
1088191830 11:107235706-107235728 CAGTGGGTCCAGTGGGTCCCTGG - Intergenic
1088989808 11:114942957-114942979 CAGTGGCCACAGTGGGGACCCGG - Intergenic
1089054828 11:115577065-115577087 CACTGGGCACAGTGAGAACTTGG - Intergenic
1090078476 11:123594396-123594418 CAGTTGGCCCAGTGGCAGAAGGG + Intronic
1090420580 11:126572548-126572570 CAGAGACCCCAGTGGGAAGAGGG + Intronic
1090827391 11:130397396-130397418 CAGTGGGCTCTGTGGGACCCTGG + Intergenic
1091280265 11:134377826-134377848 CAGTGGGCTGAGTGGGGGCATGG - Intronic
1095749812 12:45697468-45697490 CCGTGGGGCCAGTGGGAGCTGGG - Intergenic
1096652497 12:53068727-53068749 CAGGGGGCCTAATGGGGACAGGG + Intronic
1097843519 12:64343967-64343989 CAGTGGGTCCAGTGGGCCCCTGG - Intronic
1097951169 12:65429614-65429636 CAGTGGGCCCAGTGGGAACATGG - Intronic
1098832064 12:75375237-75375259 CAGTGGGGCCAGTGGGTCCCTGG - Intronic
1099183957 12:79497879-79497901 CAGTGGGTCCAGTGGGTCCCTGG - Intergenic
1100874916 12:98951669-98951691 CTGTAGGCCCAGAGGGAAGAGGG - Intronic
1101318546 12:103652225-103652247 CAATGGCCCCAGGAGGAACAAGG - Intronic
1102077263 12:110069527-110069549 CAGTGGACCCACTGGGAAGAAGG - Intronic
1103239785 12:119403599-119403621 CAGAGGGCACAGGGGGAAGATGG - Intronic
1103396360 12:120610232-120610254 CAGTGGGTCCAGTGGGTCCCCGG + Intergenic
1103650517 12:122428358-122428380 CACTGGGCCCAGCGAGAGCAGGG + Intergenic
1107333019 13:39321816-39321838 GAGTGGGCCCAGAGGGAATGAGG - Intergenic
1107549229 13:41458841-41458863 GAGGGGGCACAGTGGGGACATGG + Intronic
1107983740 13:45757173-45757195 CAGTGGGTCCAGTGGGTCCCCGG - Intergenic
1108559546 13:51628570-51628592 CTGTGAGGCCAGTGGGAGCAAGG - Intronic
1108638160 13:52356777-52356799 TAGTGTGCCCAGAGGGGACATGG + Intergenic
1108779999 13:53818401-53818423 AAGTGGGCCAGGTGGGAATAAGG - Intergenic
1109293070 13:60498929-60498951 CAGTGGGTCCAGTGGGTACGCGG + Intronic
1110500844 13:76226112-76226134 GTGTGTGCACAGTGGGAACAAGG - Intergenic
1111215661 13:85137771-85137793 CAGTGGGTACAGTAAGAACATGG + Intergenic
1112226215 13:97543310-97543332 CAGCGGTCTCCGTGGGAACAGGG - Intergenic
1113005589 13:105698446-105698468 CAGTGTGCTCTGTGGGAATATGG - Intergenic
1113554940 13:111225578-111225600 CACTGGGACAAGTGGGCACATGG - Intronic
1113632255 13:111896424-111896446 CTGAGGGCCCACTGGGAACGGGG - Intergenic
1113916786 13:113878759-113878781 CAGTGGCCCCAGGTGCAACACGG - Intergenic
1114073139 14:19131613-19131635 CAGTGTGCCCAGTGGGCATGGGG - Intergenic
1114089127 14:19268370-19268392 CAGTGTGCCCAGTGGGCATGGGG + Intergenic
1114758418 14:25285074-25285096 CAGTGGGTCCAGTGGGTCCCCGG - Intergenic
1117596432 14:57331091-57331113 CAGTGGGTCCAGTGGGTCCTGGG - Intergenic
1117908398 14:60613490-60613512 CTGTGGGCCCAGAGGGTCCAGGG + Intergenic
1117997327 14:61490026-61490048 CTGTGTGCCCAGGGGTAACATGG - Intronic
1118274409 14:64372909-64372931 GAGAGGGCCCAGTGGGAGAATGG - Intergenic
1118633179 14:67724635-67724657 CAGAGGCCCCAGTGGGAAGAAGG - Intronic
1119188087 14:72658870-72658892 AAGTGTGCCCAGTAGGCACATGG + Intronic
1119721028 14:76890583-76890605 CAGTGATCCAAGAGGGAACATGG + Intergenic
1119848394 14:77847659-77847681 CACTGGCCACAGTGGGAAAAGGG - Intronic
1120942151 14:89958673-89958695 AAGTGTGCCAAGTGGGAAGAGGG + Intronic
1121371220 14:93360084-93360106 CAGTGGGTCCAGTGGGTCCCTGG + Intronic
1122285659 14:100650796-100650818 CAGTAGGCCCAGTTGGTCCATGG - Intergenic
1122285910 14:100652533-100652555 CTGTGGGTCTAGTGGCAACAGGG + Intergenic
1122345140 14:101053906-101053928 CAGTGGGCCCTGCGGGAGCCTGG + Intergenic
1122772351 14:104103038-104103060 CAGTGGGCACAGTGGGTGCCTGG + Intronic
1124613297 15:31223761-31223783 CAGGGGGCCCAGGGTGACCACGG + Intergenic
1125483704 15:40097982-40098004 CAGTGGGCCCACTGGGTCCAAGG - Intronic
1125782167 15:42279373-42279395 CAGGTGGGCCAGGGGGAACAGGG + Intronic
1126010649 15:44299095-44299117 TAGAGGCTCCAGTGGGAACAGGG + Intronic
1127356743 15:58207978-58208000 CAGTGGGTCCAGTGGGTCCCTGG + Intronic
1129128763 15:73470905-73470927 CAGTGTGCCTAGTGGGTTCAGGG + Intronic
1129243986 15:74268815-74268837 CTGTGGGCTCAGGGGGAGCACGG - Intronic
1129461046 15:75700268-75700290 CAATGGCCCCAGTGGGAGGAGGG + Intronic
1129723774 15:77891457-77891479 CAATGGCCCCAGTGGGAGGAGGG - Intergenic
1131247049 15:90804028-90804050 TAGTGAGCCCACTGGGAACAGGG - Intronic
1131920958 15:97328164-97328186 CAGTGAGCTCAGTAGGACCATGG + Intergenic
1134365179 16:13570627-13570649 CAGTGTGAACAGTGTGAACAAGG + Intergenic
1135186508 16:20320423-20320445 CTGTGGGCCCAGGGAGATCAAGG - Exonic
1135597407 16:23754946-23754968 CAGTGGCCCCAGGGGGACGAAGG - Exonic
1136377892 16:29876389-29876411 CGGGGAGCCCAGTGGGAACCTGG + Intronic
1136448305 16:30337359-30337381 CAGTGTGTCCTGTGCGAACACGG - Intergenic
1138120593 16:54398033-54398055 CTTTGGATCCAGTGGGAACAGGG + Intergenic
1138590259 16:57995859-57995881 CAGTGGGCCCAGGGGGAAGGGGG - Exonic
1139602953 16:67997923-67997945 CAGTGGGCAGAGTGGAAACAAGG - Intronic
1140032710 16:71351155-71351177 CAGTGGGACGAGTGGGTGCATGG - Intergenic
1141094588 16:81154008-81154030 CAGTTCTCCCAGGGGGAACAGGG + Intergenic
1142047567 16:87935472-87935494 CAGTGTGTCCCGTGCGAACACGG + Intronic
1142121808 16:88390226-88390248 CAGTGGGCCCAGCGGGTCCTGGG + Intergenic
1142161744 16:88561344-88561366 CAGTGGACCCACTGAGACCAAGG - Intergenic
1142808185 17:2382624-2382646 CTGTGTTCCCAGTGGGCACAGGG + Intergenic
1144249476 17:13401178-13401200 CTGTGGACCCAGTAAGAACAAGG + Intergenic
1144493130 17:15731592-15731614 CAGTGGGGTCAGTGGGAACGTGG + Intergenic
1144834840 17:18151365-18151387 CAAGGGGCGCGGTGGGAACAGGG - Intronic
1144907125 17:18645060-18645082 CAGTGGGGTCAGTGGGAACGTGG - Intronic
1145273631 17:21417633-21417655 CTGTGGGCCCAGTGGGGACGGGG - Exonic
1145311826 17:21705075-21705097 CTGTGGGCCCAGTGGGGACGGGG - Intergenic
1146065784 17:29634003-29634025 CAGTGGGCCCAGTATGTGCATGG + Intronic
1146850775 17:36219823-36219845 CAGTGGGCCCAGTGGGTCCCTGG + Intronic
1147162059 17:38574088-38574110 CAGGGAATCCAGTGGGAACAGGG - Intronic
1148793631 17:50187050-50187072 CAGGGGGCCCAATGGGGCCAGGG + Exonic
1148857270 17:50585620-50585642 CAGTGTGCCCAGTGGGCAGGAGG + Intronic
1151028945 17:70712786-70712808 CATCGGGCCCAGTAGCAACATGG + Intergenic
1151324758 17:73372271-73372293 CAGTGTGCCCCATGGGAACCAGG - Intronic
1151562445 17:74877935-74877957 CAGGGGGCACAGAGAGAACAGGG - Exonic
1151606067 17:75136869-75136891 CAGTGGGACCTCTGGGAATAGGG - Intronic
1151642348 17:75405404-75405426 GAGTGGGCCCCGGGGGAACCGGG - Exonic
1152025133 17:77804041-77804063 TAGTGAGCCCAGTGGGAAGCAGG + Intergenic
1152639977 17:81445292-81445314 CAGGGGGCCCACTGGGGTCAGGG + Intronic
1152735006 17:81992926-81992948 CAGTGGACCCAGGGAGACCATGG + Intronic
1155560746 18:27073548-27073570 CAGTGTGACCAGAGGGAAGATGG + Intronic
1155741917 18:29299203-29299225 CAGTGGGTCCAGTGGGTCCCTGG - Intergenic
1157601053 18:48893522-48893544 CACTGGCCCCAGTGGAAACCGGG + Intergenic
1157730699 18:50001676-50001698 CACTGCACCCAGTGGGAACTCGG - Intronic
1158453294 18:57586091-57586113 AAGTGGGCACAGAGGGACCAAGG + Intronic
1160092296 18:75838810-75838832 CAGTGGGTCCAGTGGGTTCCTGG + Intergenic
1160315422 18:77840093-77840115 CAATGGGCCCAGCTGTAACATGG - Intergenic
1163116561 19:15192238-15192260 CAGCGGGCACCGTGGGCACAAGG + Exonic
1163520356 19:17788137-17788159 CCTGGGGCCCAGTGGCAACAGGG + Intronic
1163977862 19:20869484-20869506 CATTCACCCCAGTGGGAACATGG + Intergenic
1164536172 19:29087898-29087920 CTGTGGGGCCAGGGGGAACAAGG + Intergenic
1165907809 19:39204234-39204256 CAGCGGGCGCAGCGGGGACATGG + Exonic
1168116063 19:54221928-54221950 CACGGGGCCCACAGGGAACAGGG + Exonic
1168119045 19:54241676-54241698 CACGGGGCCCACAGGGAACAGGG + Exonic
1168129891 19:54311514-54311536 CACAGGGCCCACAGGGAACAGGG + Exonic
1168133928 19:54338036-54338058 CAGGGGGCCCATGGGGAACAGGG + Exonic
1168181771 19:54666603-54666625 CAGTGGCACTAATGGGAACAGGG + Intronic
1168185499 19:54697392-54697414 CACGGGGCCCACAGGGAACAGGG - Intronic
925383651 2:3446661-3446683 CAGTGGGCACTGCGGGGACATGG + Intronic
925460558 2:4059239-4059261 CAGTGGGTCCAGTGGGTGCCTGG + Intergenic
925913460 2:8587992-8588014 CAGTGGGGCAGGTGGGAACCTGG + Intergenic
926369839 2:12168663-12168685 CAGGGGGCCCAGAGAGAAGAAGG + Intergenic
927578437 2:24219967-24219989 CTGTGGGCTCACTGAGAACAGGG - Intronic
928815755 2:35292821-35292843 CAGTGGCCCCAGTGGGGATTGGG + Intergenic
929444791 2:41993145-41993167 CAGTGGGCCCTCTAGGAGCATGG + Intergenic
929779170 2:44946800-44946822 CCTTGGGGCCAGTGGGAACATGG - Intergenic
929945808 2:46370959-46370981 CCGTGGGCTCCTTGGGAACAAGG + Intronic
931465649 2:62484389-62484411 CAGTAGGTCCAGCAGGAACATGG - Intergenic
931759069 2:65400573-65400595 CAGTCGGCCTAGATGGAACATGG - Intronic
932299577 2:70656700-70656722 AAGGGGGCCCTGTGGAAACATGG - Intronic
932402157 2:71488486-71488508 CAGGGGGCCCAGATGCAACAAGG + Intronic
934685607 2:96319146-96319168 TAGTGGCCCCAGAAGGAACATGG - Intergenic
934711315 2:96516157-96516179 CAGGGGGCCCAGTGAGAAACTGG + Intergenic
934949527 2:98566953-98566975 CAGAAGGCCCAGCAGGAACACGG - Intronic
934991160 2:98922535-98922557 CAGCTGGCCCACTGGGCACAGGG - Intronic
935183770 2:100713561-100713583 CAGTGGGTCCAGTGGGTCCCTGG + Intergenic
935624732 2:105162738-105162760 CTGTGGGCCCAGTAGAAAAAGGG + Intergenic
936578013 2:113671372-113671394 AAGTGAGGCCAGTGAGAACAAGG + Intergenic
937800178 2:126073534-126073556 CAGTGGGTCCAGTGGGTCCCTGG + Intergenic
937852725 2:126649935-126649957 CGGTGGGCCCAGTGGGTCCCCGG - Intergenic
939068911 2:137516643-137516665 CAGTGGCTCCAGTGGGTCCACGG + Intronic
940171479 2:150833932-150833954 CAGTGGGTCCAGTGGGCCCTTGG - Intergenic
940357285 2:152757744-152757766 CAGTGTTCCCAGTGGGAATATGG + Intronic
941330832 2:164175783-164175805 CAGTGGGTCCAGTGGGTTCAGGG - Intergenic
941653995 2:168123981-168124003 CAGTGGATCCAGTGGGGCCAAGG + Intronic
941974837 2:171392084-171392106 CAGTGGCCCCTCTGGGATCAAGG - Exonic
942626405 2:177905710-177905732 GGATGGGCCCAGTGGGAACTAGG + Intronic
943387986 2:187225924-187225946 CAGTGGATCCAGTGGGTTCATGG + Intergenic
943517755 2:188908445-188908467 CAGTGGGCCCATTGGGTCCCCGG - Intergenic
945922149 2:215765983-215766005 CTGAGGGCCCAGTGGGAGCTAGG + Intergenic
948181867 2:235988656-235988678 GAGGGGGCCCAGTGGGTAAATGG + Intronic
948231357 2:236351683-236351705 CGGTGGGCACAGTGAGGACAAGG + Intronic
949042102 2:241854216-241854238 CCATGGGCACAGAGGGAACAGGG - Intronic
1170704506 20:18733169-18733191 CAGTTGGCTCAGTGGGCAGAAGG + Intronic
1170964378 20:21053007-21053029 CAGTGGGCCTACTGGGGGCAGGG - Intergenic
1171459148 20:25288766-25288788 CTTTGTGCCCAGTGGGCACAGGG + Intronic
1172514351 20:35522771-35522793 CACATGGCCCAGTGGGCACAGGG + Intergenic
1173480928 20:43398792-43398814 CAGTGAGCTCACTGGGGACATGG - Intergenic
1174651319 20:52128292-52128314 CAGTGGACCTGATGGGAACAGGG - Intronic
1176383777 21:6127045-6127067 CAGTGGGCCCTGGGGAAACACGG + Intergenic
1177479239 21:21664751-21664773 CAGTGGGGCAATTGGGTACATGG + Intergenic
1177505734 21:22015423-22015445 CAGTGGGTCCAGTGGGTCCCTGG - Intergenic
1179309825 21:40185598-40185620 CAGTGAGCACCGTGGGGACAGGG - Intronic
1179415322 21:41193733-41193755 CAGTGGGTCCAGTGGGTCCTCGG - Intronic
1179508118 21:41855232-41855254 CAGATGGCCCACTGGGAACTGGG + Intronic
1179739693 21:43411193-43411215 CAGTGGGCCCTGGGGAAACACGG - Intergenic
1180085267 21:45505386-45505408 CAGGGGGCCCAGGGGGCCCAGGG - Exonic
1180195697 21:46192241-46192263 CAGTGGGCCAGTTGGGAACAAGG - Intronic
1180491580 22:15853966-15853988 CAGTGTGCCCAGTGGGCATGGGG - Intergenic
1181545325 22:23599199-23599221 AACAGGGCCCAGAGGGAACAAGG - Intergenic
1181628469 22:24137341-24137363 GAGTGAGCCCAGTGGGAAAGGGG - Intronic
1181712228 22:24697767-24697789 CACAGGGCCCGCTGGGAACACGG + Intergenic
1182287691 22:29258037-29258059 CAGTGCCCTCAGTGGGAACCTGG + Intronic
1182623010 22:31628007-31628029 CAGTGAGCCCAGTGAGGGCAGGG + Exonic
1182792664 22:32966084-32966106 CTCTGGGCTCATTGGGAACAGGG - Intronic
1183029437 22:35092389-35092411 CAGTGGGCAAGGTGAGAACAGGG - Intergenic
1183364868 22:37401564-37401586 CAGTGGGCCCTCAGGAAACACGG + Intronic
1183475862 22:38035427-38035449 CAGTGGGGCAAGTGGGAATCAGG + Intronic
1183779912 22:39992815-39992837 CAATCTGCCCAGTGGGAACTGGG - Intergenic
1183980569 22:41537459-41537481 GAGAGGGAGCAGTGGGAACAGGG + Intronic
1184603727 22:45559603-45559625 CAGTGGGTCCAGTGGGTCCCCGG - Intronic
1184803069 22:46774296-46774318 CAGGAGGCCCAGAGGGAACAGGG + Intronic
1185422210 22:50741284-50741306 AAGTGAGGCCAGTGAGAACAAGG - Intronic
949482073 3:4503521-4503543 CAGTGGTCTCAATGGGGACAGGG + Intronic
950405311 3:12800580-12800602 AAGTGGGCCTAGTGGGGACCAGG + Intronic
951506401 3:23449954-23449976 CAGTGGGCCCAGTGGCCAGGAGG - Intronic
951970918 3:28443077-28443099 CAGTGGGTCCAGTGGGTCCCTGG - Intronic
952967085 3:38628131-38628153 TAGTGGGCTCAGTGGGCACTGGG - Intronic
954053961 3:48006458-48006480 CAGTGGGCCCAGTGGGTCCCTGG + Intronic
955129653 3:56152932-56152954 CGGTGGGCCTAGTGGGTAAATGG - Intronic
957247687 3:77734537-77734559 CAGTGGGTCCAGTGGGTCCCCGG - Intergenic
960961845 3:123076414-123076436 CAGTGAGCCCAGTGTGTACTGGG - Intronic
961138421 3:124534358-124534380 CACTGGGGCCAGTGGGGACGTGG + Intronic
961389605 3:126544477-126544499 CAGTGGCCCCAGTGTGGCCAAGG - Intronic
961523068 3:127479140-127479162 AAGTGGCCCCAGTGGAGACAGGG - Intergenic
963355824 3:144208051-144208073 CAGTGGGTCCAGTGGGTCCCTGG - Intergenic
963630157 3:147722016-147722038 CAGTGGGTCCAGTGGGTCCCCGG + Intergenic
963792913 3:149602617-149602639 CAGTGTGGCCAGTGTAAACAAGG - Intronic
967080949 3:186048881-186048903 TACAGGGCCCAGTTGGAACAGGG + Intronic
967631099 3:191743517-191743539 AAGCAGGCCCTGTGGGAACAAGG - Intergenic
968628668 4:1639081-1639103 CAGAGGGCCCTGTGGGACCCTGG + Intronic
968906769 4:3456751-3456773 CAGTGGGTCCAGTGGGTCCCCGG + Intergenic
969715335 4:8865637-8865659 TAGAGGGCCCAGTGGGGAGAGGG + Intronic
969781200 4:9405772-9405794 CAGTGTCCACAGTGGGAATATGG - Intergenic
970089341 4:12387558-12387580 CAGTGGGCCCAGTGGGTCCCTGG - Intergenic
971101181 4:23467636-23467658 CAGTGGGTCCAGTGGGTCCGCGG - Intergenic
971118880 4:23681537-23681559 CAGTGTGTCCAGTGGGTCCAAGG - Intergenic
971979445 4:33734071-33734093 CAGTGGGTCCAGTGGGTCCCTGG - Intergenic
972963792 4:44485885-44485907 GATGGGCCCCAGTGGGAACATGG + Intergenic
974459024 4:62164028-62164050 CAGTGGGCCCAGTGGGTTCTGGG + Intergenic
977430604 4:96927012-96927034 CAGTGGGTCCAGTGGGTCCCTGG + Intergenic
977465836 4:97382178-97382200 CAGTGGGTCCAGTGGGTCCCCGG + Intronic
977490241 4:97701280-97701302 CAGTGGGTCCAGTGGGTCCCTGG - Intronic
978367114 4:107994071-107994093 CAGTGGGCTCCCTGGGAACGGGG + Intronic
979579736 4:122342992-122343014 CAGTAGGTGCAGTGGAAACAGGG - Intronic
979766856 4:124473377-124473399 CAGTGGGTCCAGTGGGTCCCTGG + Intergenic
980602005 4:135038263-135038285 CAGTGGGTCCAGTGGGTCCCTGG + Intergenic
980761451 4:137239056-137239078 CAGTGGGCTGTGTGGGAGCAGGG - Intergenic
981923905 4:150117121-150117143 CAGTGGCCCCAGTGGGGATCAGG + Intronic
982275348 4:153631932-153631954 AAGTGAGTCCAGTGGGTACAGGG - Intronic
982490759 4:156026378-156026400 CAGTAGGCAAAGTGGGAGCAGGG - Intergenic
985209483 4:187576975-187576997 CCTGGGGCCCAGTGGAAACAGGG - Intergenic
987578501 5:19759529-19759551 CAGTGGGCCCAGTGGGTCCCTGG - Intronic
989045379 5:37268809-37268831 CAGTGGGTCCAGTGGGCCCCTGG - Intergenic
991013976 5:61912119-61912141 CAGTGGGTCCAGTGGGTCCCTGG - Intergenic
991300135 5:65121789-65121811 CAGTGGGTCCACTGGGGCCATGG + Intergenic
992940006 5:81751716-81751738 CAGCCGGCCCTCTGGGAACAGGG - Intronic
993704240 5:91151548-91151570 CAGCAGGCCCAATGGAAACAGGG + Intronic
994471329 5:100211770-100211792 CTGTAGGCCCAGTGGGTACAGGG - Intergenic
997250526 5:132385510-132385532 CAGTGGGCACATGGGGCACAAGG - Intronic
997415768 5:133727453-133727475 AGGTGTGCCCAGTGGGAAGATGG - Intergenic
998061214 5:139120122-139120144 CAGTGGGGGCAGTGAGGACATGG + Intronic
999341132 5:150774009-150774031 CTGATGGGCCAGTGGGAACAAGG + Intergenic
999351227 5:150873641-150873663 CAGTGGGTCCAGTGGGTCCCTGG + Intronic
1001367507 5:171158697-171158719 AAGTGGGCCAAGAGGGAGCAAGG - Intronic
1001927844 5:175651889-175651911 CTGTGTGCCAAGTGGGCACATGG - Intergenic
1001961324 5:175881863-175881885 AACTGGGGCCAATGGGAACAAGG - Exonic
1002519854 5:179786373-179786395 CAGTGGTCCCACTGGGAGCTGGG - Intronic
1003696064 6:8407355-8407377 CAGTGGGTCCAGTGGGTCCCCGG - Intergenic
1003984233 6:11419484-11419506 CAGTGGCCCCAGTGGCCCCAAGG + Intergenic
1006105709 6:31715194-31715216 CAAGGGCCCCAGTGGGGACAGGG - Intronic
1007431635 6:41780294-41780316 CAGGGGGACCACTGGGGACAAGG + Intronic
1007766658 6:44164664-44164686 CGGTGGACCCAGTGTGAGCATGG + Intronic
1008693838 6:54010856-54010878 AAGTGGTCCCAGTGGGAATGAGG + Intronic
1010108160 6:72192130-72192152 CAGTGGGTCCAGTGGGTCCCCGG - Intronic
1010552285 6:77237613-77237635 CAGTGGGTCCAGTGGGTCCTGGG + Intergenic
1010818469 6:80387186-80387208 CAGTGGGTCCAGTGGGTTCCTGG + Intergenic
1012001773 6:93663250-93663272 CAGTGGGTCCAGTGGGTTCCTGG + Intergenic
1016829354 6:148418054-148418076 CAGTGGTCCTAGTGGGCACTTGG + Intronic
1016843155 6:148544473-148544495 CACTGGGGCCCATGGGAACAGGG - Exonic
1019223438 6:170492967-170492989 CAAGGGGCCCAGAGGGGACAGGG + Intergenic
1020796324 7:12682250-12682272 CAGGAGGCCCAGTGGTAAAAAGG - Intergenic
1021081172 7:16367223-16367245 TAGGGGGCACAGTGGGCACAGGG - Intronic
1021679564 7:23116287-23116309 TAGTGGTCCCTGTGGGACCACGG - Intronic
1021694371 7:23261952-23261974 CAACTGGCCCAGTGGGAAAAGGG - Intronic
1021952425 7:25788212-25788234 CAGTGGGGCCAGTGGAATCTTGG - Intergenic
1022078729 7:26999110-26999132 CAGTGGGTCCAGTGGGTCCCCGG + Intergenic
1022741210 7:33123265-33123287 CAGTGGACTCAGGGGGCACATGG - Intergenic
1027400163 7:77798689-77798711 CTGTGGGCCCAATGGGAGCACGG - Intergenic
1030170936 7:106602175-106602197 CAGTGGGCTGAGTGTGAACAAGG + Intergenic
1031474608 7:122206552-122206574 CAGTGGGTCCAGTGGGTCCCTGG - Intergenic
1033480384 7:141734412-141734434 CCCTGGGCCTAGTGGGAAAAAGG - Intergenic
1034011800 7:147536521-147536543 CAGAAGTCCCAGTGGGCACAAGG - Intronic
1034264494 7:149774278-149774300 GAGTGGGCGCAGCGGGAACAAGG - Intergenic
1034939533 7:155221261-155221283 CAGTGAGCTCAGGGGGAACCAGG - Intergenic
1035394217 7:158524907-158524929 CAGTGGGCCCTGGGACAACATGG - Intronic
1036278633 8:7379689-7379711 CAGTGTCCACAGTGGGAATATGG - Intronic
1036342889 8:7932179-7932201 CAGTGTCCACAGTGGGAATATGG + Intronic
1036838231 8:12092934-12092956 CAGTGTCCACAGTGGGAATATGG + Intergenic
1036860021 8:12339182-12339204 CAGTGTCCACAGTGGGAATATGG + Intergenic
1038342288 8:26696716-26696738 CAGCAGGCCCAGTAGGTACAAGG - Intergenic
1039292443 8:36111080-36111102 CAGTGGGCCCAGTGGGCGCCTGG - Intergenic
1040697753 8:50022749-50022771 CAGTGGGAACAGAGGCAACATGG - Intronic
1042131889 8:65595407-65595429 TAGTTGGCCAAGTGGGAGCAGGG - Intergenic
1042390698 8:68230397-68230419 CAGTGGGACCAGTGTGGCCATGG + Intronic
1042565105 8:70103020-70103042 CAGTGGGCCCAGTGGTTCCATGG - Intergenic
1044487310 8:92768339-92768361 CAGTGGGTCCAGTGGGTCCCTGG - Intergenic
1044633583 8:94300996-94301018 CAGTGGGTCCAGTGGGTCCCTGG - Intergenic
1044760978 8:95517244-95517266 CAGAGAGCCCAGTGTGAAAATGG + Intergenic
1044923411 8:97188839-97188861 CAGAGGGCACAGTGGGTAGAGGG - Intergenic
1045809736 8:106207321-106207343 AAGTGGCCAAAGTGGGAACATGG - Intergenic
1046860959 8:119091198-119091220 GACTGGGCCCATTGGGAAGAAGG + Exonic
1048252314 8:132876947-132876969 CAGATTGCCCAGTGGGAAGAAGG + Intronic
1048418292 8:134251064-134251086 CAGTGTGTCCATTGGGCACAAGG + Intergenic
1048442282 8:134468876-134468898 CACTGGGCCATGTGGGCACAGGG + Intergenic
1048654728 8:136523037-136523059 CAGTGGGTCCAGTGGGTAACCGG + Intergenic
1049747506 8:144269231-144269253 CAGTGGGCACAGAGAGAAGAAGG + Intronic
1049838203 8:144753981-144754003 CAGTGGGGCCACTGGCAACAGGG + Intronic
1049867437 8:144947911-144947933 CAGTGCTCCCAGTGGGCACCCGG - Intronic
1049934173 9:484771-484793 CAGTGGCCCCAGTGAGCACTGGG + Intronic
1052368487 9:27639617-27639639 CAGTGGGTCCAGTGGGTCCCTGG + Intergenic
1052652512 9:31321930-31321952 CAGTGGAGCCAGTGGGAGCCGGG - Intergenic
1052850555 9:33375888-33375910 CACAGGGCTGAGTGGGAACAAGG + Intergenic
1053105475 9:35404567-35404589 CTGTGGCTCCAGTGAGAACAAGG + Exonic
1053157916 9:35792822-35792844 CAGAGGGGCCAGTGCGAACCAGG - Exonic
1053370873 9:37560672-37560694 CAGAGGCCCCAGTGGTAAAACGG - Intronic
1053670005 9:40351201-40351223 CAGTGGCCTCTGTGGGGACATGG + Intergenic
1053919796 9:42977451-42977473 CAGTGGCCTCTGTGGGGACATGG + Intergenic
1054381128 9:64491200-64491222 CAGTGGCCTCTGTGGGGACATGG + Intergenic
1054514608 9:66025096-66025118 CAGTGGCCTCTGTGGGGACATGG - Intergenic
1057453564 9:95187552-95187574 CAGTGGGCTGGGTGGGACCAAGG - Intronic
1057474689 9:95388471-95388493 CAGTGGGCTGGGTGGGACCAAGG + Intergenic
1058544334 9:106043965-106043987 CAGTGGGTCCAGTGGGTCCCTGG - Intergenic
1059520385 9:114935175-114935197 GAGAGGGCCCAGTGAGGACAGGG + Intergenic
1061726300 9:132583767-132583789 CAATGGGCCCAGTGTGATCCGGG + Intronic
1061741326 9:132708496-132708518 CTGTGGTCCTGGTGGGAACATGG - Intergenic
1061927487 9:133813099-133813121 CAACGGGGCCTGTGGGAACAGGG - Intronic
1062426679 9:136509216-136509238 CAGGGAGGCCAGTGGGAACCCGG + Intronic
1190996911 X:55618690-55618712 CAGTGGGTCCAGTGGGTTCCCGG - Intergenic
1192463431 X:71337535-71337557 CAGTGAAAGCAGTGGGAACAGGG - Intergenic
1192807261 X:74521853-74521875 CAGTGGAACCAGTGGGACTAGGG - Intronic
1193053334 X:77124554-77124576 CAGTGGATCCAGTGGGTACCCGG + Intergenic
1194849408 X:98853387-98853409 CAGTGGGTCCAGTGGGTCCCCGG - Intergenic
1195809816 X:108817036-108817058 CAGTGGGTCCAGTGGGTCCCTGG - Intergenic
1197002133 X:121451739-121451761 CAGTGGGTCCAGTGGGTTCCCGG + Intergenic
1198601738 X:138291503-138291525 CAGTGAAGCCAGTGGGAACTGGG + Intergenic
1199490855 X:148399024-148399046 CAGTGGGACCAGTAGGTAGAAGG - Intergenic
1199539859 X:148946845-148946867 AAGTGGGCCCAGTGTAATCACGG - Intronic
1200673887 Y:6127214-6127236 CAGTAGCAGCAGTGGGAACATGG + Intergenic
1201258488 Y:12134115-12134137 CAGAGGGCCCTGTGCAAACAAGG + Intergenic
1201863795 Y:18627816-18627838 AAGTATGCCCAGTGGGAAAAAGG + Intergenic
1201869527 Y:18692562-18692584 AAGTATGCCCAGTGGGAAAAAGG - Intergenic