ID: 1097952434

View in Genome Browser
Species Human (GRCh38)
Location 12:65446818-65446840
Sequence TGCCCAGCAGAATTACAAAA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 254
Summary {0: 1, 1: 0, 2: 0, 3: 21, 4: 232}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1097952431_1097952434 6 Left 1097952431 12:65446789-65446811 CCCAAAATATGTACAAGAGTTGT 0: 1
1: 0
2: 2
3: 63
4: 603
Right 1097952434 12:65446818-65446840 TGCCCAGCAGAATTACAAAAAGG 0: 1
1: 0
2: 0
3: 21
4: 232
1097952430_1097952434 26 Left 1097952430 12:65446769-65446791 CCAATTAAAGAAAGTTGCAGCCC 0: 1
1: 0
2: 1
3: 6
4: 96
Right 1097952434 12:65446818-65446840 TGCCCAGCAGAATTACAAAAAGG 0: 1
1: 0
2: 0
3: 21
4: 232
1097952432_1097952434 5 Left 1097952432 12:65446790-65446812 CCAAAATATGTACAAGAGTTGTT 0: 1
1: 0
2: 1
3: 23
4: 266
Right 1097952434 12:65446818-65446840 TGCCCAGCAGAATTACAAAAAGG 0: 1
1: 0
2: 0
3: 21
4: 232

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1097952434 Original CRISPR TGCCCAGCAGAATTACAAAA AGG Intronic
900919102 1:5659488-5659510 TGACCAGTATACTTACAAAAAGG - Intergenic
904045313 1:27604819-27604841 TGCTCAGCAGAATTCGGAAAAGG - Intergenic
905185730 1:36195397-36195419 TGCCCAAAAGAATTAAAAATAGG - Intergenic
905638208 1:39570151-39570173 TCCCCAGCAGAAAGAGAAAAAGG + Intronic
905866634 1:41380499-41380521 GGCACAGCAGAATTAAAAAGAGG + Intronic
906053334 1:42893211-42893233 TGACCAGATGAATTACAGAAGGG + Intergenic
906997664 1:50814909-50814931 TTCCCATCAGCAGTACAAAAGGG - Intronic
908817715 1:68051077-68051099 TGACGAGTAAAATTACAAAACGG + Intronic
908895869 1:68897676-68897698 TGCAAGGCAGAATGACAAAAAGG + Intergenic
910193517 1:84618760-84618782 TGCCCAGCAGCATGCCCAAAAGG + Intergenic
910215167 1:84836359-84836381 TGCTCAGCAAAATTGCAGAATGG - Intronic
913178747 1:116298798-116298820 TGCCCAACAGATTTCCAAAGTGG + Intergenic
913528690 1:119717011-119717033 TGCACAGAAGAACTACAAAGTGG - Intronic
914936350 1:151984098-151984120 TGACCAGCATCACTACAAAAAGG - Intronic
918870204 1:189962391-189962413 TTCCCAGCTGAATCACTAAATGG - Intergenic
921088115 1:211815548-211815570 TGCAGAGTAGAATTACAAATGGG + Intronic
922341222 1:224656654-224656676 TGGTCAGCAGCATTTCAAAAGGG + Intronic
922979216 1:229811326-229811348 TTGCCAGCAGAAATAAAAAATGG + Intergenic
923219356 1:231879375-231879397 TGCCAAGCAGTTTTACAAAGTGG + Intronic
923489875 1:234475218-234475240 TGCCCTGCAGGAGTACAAGATGG + Intronic
924546220 1:245030251-245030273 TGACCAACAGAATGATAAAAAGG - Intronic
924690352 1:246343531-246343553 TGCCAAGCAGAATTCCAGAAAGG + Intronic
1062822548 10:545680-545702 TACCCAGCAGACTGACAAAATGG + Intronic
1063500667 10:6550819-6550841 TTCCCAGCAAAAGTGCAAAAAGG + Intronic
1064093256 10:12403283-12403305 TGCCCTGCAGAACTGCAGAATGG + Intronic
1065320651 10:24506005-24506027 TGCCAAGCAGAAATAATAAACGG + Intronic
1065439232 10:25732657-25732679 TACCCAGCCCAATTAAAAAATGG - Intergenic
1065495635 10:26324894-26324916 TGCCCAGATGAATTTCAGAAGGG - Intergenic
1065672414 10:28134732-28134754 ATCACAGCAGAAATACAAAATGG + Intronic
1068517570 10:58043457-58043479 TGCGCAGGAAAATTACAAAAAGG - Intergenic
1068586308 10:58803182-58803204 TGCCCAGCAAAACTCCGAAAGGG + Exonic
1068962425 10:62879153-62879175 TGCCCATGAGAATTAGAAGAAGG - Intronic
1070574363 10:77666395-77666417 AGCCTAGCAGCATTCCAAAAAGG + Intergenic
1071855343 10:89618647-89618669 TGCCCAGCTCAAGTATAAAATGG - Intronic
1072477758 10:95779346-95779368 AGCCAAGCAGAATTTCACAAAGG - Intronic
1072514191 10:96161929-96161951 TGCCCAACAGAGTTTTAAAATGG + Exonic
1072840006 10:98762158-98762180 TGCACAGAAGAATTGAAAAATGG + Intronic
1073951410 10:108813703-108813725 TGCCCAGCCGGACTACAGAATGG + Intergenic
1075343732 10:121667223-121667245 TGCACAGCTGACTTACAGAAGGG + Intergenic
1075585667 10:123656390-123656412 TCCCCAGCAGACTTACAAGTAGG + Intergenic
1076137874 10:128057305-128057327 TGCCCATCAGGCTAACAAAATGG + Intronic
1076348479 10:129797167-129797189 AGCCCAGCAGGAAGACAAAAGGG - Intergenic
1077623220 11:3746601-3746623 TCCACAGAAGAATTAAAAAAAGG + Intronic
1080145382 11:28976855-28976877 TGCCCAGGATAAATACAAGAAGG - Intergenic
1082053532 11:47793429-47793451 TTCCCAGCAACAGTACAAAAGGG - Intronic
1085886079 11:80523745-80523767 TGCCCTGCACAATCACCAAAGGG - Intergenic
1086313363 11:85561443-85561465 TTCCTACCAGTATTACAAAAGGG + Intronic
1088145843 11:106676599-106676621 TGCCAAGCTGAATTACAGAAGGG + Intronic
1089843432 11:121439172-121439194 TGGCCAGCAAAAGTATAAAATGG - Intergenic
1090143401 11:124291115-124291137 TTCCACGCAGAATTATAAAAAGG - Intergenic
1090499715 11:127249520-127249542 TGCCCAGCAGCATTGCTGAAAGG - Intergenic
1090539486 11:127685153-127685175 GGTCCAGTAGAATTGCAAAATGG - Intergenic
1092932981 12:13334695-13334717 TGCCCACCAGAATTATAAACAGG + Intergenic
1093215274 12:16354599-16354621 TGCTTAGCAGAATGATAAAAAGG - Intronic
1094170499 12:27486253-27486275 TGCCCAGCAGAGTGCCAAAGAGG - Intronic
1095121790 12:38427586-38427608 TGCCCAGCAGAACTCAAAACAGG - Intergenic
1095656779 12:44679394-44679416 TGCACAGTAGAATTACCAAGCGG + Intronic
1097952434 12:65446818-65446840 TGCCCAGCAGAATTACAAAAAGG + Intronic
1099843549 12:87998814-87998836 TGCTCAGCTGATTTTCAAAAAGG + Intronic
1099847926 12:88052946-88052968 TCCCCAGCAGAAGTCCAACAAGG - Intronic
1101446488 12:104740475-104740497 TGTCCAGCAGCACAACAAAAAGG + Intronic
1103343686 12:120235270-120235292 AGCCCAGCAGAGTGCCAAAAAGG + Intronic
1107319605 13:39171465-39171487 TGCCCAGGAGAAATAAAGAAAGG - Intergenic
1108129701 13:47284948-47284970 TGCACAGGAGAAATACAAAAGGG + Intergenic
1108781458 13:53841166-53841188 TGTTTGGCAGAATTACAAAATGG - Intergenic
1109487544 13:63047122-63047144 TGCCCAGCAGTATCACCAAGGGG - Intergenic
1109976733 13:69845404-69845426 TGTACAGCAGAATGACAAAGTGG - Intronic
1110420364 13:75300966-75300988 AGCCCAGCGGAATTAAAAAGGGG - Intronic
1112579540 13:100666427-100666449 TGCTCAGCAGAACCACGAAATGG + Intronic
1113113880 13:106854226-106854248 TGCCCAGCAGAATGGCAATAGGG + Intergenic
1114291245 14:21290157-21290179 TGCCCAGGAGAAATAAAAACAGG - Intronic
1114464250 14:22909843-22909865 TTCCCAGGAGAGTTACAAATTGG + Intronic
1115229555 14:31145296-31145318 TGCCCTTCAGAATTAAAAGATGG + Intronic
1118931956 14:70251034-70251056 TGCCCAGGAGAATAAAGAAAAGG - Intergenic
1119791109 14:77350892-77350914 TGCTCTGGAGAATTAGAAAAGGG + Intronic
1119919379 14:78432196-78432218 TGCCCTGCAGAATTTCCAGATGG + Intronic
1122564728 14:102644792-102644814 TGCCCTGCTGAATTTCAGAATGG - Intronic
1202831923 14_GL000009v2_random:43682-43704 TTCCCAGCAGCATTAGATAAGGG + Intergenic
1125431886 15:39603647-39603669 TGCCCAAAAGAATGACAAGATGG + Intronic
1125785597 15:42314285-42314307 TTCTCAGCAGAATTTCCAAAGGG + Intronic
1126333036 15:47554595-47554617 TGAGCAGCAGGATGACAAAATGG - Intronic
1126464222 15:48946303-48946325 TACCCAGCTGACTTCCAAAAAGG - Intronic
1126839512 15:52703443-52703465 TGCCCATCAGTTTGACAAAATGG + Intronic
1128918567 15:71590244-71590266 TTCACAGCAGAATTTCAGAATGG + Intronic
1129947729 15:79555531-79555553 TACCCAGAAGAATTAAAAACAGG - Intergenic
1130447420 15:84016088-84016110 TATTCAGCAGAATTCCAAAAGGG - Intronic
1131369933 15:91872017-91872039 TGCTTTTCAGAATTACAAAATGG + Intronic
1131661282 15:94520466-94520488 TTCCCAGTAGGATTACAAAGAGG + Intergenic
1134889562 16:17827711-17827733 TGCACAGAATAATTAGAAAAGGG + Intergenic
1135660801 16:24294804-24294826 TGTCTAGCAAAATTAGAAAAAGG + Intronic
1135692390 16:24551623-24551645 AGCCCAGCATAAAAACAAAAAGG + Intronic
1135693748 16:24567912-24567934 TTCACAACAGAATTACAAACGGG + Intronic
1138548250 16:57732334-57732356 TGCCAAGCAGTTTTCCAAAATGG - Intergenic
1138869205 16:60860806-60860828 TGCCCAGGAGACATACAAATTGG + Intergenic
1143745663 17:8992193-8992215 GGCCCAGCAGAATTGGATAATGG + Intergenic
1144081244 17:11766254-11766276 AGCAAAGCAGAAATACAAAATGG + Intronic
1144708086 17:17383252-17383274 TGCCCAGAAGAATTAAAGACAGG - Intergenic
1146368932 17:32252156-32252178 TGTTCAGCATAATTCCAAAATGG - Intronic
1150590839 17:66560813-66560835 TGCCCAGCAGAATGACATCCAGG - Intronic
1155767241 18:29651107-29651129 TTCCCAGAAGATTTGCAAAATGG - Intergenic
1156592556 18:38507949-38507971 TGGCCTGCAGCACTACAAAAAGG - Intergenic
1156599391 18:38586845-38586867 TGCACAGCAAAATGAGAAAAAGG + Intergenic
1157208134 18:45717913-45717935 TCCCCAGCAGCATGACACAATGG - Intergenic
1159003746 18:62994824-62994846 TGCCCAACGAAATTTCAAAAAGG - Intergenic
1161955500 19:7492282-7492304 TCCCCACCAGCATTACACAAAGG + Intronic
1162863824 19:13528634-13528656 TGTCCAACAGAAATACAACAAGG - Intronic
1162967057 19:14161016-14161038 TGGCCAGCTGAAGTGCAAAAAGG - Intronic
1163721172 19:18898916-18898938 TGCCCACCCGAACAACAAAAAGG - Intergenic
1164107325 19:22119725-22119747 TGCACAACAGAATTTCAGAATGG + Intergenic
1166364875 19:42273211-42273233 CGCCCAGCAGAAGTACAAGAAGG + Intronic
1202640759 1_KI270706v1_random:84070-84092 TTCCCAGCAGCATTAGATAAGGG - Intergenic
926680260 2:15657759-15657781 TCCTCAGCAGATTTACAACAAGG - Intergenic
928134291 2:28676620-28676642 TCCCCAGCAGTATTACACATAGG - Intergenic
928415566 2:31088831-31088853 TGCCCATGAGAATAACAAGAGGG + Intronic
928644313 2:33335688-33335710 TGCCCAAAAGAATTTTAAAATGG - Intronic
929036107 2:37693566-37693588 TGCCCAGCAAAATAGAAAAACGG + Intronic
931350962 2:61488660-61488682 TTCCAAGCTGAATTACAAAGGGG + Exonic
931923257 2:67043808-67043830 TTCCTTGCAGAAGTACAAAATGG - Intergenic
934063389 2:88317861-88317883 TGGCCATCAGAAGTCCAAAATGG - Intergenic
935593223 2:104859864-104859886 TGCCCAGCAAATTTACAACCTGG + Exonic
935720883 2:105978176-105978198 TCCTCAGCAGAAATCCAAAATGG + Intergenic
936902287 2:117495237-117495259 TGCTCAGCAGAATCATAAAAGGG + Intergenic
937174766 2:119918677-119918699 TGCCCAACAGTTTTCCAAAATGG - Intronic
937699576 2:124848764-124848786 TGACCAACAGATCTACAAAATGG - Intronic
939424721 2:142020105-142020127 TCCCCATCAAAATTGCAAAAGGG + Intronic
943373966 2:187052770-187052792 TACCCAGAAGAAATACTAAAAGG - Intergenic
943582590 2:189702222-189702244 TGCCCTGGAGTATTTCAAAATGG + Intronic
944932418 2:204533543-204533565 TGCCCTGCAGAATTACTCAAAGG - Intergenic
946545565 2:220738571-220738593 TGCCAAACGGAATTACAAAGTGG + Intergenic
946878155 2:224150790-224150812 TGTCCATCATAATTACATAAGGG + Intergenic
947299725 2:228675655-228675677 TGTCCAGAAGACTTAGAAAAAGG - Intergenic
947415224 2:229888578-229888600 TGTCCATCAGATTTAGAAAATGG + Intronic
948564817 2:238878055-238878077 TGCGGAGCATAATTCCAAAAAGG + Intronic
1169397399 20:5244754-5244776 TGCCAAGAAGAATTCCAATAAGG + Intergenic
1170003861 20:11645354-11645376 TGCACAGGAGAATTTGAAAAAGG + Intergenic
1172297691 20:33825000-33825022 TCCCCAGCAGAACAACAAAAGGG - Intronic
1173828762 20:46064504-46064526 TCTCCAGCACACTTACAAAAAGG + Intronic
1174196790 20:48777987-48778009 TGGCCAGGAGTAGTACAAAAGGG + Intronic
1174981139 20:55396563-55396585 TGCCCAGCTGAATTATACCACGG - Intergenic
1178755421 21:35345000-35345022 TGGCAAGCAGAATTTCAATACGG - Intronic
1179392086 21:41003274-41003296 TGCCCTTCAGAATTACCCAAGGG + Intergenic
1179940286 21:44635005-44635027 TACCCAACAGAATTAAAAAGAGG + Intronic
1180131230 21:45828533-45828555 TGCCCAGCAGACTTTCAGCAGGG - Intronic
1180361191 22:11897792-11897814 TTCCCAGCAGCATTAGATAAGGG + Intergenic
1182147748 22:28007247-28007269 TTCCCAGCAGCATCACAGAAAGG - Intronic
1185218651 22:49617808-49617830 AGCCTAGCAGAATGACAAACCGG - Intronic
950896434 3:16455871-16455893 TGCCAAGAAGAAATACAAATTGG + Intronic
955610657 3:60753378-60753400 TGTCCAGAACAATCACAAAAAGG + Intronic
955904048 3:63788332-63788354 AGACCAGCAGAATAACATAATGG - Intergenic
956055166 3:65290952-65290974 TTCCCAGCAGACTTACTGAATGG - Intergenic
956070985 3:65451275-65451297 TTCCCAGAATAATTACAAAAGGG + Intronic
956481789 3:69680469-69680491 TGCCCAAAAGAATTAAAAACAGG + Intergenic
959135296 3:102411264-102411286 TGCCCAGCAAAATTAGCAGATGG + Intronic
959840974 3:110974095-110974117 TTTCCAGCAAAATTACAAGAAGG - Intergenic
961484361 3:127206848-127206870 AGCCCAGCAGAAGGACAACAGGG - Intergenic
965374365 3:167904120-167904142 GGCCCATCAGAATTAAAAAAAGG + Intergenic
965815735 3:172634738-172634760 TGCACACTAGAATTACAAAATGG - Intronic
966595298 3:181720105-181720127 TGCCCAGCAGAATTAGGGAAGGG + Intergenic
974569098 4:63620738-63620760 TGACCAGAAGGATGACAAAATGG - Intergenic
975365058 4:73519501-73519523 TGCCCACCAGAACTGCTAAAAGG - Intergenic
975430096 4:74279492-74279514 TTCCCAGGAAAATTACAAAATGG - Intronic
975823771 4:78298737-78298759 TGCACAGCAGATTTTTAAAATGG - Intronic
976636985 4:87296018-87296040 TGGCCAGCAGAATTCTAAGATGG - Intergenic
978339790 4:107710091-107710113 TCCTCAGCAGAATTATAGAAAGG - Intronic
981417924 4:144514915-144514937 TTCTCAGCAAAATTCCAAAATGG - Intergenic
982958804 4:161808877-161808899 TGGCCAGCAAGCTTACAAAAAGG + Intronic
983365334 4:166779773-166779795 TTCCAAGCAGAATGACACAAAGG + Intronic
983515606 4:168653325-168653347 TGCCCAAAGGAATTGCAAAAAGG + Intronic
984143028 4:176026228-176026250 TGCCCAAAAGAATTAAAAACAGG + Intergenic
1202768128 4_GL000008v2_random:169925-169947 TTCCCAGCAGCATTAGATAAAGG - Intergenic
986682101 5:10243186-10243208 TGGCCAGCAGATTTTCAATATGG - Intronic
987631894 5:20484155-20484177 TGTCCAGCAGATATATAAAAAGG + Intronic
988067747 5:26243493-26243515 TGGACAGTAGAATTACTAAATGG + Intergenic
992557160 5:77915339-77915361 TGCCCAGCAGAGCTACAAGCAGG + Intergenic
992938724 5:81739877-81739899 TCCCCAGCAGAATAGCAGAATGG - Intronic
995170023 5:109097376-109097398 TGATAAGCAGAATTACAAAAGGG + Intronic
995239879 5:109873655-109873677 TTCCCTGCAGGGTTACAAAATGG - Intergenic
995514534 5:112940891-112940913 AGCCCTGCAGACTAACAAAATGG - Intergenic
996525519 5:124475045-124475067 TGCCAAGCAGATTTCGAAAATGG + Intergenic
997424164 5:133791843-133791865 TGCCCAGCAGAATGGGAAGATGG - Intergenic
998431468 5:142074156-142074178 TGTCCAGCAGATTTCAAAAATGG - Intergenic
999126064 5:149246955-149246977 TACCCAGAAGAATTAAAAACAGG + Intronic
1000689847 5:164303603-164303625 TACCCAGTAGAAAAACAAAAAGG + Intergenic
1004125489 6:12868900-12868922 TTCCAAGCAGAATTCCAAAGGGG + Intronic
1004409276 6:15365506-15365528 TGCCCAGCAGATTTTTATAAAGG + Intronic
1005197969 6:23310892-23310914 TGCCCAGCAGATATAAAACAGGG - Intergenic
1005719628 6:28588307-28588329 TGCCTTGCAGAATGAGAAAAAGG - Intronic
1006398344 6:33801588-33801610 TGCCTATTAGAATGACAAAAGGG + Intronic
1010028946 6:71252649-71252671 TACCCAGCAGAAGTAAAAACAGG + Intergenic
1010077938 6:71822804-71822826 GGCTCAGCAGAATGATAAAATGG - Intergenic
1013389923 6:109674649-109674671 TGCTCATCAAAATTACTAAATGG - Intronic
1013690589 6:112637504-112637526 TTCTAAGCAGAATTCCAAAATGG + Intergenic
1013875011 6:114814654-114814676 TGTCCAGAAGAATTAAAAACAGG - Intergenic
1015452732 6:133389756-133389778 TGACCAGCAGGATTAGGAAAGGG - Intronic
1015524772 6:134165713-134165735 TGCCAAGCAGTTTTCCAAAATGG + Intergenic
1017544676 6:155438285-155438307 TGCCCATCCCAAGTACAAAAAGG + Intronic
1019459961 7:1152633-1152655 TGACCAGCATCCTTACAAAAAGG + Intronic
1020750763 7:12138634-12138656 TGCTTAGCAGAGTTAGAAAAGGG + Intergenic
1022273682 7:28835463-28835485 TGCCCAGAAGGAAGACAAAAAGG - Intergenic
1022294028 7:29033105-29033127 TGCCCTTCAGAAATACAAAATGG - Intronic
1022556572 7:31304031-31304053 TGCCCAAAAGAATTAAAAACAGG - Intergenic
1023474938 7:40566901-40566923 TACCCAGATGAATAACAAAAAGG - Intronic
1026997748 7:74629630-74629652 AGACCAGCAGGATTACAACATGG + Intergenic
1027374934 7:77538729-77538751 TGTCCAGCAGAAAAATAAAAAGG - Intronic
1027811511 7:82906417-82906439 TGGCTTGGAGAATTACAAAATGG - Intronic
1028677193 7:93478877-93478899 TTTCCAGGAGAATTACAAAAAGG - Intronic
1030469943 7:109951319-109951341 TGCCCAGAAGAAATAAACAAGGG - Intergenic
1031092937 7:117383853-117383875 AGCCCTGTAGAATTTCAAAAAGG - Intronic
1031785184 7:126021361-126021383 TCCCCAGCTGCATTACACAAAGG + Intergenic
1033769213 7:144529780-144529802 CTCTCAGCAGAATCACAAAAGGG + Intronic
1035038143 7:155908613-155908635 TGACAAGCACAGTTACAAAAAGG - Intergenic
1035061457 7:156072478-156072500 TGTCCAGCAGGATTATAAGATGG + Intergenic
1036466961 8:9007311-9007333 TGCCCAACATAAAAACAAAATGG - Intronic
1036651637 8:10647827-10647849 TGCCCAGAAGAATTGAAAACAGG - Intronic
1038570646 8:28659145-28659167 TTCCCAGTAGAAGTACAAATTGG - Intronic
1041486232 8:58379761-58379783 TGCCCAGGGGAATTACCAGAAGG - Intergenic
1042928926 8:73994462-73994484 TGCCCAGCAGCTTGACCAAATGG - Intronic
1042964487 8:74336063-74336085 GGACAAGCAGAATTAGAAAAAGG + Intronic
1043662626 8:82763644-82763666 TACCCAGCAGACTTACGCAATGG + Intergenic
1046406296 8:113776913-113776935 TCACCAGCAGAATAACAAAGAGG + Intergenic
1046671184 8:117058151-117058173 TGGCCAACAGACATACAAAAAGG - Intronic
1048254939 8:132898498-132898520 TGCCCAGCAGATGTACAGAGGGG - Intronic
1048900246 8:139030530-139030552 TGCCAACCAGTTTTACAAAATGG + Intergenic
1050176252 9:2872217-2872239 TGAACAGCAGAATGACAAAAAGG + Intergenic
1050468340 9:5957333-5957355 TGTGCAGTAGAATTACATAATGG - Intronic
1051177190 9:14372716-14372738 TGCCCTGCTTAATTATAAAATGG + Intronic
1052095196 9:24375213-24375235 TCCCCAGCTGAAAGACAAAATGG - Intergenic
1054361819 9:64129292-64129314 TTCCCAGCAGCATTAGATAAGGG + Intergenic
1056738080 9:89226524-89226546 TCACCAGCAGACTTAGAAAAAGG - Intergenic
1057300413 9:93875997-93876019 TGCCCTGCAAAAGTACAAAAAGG + Intergenic
1058685902 9:107479301-107479323 TGCCCAGCAGACTGAAACAAAGG + Intergenic
1058874658 9:109233468-109233490 TGCCCTGCAGAACTGAAAAAGGG - Intronic
1059054701 9:110967124-110967146 GGACCAGCAGAATTATAAATCGG + Intronic
1059801842 9:117757803-117757825 TGCACAGAAGCATGACAAAAAGG - Intergenic
1059898047 9:118890679-118890701 TTCCCACCAGAAATACACAAGGG - Intergenic
1060506984 9:124205225-124205247 ATCCCAGCAGCATTATAAAATGG + Intergenic
1203706520 Un_KI270742v1:53761-53783 TTCCCAGCAGCATTAGATAAGGG + Intergenic
1203556717 Un_KI270744v1:5723-5745 TTCCCAGCAGCATTAGATAAGGG - Intergenic
1185944489 X:4359569-4359591 TACCCAGAAGAATTAAAAACAGG + Intergenic
1187787105 X:22904161-22904183 TGTGCATCAGAATTACATAAAGG + Intergenic
1192074570 X:67979763-67979785 TGTCCAACAGGATAACAAAATGG - Intergenic
1192076806 X:68007323-68007345 TGCCCAACAGGAGGACAAAATGG - Intergenic
1192500865 X:71651059-71651081 TGCCCTGCTGAAGGACAAAATGG + Intergenic
1192527248 X:71858165-71858187 TGCCCTGCTGAAGGACAAAATGG + Intergenic
1195600212 X:106738466-106738488 TGCCCAGAAAAATTGCAATATGG - Intronic
1196128759 X:112129225-112129247 TTCCCATCAGCAATACAAAAGGG - Intergenic
1197485716 X:127048772-127048794 TGCCCACCATAATTAGAGAAAGG - Intergenic
1199654245 X:149979091-149979113 TTCACAGCAGAAAAACAAAAAGG - Intergenic
1199886447 X:152026045-152026067 TGCCCTGCAGACTGAGAAAATGG + Intergenic
1200851532 Y:7888553-7888575 TGGGCAACAGAAGTACAAAAAGG - Intergenic
1201554819 Y:15256904-15256926 TGCCCCCCAGGATTACAAAGGGG + Intergenic
1201556847 Y:15272139-15272161 TCCCCAGTAGCCTTACAAAATGG + Intergenic
1202304779 Y:23457233-23457255 TGCCCATCAGAAGTACAGACAGG + Intergenic
1202566031 Y:26213358-26213380 TGCCCATCAGAAGTACAGACAGG - Intergenic