ID: 1097953117

View in Genome Browser
Species Human (GRCh38)
Location 12:65454999-65455021
Sequence TTCCCCAACAAAATACCCTG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 154
Summary {0: 1, 1: 0, 2: 1, 3: 11, 4: 141}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1097953117_1097953121 15 Left 1097953117 12:65454999-65455021 CCACAGGGTATTTTGTTGGGGAA 0: 1
1: 0
2: 1
3: 11
4: 141
Right 1097953121 12:65455037-65455059 AGAGGTACAGGAGCATGATCAGG 0: 1
1: 0
2: 0
3: 14
4: 180
1097953117_1097953119 -3 Left 1097953117 12:65454999-65455021 CCACAGGGTATTTTGTTGGGGAA 0: 1
1: 0
2: 1
3: 11
4: 141
Right 1097953119 12:65455019-65455041 GAATCTGTTGGACATATCAGAGG 0: 1
1: 0
2: 0
3: 13
4: 121
1097953117_1097953120 3 Left 1097953117 12:65454999-65455021 CCACAGGGTATTTTGTTGGGGAA 0: 1
1: 0
2: 1
3: 11
4: 141
Right 1097953120 12:65455025-65455047 GTTGGACATATCAGAGGTACAGG 0: 1
1: 0
2: 0
3: 3
4: 71

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1097953117 Original CRISPR TTCCCCAACAAAATACCCTG TGG (reversed) Intronic
901898385 1:12335411-12335433 ATCCCCATCAAAATACCCATAGG - Intronic
903785971 1:25861637-25861659 CTCCCCAACCTAAGACCCTGAGG + Exonic
909261419 1:73494056-73494078 GTCCCCATCAAATTACCCTGTGG + Intergenic
911937334 1:103994468-103994490 TTCTCCAACAAAATCCCTAGTGG + Intergenic
916910743 1:169343102-169343124 CTCCCCAACAAAAAATCGTGTGG - Intronic
921950547 1:220925545-220925567 TTCCATAACAAAATGCCTTGAGG - Intergenic
924251425 1:242137004-242137026 TTCCCCATGAATATAACCTGTGG + Intronic
1063293883 10:4781886-4781908 CTATCCAACAACATACCCTGGGG + Intergenic
1068182109 10:53534277-53534299 TTCCCCCAGAAAAGGCCCTGAGG + Intergenic
1073466164 10:103695681-103695703 ATCTCCAACAAACTCCCCTGGGG + Intronic
1075809252 10:125212720-125212742 TTCCCCAAATAAAGACCCTTGGG + Intergenic
1077758421 11:5062316-5062338 TTACCCAACAAACAACACTGAGG - Intergenic
1079087263 11:17455471-17455493 GCCCCCAACAAAATAACCTAGGG + Intronic
1080630393 11:34069582-34069604 TTACCTCACAAAATACTCTGAGG - Intronic
1081594973 11:44452816-44452838 CTTCCCAACAATATACCCTTGGG + Intergenic
1083142874 11:60736092-60736114 TTCCCAAACAAAATGGCCAGTGG - Intronic
1083201623 11:61124250-61124272 TTCCCCAACACAGTAGCCAGTGG + Intronic
1085225369 11:74915349-74915371 TTCCCCAAGACAATCCCCTGTGG + Intronic
1085379112 11:76096757-76096779 TTCCACAAGCAAATACCCTGAGG + Intronic
1090535234 11:127633639-127633661 TTCCCCAACTAAACAGCTTGGGG + Intergenic
1091329106 11:134716676-134716698 TTCCCCCAGAAAGTAACCTGGGG + Intergenic
1092853727 12:12653709-12653731 TGCCCCAACAAAATGACATGTGG - Intergenic
1093828597 12:23726695-23726717 TTCCCAAACAAAATTACCTGTGG - Intronic
1094223070 12:28015358-28015380 TTGTCCAACAAAATATGCTGAGG - Intergenic
1096919223 12:55066028-55066050 TTCCCAAACAAAATGGTCTGTGG - Intergenic
1097953117 12:65454999-65455021 TTCCCCAACAAAATACCCTGTGG - Intronic
1098016413 12:66109216-66109238 TTCCCCAACAAAATTACATTAGG + Intergenic
1099194930 12:79604379-79604401 TTCCCCAACACAACACCCCCTGG - Intronic
1100783687 12:98056335-98056357 TGCCATAACAAAATACCCTAGGG - Intergenic
1101731317 12:107428707-107428729 TTCCCCAATAGCAAACCCTGGGG - Intronic
1103256621 12:119547233-119547255 TTCTCCACCACACTACCCTGGGG + Intergenic
1108405502 13:50096952-50096974 TTACCAAACAAAATAAACTGGGG - Intronic
1111367239 13:87264758-87264780 TTCTCTAACAAAATAAACTGGGG - Intergenic
1115888143 14:37996749-37996771 TTCCCAAAATCAATACCCTGTGG - Intronic
1116577244 14:46589273-46589295 TTCCCCAATAAAATACTCCTTGG - Intergenic
1116871222 14:50070685-50070707 TTCCCCAAGAAAAAACCTTGAGG + Intergenic
1120237996 14:81915366-81915388 GGCCCCAAGAAAATACACTGGGG + Intergenic
1120471994 14:84937589-84937611 TTCACCAACAAAATGCCAAGGGG + Intergenic
1120809400 14:88787934-88787956 TTCCCAAACAGAATAATCTGAGG + Intronic
1122976700 14:105173840-105173862 GCCCCCAACCAGATACCCTGAGG + Intronic
1128762169 15:70224762-70224784 TTCCTCAACAAGATTCTCTGTGG - Intergenic
1130766837 15:86879360-86879382 TTTCCCAAAAAAAGACCATGTGG - Intronic
1131563188 15:93462130-93462152 ATGCCCAACAGAATGCCCTGTGG - Intergenic
1138235493 16:55378822-55378844 ATCAACAATAAAATACCCTGGGG - Intergenic
1140205193 16:72927754-72927776 CTCCCCCACCAAAAACCCTGAGG + Intronic
1140218203 16:73024930-73024952 CTCCCCAACACAATACCCCTCGG + Intronic
1141004492 16:80339623-80339645 ATCCCCATCAAACTTCCCTGAGG + Intergenic
1141153582 16:81581691-81581713 TTCCTCACCATAACACCCTGAGG + Intronic
1142203856 16:88773519-88773541 TTCCCCTCAAAAAAACCCTGGGG + Intronic
1142892880 17:2956690-2956712 TACCCCAACAAAACACACAGAGG - Intronic
1144419993 17:15087792-15087814 ATCCACATCAGAATACCCTGGGG + Intergenic
1146898274 17:36562037-36562059 GTCCCCTACAAAATTGCCTGGGG + Intronic
1147211693 17:38875670-38875692 TTCCCCCTGAAATTACCCTGGGG + Intronic
1149479386 17:56990106-56990128 TTCCACAACTAAATACCCAAAGG - Intronic
1149483000 17:57018478-57018500 TTAACCAACAAACGACCCTGGGG + Intergenic
1150936737 17:69643872-69643894 TTGGCCAACAAAATCCCTTGGGG + Intergenic
1151645261 17:75426370-75426392 TTCCCTCACTAATTACCCTGTGG - Intergenic
1153522480 18:5965794-5965816 CTCCCCAACTAGATGCCCTGAGG - Intronic
1156208749 18:34914734-34914756 TCCCTCATCAAACTACCCTGGGG - Intergenic
1157795579 18:50571184-50571206 TTCCACAATAATTTACCCTGCGG + Intronic
1165461006 19:35944469-35944491 TTCCCCCACCAAACTCCCTGCGG - Intronic
1168312050 19:55465286-55465308 TGCCTCAATAAAACACCCTGGGG - Intergenic
925203296 2:1986396-1986418 TTCCCAGAGCAAATACCCTGAGG - Intronic
925401157 2:3574403-3574425 TTCCCCAGCAATAGATCCTGCGG + Intergenic
932912889 2:75822698-75822720 ATACCCAACAAAATACCCATGGG + Intergenic
933395350 2:81724065-81724087 TTCCCCAACAGAAAACACTTAGG - Intergenic
933474979 2:82778544-82778566 TTTCAGAACAAATTACCCTGGGG - Intergenic
934024440 2:87988873-87988895 TTCCCCAACAGAAGAACCTCAGG + Intergenic
934081085 2:88468307-88468329 ATCCCCAACAAAAAAGCTTGGGG - Intergenic
935246487 2:101223289-101223311 TTCCCAAACAAAACACACTTGGG - Intronic
935319657 2:101873498-101873520 TTCCCCCAAAAAATGCTCTGCGG - Intronic
935841848 2:107121805-107121827 TTCTCCAATAAAATACAATGAGG - Intergenic
936365129 2:111846902-111846924 TTCCCCAACAGAAGAACCTCAGG + Intronic
937400567 2:121579532-121579554 TTCACCAACAAAACAGCCTTAGG - Intronic
939974129 2:148696654-148696676 CTCCCAAAGAAGATACCCTGAGG + Intronic
942057724 2:172200085-172200107 TTCCCCAACAAAACCCTATGAGG - Intergenic
943664372 2:190593422-190593444 TTAACCAGAAAAATACCCTGGGG - Intergenic
944513057 2:200483604-200483626 TTCCCCGGCAAATTACTCTGTGG - Intergenic
948030866 2:234816331-234816353 TTCCATAACAAAAAACCCAGAGG - Intergenic
1174707164 20:52668759-52668781 TTCCCCTACAAAATAACAGGTGG - Intergenic
1175827060 20:61942114-61942136 TTCCCCAGCGCAATGCCCTGTGG + Intergenic
1177795342 21:25772511-25772533 CTATCCAACAAAATATCCTGGGG - Intergenic
1183782508 22:40007744-40007766 TTCCCCATGTACATACCCTGGGG - Intronic
949272466 3:2234965-2234987 TTCCCCAAAAAAATAAACTCAGG - Intronic
952374956 3:32759208-32759230 ATCCCCAACAAAATAACCAATGG - Intronic
954618827 3:51984294-51984316 TTCCCCAAGTAAATAGACTGAGG + Intronic
955858326 3:63298676-63298698 TTCCCCAAAAACAGACTCTGAGG + Intronic
958025242 3:88041528-88041550 TTCCACACCAATAGACCCTGAGG + Intergenic
959002048 3:100975845-100975867 TTCCCAGACCAAATACCCTCTGG - Intronic
961002607 3:123384182-123384204 GGCCCCAAGAAAAGACCCTGAGG + Intronic
961212490 3:125136500-125136522 TTCCCCAACTAAACTCCTTGAGG + Intronic
964339318 3:155691607-155691629 TTCCACAACAAAATGCACAGGGG + Intronic
965044993 3:163565178-163565200 TTCCCCAAGAAAATAATCTCAGG - Intergenic
965868348 3:173234076-173234098 CTCCCCTAGAAAATACCCTGTGG - Intergenic
967955481 3:194874500-194874522 TTCCCCATCAAAATACTCTGGGG - Intergenic
970425895 4:15946046-15946068 TTTCCCAACTAAGTACCCAGTGG + Intergenic
970659686 4:18269990-18270012 TTCCCCAAAAAAGTAACTTGTGG + Intergenic
971747179 4:30597920-30597942 TTCCCCCACAAAATACACTAGGG - Intergenic
971815867 4:31487997-31488019 TTCTCCAACAAAATTACCAGAGG + Intergenic
972427783 4:38950630-38950652 TTCCTGATCAAGATACCCTGTGG - Intergenic
972466529 4:39362262-39362284 TTCCCTATCAAAATTCCATGTGG + Intronic
974268148 4:59612807-59612829 GTCCCTAACAAAATTCTCTGTGG + Intergenic
974529924 4:63095315-63095337 TTCCCCATAAATATACCCTTAGG - Intergenic
975462142 4:74665836-74665858 TTCCTTAACATAATATCCTGGGG - Intergenic
976689281 4:87851389-87851411 TTCCCCAACTCACTACTCTGTGG + Intergenic
978571030 4:110137731-110137753 TTCCTCAACAACACACTCTGAGG + Intronic
979243716 4:118473996-118474018 TGTTCCAACAAAATAGCCTGAGG - Intergenic
979828400 4:125269101-125269123 GTCCCCAACCAAATATCATGTGG + Intergenic
981249667 4:142584740-142584762 TTCCCCAAAAAACTACCATAGGG - Intronic
985050844 4:185989370-185989392 TTTCACAAGAAAATGCCCTGAGG + Intergenic
985229993 4:187805193-187805215 TTTCCCAAGAACATACACTGGGG + Intergenic
994845088 5:104978725-104978747 ATCCCCCAGAAAATAGCCTGTGG + Intergenic
1003858315 6:10298368-10298390 TTCCTCTACAAAAGACACTGAGG - Intergenic
1005156017 6:22807416-22807438 GTGCCCTACAAAATACCCTAAGG - Intergenic
1011470097 6:87700674-87700696 TTGCCCAACAAAGTATGCTGGGG - Intronic
1013056258 6:106585972-106585994 TTTCTCCACAAAGTACCCTGTGG + Intronic
1015495709 6:133881121-133881143 TGCCATAACAAAATACCGTGTGG - Intergenic
1016671031 6:146708420-146708442 TTCCCAAACAAAAAAAGCTGAGG - Intronic
1016725083 6:147354872-147354894 TTCAACAACAAAATAACTTGAGG - Intronic
1016821005 6:148346190-148346212 ATAACCAACAAAATCCCCTGGGG - Intronic
1017156589 6:151327948-151327970 TTCCCCATCAGAATAACTTGCGG - Intronic
1017271704 6:152514777-152514799 TTCCCCAGAAAACAACCCTGAGG + Intronic
1019025598 6:168960356-168960378 ATCCCCTTCAAAATACTCTGTGG - Intergenic
1022307264 7:29158943-29158965 TTTCCAAATAAGATACCCTGCGG + Intronic
1023139207 7:37084151-37084173 TTCTCAACCAAATTACCCTGAGG + Intronic
1023362544 7:39431285-39431307 TTCCACCACAAAAGCCCCTGTGG - Intronic
1023659219 7:42455927-42455949 TTCCCAAACAAAATCTCATGAGG + Intergenic
1027225854 7:76243409-76243431 TCTCCCAACAAGATACCCTGGGG + Intronic
1028952217 7:96649346-96649368 TTCTCCAAAAAAATATTCTGTGG + Intronic
1029620492 7:101687605-101687627 TTCCCCAGCAAAAGGCCCTGTGG - Intergenic
1029723846 7:102389049-102389071 TTACCCAAGAAAGTTCCCTGAGG + Intronic
1029879655 7:103794410-103794432 TTCCCCAACCAAAGACCCTTTGG + Intronic
1037156116 8:15701221-15701243 TTCCCCCACAAAATTTCCTCAGG + Intronic
1037248864 8:16869064-16869086 TCCCCCCACAAAATAGCCTTGGG - Intergenic
1040557278 8:48491839-48491861 TTCAACAACAACAAACCCTGGGG - Intergenic
1041144597 8:54860657-54860679 TCCCTCAACAAAGAACCCTGGGG - Intergenic
1041905463 8:63028503-63028525 TTCCCCTGCAAAATACTATGGGG + Intronic
1043392303 8:79803616-79803638 GCTCCAAACAAAATACCCTGAGG + Intergenic
1045175660 8:99721980-99722002 TTCCCTAACTTAAAACCCTGTGG + Intronic
1045287191 8:100802405-100802427 ATCCCCAACACAATACCATCAGG + Intergenic
1045546501 8:103133710-103133732 TTCACCTTCAAAATGCCCTGCGG + Intronic
1048571040 8:135656774-135656796 TTCCATAACAAATTACACTGAGG - Intergenic
1051094786 9:13454126-13454148 TTTCCCAACAAAATATTCTCTGG - Intergenic
1052759151 9:32572239-32572261 GTCCTCAAGAAAATACCCAGAGG + Intronic
1058248240 9:102657846-102657868 TTTTGCAACAAAATTCCCTGGGG - Intergenic
1058596555 9:106621766-106621788 TTCCCCAGCCCAACACCCTGGGG + Intergenic
1059920460 9:119154643-119154665 TTCCATAACAAAATACCATTGGG + Intronic
1061247295 9:129407143-129407165 TCCCCCACCAAAACATCCTGTGG - Intergenic
1189739259 X:44101563-44101585 TTCCCCTAAAAAATATTCTGTGG - Intergenic
1191979099 X:66906019-66906041 TTCCCTTACACAATACCGTGGGG - Intergenic
1193267737 X:79493692-79493714 TTCTCCAAGAAAACACACTGAGG + Intergenic
1195220674 X:102743137-102743159 TTCCACAAGGAAATTCCCTGTGG - Intronic
1198297967 X:135305331-135305353 TTCCCTAAAAATAGACCCTGAGG - Intronic
1199787088 X:151115310-151115332 CTCCCCAACAAAAACCCCTGAGG - Intergenic