ID: 1097957322

View in Genome Browser
Species Human (GRCh38)
Location 12:65499492-65499514
Sequence GTGATAAATACAACCACTGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1097957322_1097957329 2 Left 1097957322 12:65499492-65499514 CCATCAGTGGTTGTATTTATCAC No data
Right 1097957329 12:65499517-65499539 GAGGGGAAAGGATCCCAGGGAGG No data
1097957322_1097957330 3 Left 1097957322 12:65499492-65499514 CCATCAGTGGTTGTATTTATCAC No data
Right 1097957330 12:65499518-65499540 AGGGGAAAGGATCCCAGGGAGGG No data
1097957322_1097957326 -10 Left 1097957322 12:65499492-65499514 CCATCAGTGGTTGTATTTATCAC No data
Right 1097957326 12:65499505-65499527 TATTTATCACAAGAGGGGAAAGG No data
1097957322_1097957328 -1 Left 1097957322 12:65499492-65499514 CCATCAGTGGTTGTATTTATCAC No data
Right 1097957328 12:65499514-65499536 CAAGAGGGGAAAGGATCCCAGGG No data
1097957322_1097957327 -2 Left 1097957322 12:65499492-65499514 CCATCAGTGGTTGTATTTATCAC No data
Right 1097957327 12:65499513-65499535 ACAAGAGGGGAAAGGATCCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1097957322 Original CRISPR GTGATAAATACAACCACTGA TGG (reversed) Intergenic
No off target data available for this crispr