ID: 1097966531

View in Genome Browser
Species Human (GRCh38)
Location 12:65587364-65587386
Sequence CGGTCATTATGGAGGGAAGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 80
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 73}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1097966526_1097966531 -1 Left 1097966526 12:65587342-65587364 CCTTGGGCAAGAGGAGCAACGAC 0: 1
1: 0
2: 0
3: 5
4: 121
Right 1097966531 12:65587364-65587386 CGGTCATTATGGAGGGAAGCAGG 0: 1
1: 0
2: 0
3: 6
4: 73

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1097966531 Original CRISPR CGGTCATTATGGAGGGAAGC AGG Intergenic
912698889 1:111861556-111861578 CTGTGTTTACGGAGGGAAGCGGG + Intronic
912962504 1:114208563-114208585 AGGTAATTATGAAGGCAAGCTGG - Intergenic
921358872 1:214312268-214312290 GGATCAGTGTGGAGGGAAGCGGG + Intronic
923946839 1:238897933-238897955 GGGTGAATAAGGAGGGAAGCAGG + Intergenic
1062791211 10:307781-307803 CGGTCCATCTGGAGGGCAGCAGG + Intronic
1062791252 10:307897-307919 CGGTCCCTCTGGAGGGCAGCAGG + Intronic
1062791274 10:307955-307977 CGGTCCATCTGGAGGGCAGCAGG + Intronic
1062791314 10:308071-308093 CGGTCCATCTGGAGGGCAGCAGG + Intronic
1062885223 10:1011064-1011086 CAGTCAGGATGGAGGGATGCAGG - Intronic
1062885246 10:1011150-1011172 CAGTCAGGATGGAGGGATGCAGG - Intronic
1062941997 10:1429121-1429143 TTGTTATCATGGAGGGAAGCCGG + Intronic
1062952646 10:1516241-1516263 GGGTCAGGATGGAGGGAAGGTGG - Intronic
1065037892 10:21659343-21659365 TGGTCATTCTGGAGAGAAGAAGG - Intronic
1076572295 10:131440807-131440829 CGGTCAGCAGGGAGGGAAGAGGG + Intergenic
1076820231 10:132935036-132935058 CGGGCATCATGGAGGGAAGGAGG - Intronic
1077953797 11:6991298-6991320 TGGACATCCTGGAGGGAAGCAGG - Intergenic
1078396958 11:10989608-10989630 CGGACATGATGGAGTGAAGATGG - Intergenic
1081862220 11:46339666-46339688 TGGGCATTTTGGAGGGAACCTGG + Intronic
1082818716 11:57528911-57528933 TGGTCATTCTGGAGGGAGGGAGG + Exonic
1090366620 11:126211829-126211851 CGGTGAGTGTGTAGGGAAGCCGG + Exonic
1097966531 12:65587364-65587386 CGGTCATTATGGAGGGAAGCAGG + Intergenic
1097994496 12:65872741-65872763 CAGTGATAATGGAGGTAAGCTGG - Intronic
1103254776 12:119531679-119531701 CAGTGAGTATGGAAGGAAGCAGG + Intronic
1108774907 13:53753900-53753922 CTGTCATGCTGGAGGGAAGAGGG + Intergenic
1118893714 14:69929172-69929194 CGCCCATTATGGAAGGAAGAGGG + Intronic
1121581703 14:95036935-95036957 CGGGCATCATTAAGGGAAGCTGG + Intergenic
1123412182 15:20069728-20069750 CAGTCATTATTCAGGGAAGAGGG + Intergenic
1123521526 15:21076848-21076870 CAGTCATTATTCAGGGAAGAGGG + Intergenic
1132556554 16:575241-575263 CTGTGATTGTGGAGAGAAGCAGG - Intronic
1133333657 16:4992016-4992038 CGGTCAGTATGGACGGTAGGTGG + Exonic
1140537814 16:75727024-75727046 AGGTTTTTCTGGAGGGAAGCGGG + Intronic
1141081978 16:81060793-81060815 CGGCCAGCATGGAGGGAAGGAGG + Intronic
1141531726 16:84650863-84650885 CTTTAATGATGGAGGGAAGCAGG + Exonic
1142027539 16:87822633-87822655 CGGTCATTAAGGAGTGAAATCGG + Intergenic
1144661167 17:17071906-17071928 TGGGCATTTTGGAGGGAGGCAGG - Intronic
1146299796 17:31678975-31678997 AGGTCATTCTGCTGGGAAGCAGG - Intergenic
1158804280 18:60951008-60951030 AGGTCATTATGGAGGATTGCAGG - Intergenic
1161197513 19:2995074-2995096 GGGACATGGTGGAGGGAAGCGGG + Exonic
1163746841 19:19053915-19053937 GGGGCATGATGGAAGGAAGCGGG + Intronic
1166303472 19:41924828-41924850 CGGTGTTTCTGGAGAGAAGCAGG + Intronic
1166884741 19:45953340-45953362 CGTTAATTATGGAGGGAAGGAGG + Intronic
1167503810 19:49861218-49861240 CGTTTATTGTGGAGGGGAGCTGG + Exonic
928076280 2:28267585-28267607 TGGTCATTATGGATGAAAGGAGG + Intronic
928324908 2:30311510-30311532 GGGTCATTTGGGAGGGCAGCTGG + Intronic
929057912 2:37894454-37894476 CTGTCTTGATGGAGGAAAGCTGG - Intergenic
933307944 2:80625631-80625653 TGTTCATTATGCAGGGAACCAGG - Intronic
934518409 2:95004037-95004059 CTGTTATTATGGAGGGGAACAGG + Intergenic
948253434 2:236549401-236549423 AGGTCATTAAGGAGGAATGCAGG - Intergenic
1172767119 20:37356748-37356770 GGGTCTTTATGGAGGCAATCAGG - Intronic
1173300644 20:41799364-41799386 AGCTGAGTATGGAGGGAAGCTGG + Intergenic
1180288970 22:10779406-10779428 CGGGCATCATGGCGGGAACCTGG + Intergenic
1183953500 22:41365897-41365919 GGGTCATTAGGGAGGGAAGGAGG + Intergenic
954401769 3:50322889-50322911 AGGGCATTCTGGAGGGAAACAGG - Intronic
955673290 3:61424766-61424788 CTGTCATGTTGGAGGGAAACTGG + Intergenic
959672551 3:108995726-108995748 GGGTGAATATGGAGGGAAACGGG + Intronic
961950043 3:130740060-130740082 AGGTCATCATTGGGGGAAGCTGG + Intronic
969497514 4:7534605-7534627 GGGTCCTTGTGGAGGGCAGCAGG + Intronic
973562864 4:52153564-52153586 CTGTCATTATGGATGCCAGCTGG - Intergenic
978507220 4:109471761-109471783 GGATCATCATGCAGGGAAGCTGG - Intronic
979388410 4:120098129-120098151 CAGTCACTTTGGAGGGAAGTGGG + Intergenic
979611228 4:122691020-122691042 CGGTCAGGAAGGTGGGAAGCTGG + Intergenic
996254508 5:121382419-121382441 GGGGCATTATGTAGGGAATCAGG - Intergenic
1000211162 5:159106998-159107020 TGGCCATGAGGGAGGGAAGCTGG - Intergenic
1003038944 6:2669521-2669543 CGGTCCTTATGGTGGGAAGGTGG + Intronic
1005800525 6:29417741-29417763 AGGTCATTAGGGAGTGCAGCAGG - Intronic
1007770245 6:44186321-44186343 TGGTGATAATGGAGGGAAGGCGG - Intergenic
1008104232 6:47425413-47425435 GGGTCAGGATGGAGGGAATCAGG - Intergenic
1012688286 6:102280446-102280468 CAATCATTATGGAAAGAAGCTGG - Intergenic
1014985149 6:127997395-127997417 GAATAATTATGGAGGGAAGCAGG - Intronic
1018695298 6:166386271-166386293 TGGTCAGTTTGGAAGGAAGCTGG + Intergenic
1021835871 7:24674159-24674181 AGGTCATTGTGGAGGGAAGAAGG - Intronic
1025733280 7:64125225-64125247 CTGTCATTATTCAGGGAAGAGGG + Intronic
1025930378 7:65988963-65988985 CAGTCATTATTCAGGGAAGAGGG - Intergenic
1034832819 7:154324520-154324542 CGGTCATGCTGGATGGAACCTGG - Intronic
1039953691 8:42191324-42191346 GGGTCATCAGGGAGGGAGGCAGG - Intronic
1039954671 8:42197738-42197760 TGGTTTTTATGGAGGGAAGATGG - Intronic
1040602435 8:48897741-48897763 CAGTGATTCTGGAGGGAGGCAGG - Intergenic
1041725887 8:61017066-61017088 CTGTCTTTTTGGAGAGAAGCAGG - Intergenic
1198773927 X:140159579-140159601 CTGTAATGATGGAGGGAAGCTGG + Intergenic
1200228130 X:154430657-154430679 CGGCCTTTAGGGAAGGAAGCAGG + Intronic