ID: 1097973241 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 12:65657653-65657675 |
| Sequence | TGGGCTTTATCCTGAGATCC AGG |
| Strand | + |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | ||||
| Summary |
Found 2 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1097973237_1097973241 | 0 | Left | 1097973237 | 12:65657630-65657652 | CCTGTGTGCCAAGCTACAGAGTT | No data | ||
| Right | 1097973241 | 12:65657653-65657675 | TGGGCTTTATCCTGAGATCCAGG | No data | ||||
| 1097973240_1097973241 | -8 | Left | 1097973240 | 12:65657638-65657660 | CCAAGCTACAGAGTTTGGGCTTT | No data | ||
| Right | 1097973241 | 12:65657653-65657675 | TGGGCTTTATCCTGAGATCCAGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1097973241 | Original CRISPR | TGGGCTTTATCCTGAGATCC AGG | Intergenic | ||