ID: 1097973241

View in Genome Browser
Species Human (GRCh38)
Location 12:65657653-65657675
Sequence TGGGCTTTATCCTGAGATCC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1097973237_1097973241 0 Left 1097973237 12:65657630-65657652 CCTGTGTGCCAAGCTACAGAGTT No data
Right 1097973241 12:65657653-65657675 TGGGCTTTATCCTGAGATCCAGG No data
1097973240_1097973241 -8 Left 1097973240 12:65657638-65657660 CCAAGCTACAGAGTTTGGGCTTT No data
Right 1097973241 12:65657653-65657675 TGGGCTTTATCCTGAGATCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1097973241 Original CRISPR TGGGCTTTATCCTGAGATCC AGG Intergenic