ID: 1097974977

View in Genome Browser
Species Human (GRCh38)
Location 12:65675685-65675707
Sequence CTTTTCCATTGTAAGATCAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1097974977_1097974979 6 Left 1097974977 12:65675685-65675707 CCAGTGATCTTACAATGGAAAAG No data
Right 1097974979 12:65675714-65675736 AGTCATTCCTGACCATTCATTGG No data
1097974977_1097974980 7 Left 1097974977 12:65675685-65675707 CCAGTGATCTTACAATGGAAAAG No data
Right 1097974980 12:65675715-65675737 GTCATTCCTGACCATTCATTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1097974977 Original CRISPR CTTTTCCATTGTAAGATCAC TGG (reversed) Intergenic
No off target data available for this crispr