ID: 1097975251

View in Genome Browser
Species Human (GRCh38)
Location 12:65678898-65678920
Sequence AACAAAGACACACAAAGATA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1097975249_1097975251 -7 Left 1097975249 12:65678882-65678904 CCAACACCAGTGTAATAACAAAG No data
Right 1097975251 12:65678898-65678920 AACAAAGACACACAAAGATAAGG No data
1097975248_1097975251 -2 Left 1097975248 12:65678877-65678899 CCGTGCCAACACCAGTGTAATAA No data
Right 1097975251 12:65678898-65678920 AACAAAGACACACAAAGATAAGG No data
1097975247_1097975251 23 Left 1097975247 12:65678852-65678874 CCAAATCTCAGGGATAGCTTGAC No data
Right 1097975251 12:65678898-65678920 AACAAAGACACACAAAGATAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1097975251 Original CRISPR AACAAAGACACACAAAGATA AGG Intergenic
No off target data available for this crispr