ID: 1097981714

View in Genome Browser
Species Human (GRCh38)
Location 12:65742447-65742469
Sequence GCCGGGGGCGCTCCCCGGCG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1097981696_1097981714 17 Left 1097981696 12:65742407-65742429 CCGGCCGGGCCTGCCAAACCCCG No data
Right 1097981714 12:65742447-65742469 GCCGGGGGCGCTCCCCGGCGGGG No data
1097981695_1097981714 20 Left 1097981695 12:65742404-65742426 CCTCCGGCCGGGCCTGCCAAACC No data
Right 1097981714 12:65742447-65742469 GCCGGGGGCGCTCCCCGGCGGGG No data
1097981700_1097981714 4 Left 1097981700 12:65742420-65742442 CCAAACCCCGACGCAGCCTGGAT No data
Right 1097981714 12:65742447-65742469 GCCGGGGGCGCTCCCCGGCGGGG No data
1097981705_1097981714 -3 Left 1097981705 12:65742427-65742449 CCGACGCAGCCTGGATGTGGGCC No data
Right 1097981714 12:65742447-65742469 GCCGGGGGCGCTCCCCGGCGGGG No data
1097981702_1097981714 -1 Left 1097981702 12:65742425-65742447 CCCCGACGCAGCCTGGATGTGGG No data
Right 1097981714 12:65742447-65742469 GCCGGGGGCGCTCCCCGGCGGGG No data
1097981697_1097981714 13 Left 1097981697 12:65742411-65742433 CCGGGCCTGCCAAACCCCGACGC No data
Right 1097981714 12:65742447-65742469 GCCGGGGGCGCTCCCCGGCGGGG No data
1097981698_1097981714 8 Left 1097981698 12:65742416-65742438 CCTGCCAAACCCCGACGCAGCCT No data
Right 1097981714 12:65742447-65742469 GCCGGGGGCGCTCCCCGGCGGGG No data
1097981694_1097981714 23 Left 1097981694 12:65742401-65742423 CCTCCTCCGGCCGGGCCTGCCAA No data
Right 1097981714 12:65742447-65742469 GCCGGGGGCGCTCCCCGGCGGGG No data
1097981704_1097981714 -2 Left 1097981704 12:65742426-65742448 CCCGACGCAGCCTGGATGTGGGC No data
Right 1097981714 12:65742447-65742469 GCCGGGGGCGCTCCCCGGCGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1097981714 Original CRISPR GCCGGGGGCGCTCCCCGGCG GGG Intergenic
No off target data available for this crispr