ID: 1097983024

View in Genome Browser
Species Human (GRCh38)
Location 12:65753633-65753655
Sequence GTGTTTCACCAGAACCTTGT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1097983024_1097983026 25 Left 1097983024 12:65753633-65753655 CCAACAAGGTTCTGGTGAAACAC No data
Right 1097983026 12:65753681-65753703 CAAGAGTTGAATGTATTATCTGG No data
1097983024_1097983027 26 Left 1097983024 12:65753633-65753655 CCAACAAGGTTCTGGTGAAACAC No data
Right 1097983027 12:65753682-65753704 AAGAGTTGAATGTATTATCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1097983024 Original CRISPR GTGTTTCACCAGAACCTTGT TGG (reversed) Intergenic
No off target data available for this crispr