ID: 1097984368

View in Genome Browser
Species Human (GRCh38)
Location 12:65768148-65768170
Sequence TTTTGCCCATGCAAGGTCCA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1097984368_1097984372 28 Left 1097984368 12:65768148-65768170 CCATGGACCTTGCATGGGCAAAA No data
Right 1097984372 12:65768199-65768221 AGTAATGCTATACCAACTCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1097984368 Original CRISPR TTTTGCCCATGCAAGGTCCA TGG (reversed) Intergenic
No off target data available for this crispr