ID: 1097984372

View in Genome Browser
Species Human (GRCh38)
Location 12:65768199-65768221
Sequence AGTAATGCTATACCAACTCC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1097984368_1097984372 28 Left 1097984368 12:65768148-65768170 CCATGGACCTTGCATGGGCAAAA No data
Right 1097984372 12:65768199-65768221 AGTAATGCTATACCAACTCCAGG No data
1097984371_1097984372 21 Left 1097984371 12:65768155-65768177 CCTTGCATGGGCAAAAGCTGGGC No data
Right 1097984372 12:65768199-65768221 AGTAATGCTATACCAACTCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1097984372 Original CRISPR AGTAATGCTATACCAACTCC AGG Intergenic
No off target data available for this crispr