ID: 1097984422

View in Genome Browser
Species Human (GRCh38)
Location 12:65768474-65768496
Sequence CCTTCATATGGCATCTTCTG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1097984422_1097984432 27 Left 1097984422 12:65768474-65768496 CCCCAGAAGATGCCATATGAAGG No data
Right 1097984432 12:65768524-65768546 GAACAGAGAGCCCAGCTATATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1097984422 Original CRISPR CCTTCATATGGCATCTTCTG GGG (reversed) Intergenic
No off target data available for this crispr