ID: 1097995624

View in Genome Browser
Species Human (GRCh38)
Location 12:65884911-65884933
Sequence CACATATAGCACTATGTGCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 203
Summary {0: 1, 1: 0, 2: 4, 3: 12, 4: 186}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1097995624 Original CRISPR CACATATAGCACTATGTGCC AGG (reversed) Intronic
903469558 1:23576408-23576430 TTCATGTAACACTATGTGCCAGG + Intergenic
904539947 1:31226069-31226091 CTTATCAAGCACTATGTGCCAGG - Intronic
909813356 1:79959436-79959458 TACAGCTTGCACTATGTGCCTGG - Intergenic
911276521 1:95866531-95866553 TGCAAATAACACTATGTGCCAGG + Intergenic
911503524 1:98719175-98719197 CACATTTAGCACTATGAGCTAGG - Intronic
912847474 1:113087966-113087988 CACTTATTGGACCATGTGCCAGG - Intronic
914390977 1:147222971-147222993 AACATGTAACACTATGTTCCTGG + Intronic
915320705 1:155054558-155054580 CACACATAGCTCTAAGTGTCTGG - Intronic
916804898 1:168249927-168249949 CTTATCTAGTACTATGTGCCCGG + Exonic
916910593 1:169341577-169341599 CACAGCTTGCACCATGTGCCTGG + Intronic
917428677 1:174942662-174942684 AGCATATAGCACTCAGTGCCTGG + Intronic
917919423 1:179738019-179738041 CAGATTTATCACTCTGTGCCTGG - Intergenic
918065823 1:181101072-181101094 CACATGCAGCTCTATCTGCCTGG - Intergenic
919065981 1:192693381-192693403 GACAGCTTGCACTATGTGCCTGG - Intergenic
920208906 1:204313989-204314011 CCCATATAGCACAATGTGAACGG + Intronic
922097927 1:222458393-222458415 AACAGCTTGCACTATGTGCCTGG + Intergenic
922175800 1:223196204-223196226 CAGCTATAGAACTAGGTGCCTGG - Intergenic
1064693396 10:17940867-17940889 CAAATATAGTACTAGATGCCAGG + Intergenic
1065408179 10:25391320-25391342 AACAGCTAGCACTGTGTGCCTGG + Intronic
1068374839 10:56165023-56165045 AACAGCTTGCACTATGTGCCTGG + Intergenic
1069537571 10:69266088-69266110 CACATTTAGCCCTATGTGGTAGG - Intronic
1069980589 10:72249606-72249628 GACATAAGCCACTATGTGCCTGG + Intergenic
1071883676 10:89926992-89927014 CACATATAGCTCTATTATCCAGG + Intergenic
1072421404 10:95292676-95292698 TACATTAAGTACTATGTGCCAGG - Intergenic
1073942424 10:108713796-108713818 GACAGATTGCACTGTGTGCCTGG + Intergenic
1075329628 10:121564077-121564099 CAAATATTGCCCAATGTGCCGGG + Intronic
1078282288 11:9914874-9914896 CAAATATACCACTATGTTACAGG + Intronic
1079500213 11:21094377-21094399 AACAGCTTGCACTATGTGCCTGG - Intronic
1079655036 11:22976216-22976238 CACAGCTTGCACTGTGTGCCTGG + Intergenic
1082205768 11:49432277-49432299 CTCATATACCACTGTATGCCAGG + Intergenic
1085314706 11:75537497-75537519 CACATGTAGCACGATGTTCCGGG - Intergenic
1086435918 11:86781214-86781236 CTTATATAGCACTATGTAACAGG + Intergenic
1086649327 11:89268220-89268242 CTCATATACCACTGTATGCCAGG - Intronic
1088453473 11:110008132-110008154 CTCATGCAGCACTATGTGCTAGG + Intergenic
1089339214 11:117746249-117746271 CTTATATAGCACTATGTGCCAGG - Intronic
1095448667 12:42306600-42306622 CATATTTAGCACTATGTTTCAGG - Intronic
1095943894 12:47743131-47743153 CTTATGTATCACTATGTGCCGGG + Intronic
1096135841 12:49199888-49199910 CTCATATAACACTGTGTTCCAGG + Intronic
1097522749 12:60689228-60689250 GACAGCTAGCACCATGTGCCTGG - Intergenic
1097995624 12:65884911-65884933 CACATATAGCACTATGTGCCAGG - Intronic
1098836415 12:75429120-75429142 GACAACTTGCACTATGTGCCTGG + Intronic
1100533385 12:95481565-95481587 CATTTATAGAACTTTGTGCCAGG - Intronic
1100541813 12:95564375-95564397 CACTTATATCACTATTTGCTAGG - Intergenic
1100675556 12:96863130-96863152 CAAATATAGACCTATGTGCCAGG - Intronic
1101958532 12:109231094-109231116 GACCTAAAGCACCATGTGCCTGG - Intronic
1102806595 12:115786827-115786849 CACATATGATACCATGTGCCAGG + Intergenic
1104844795 12:131841347-131841369 CACAGATAACACCTTGTGCCTGG - Intronic
1105699483 13:22925804-22925826 TACATATAACACCATGTCCCGGG - Intergenic
1105851188 13:24338344-24338366 TACATATAACACCATGTCCCGGG - Intergenic
1108558187 13:51616848-51616870 AACACTTAGAACTATGTGCCAGG - Intronic
1108877343 13:55062591-55062613 AAAATATAGCACTGTGAGCCGGG + Intergenic
1110489483 13:76086773-76086795 CACAGCTTGCACCATGTGCCTGG - Intergenic
1111081887 13:83321957-83321979 CACAGCTTGCACTGTGTGCCTGG - Intergenic
1111259577 13:85719319-85719341 CACATATTGCACAACGTTCCAGG - Intergenic
1111527570 13:89492242-89492264 AACAGCTTGCACTATGTGCCTGG - Intergenic
1113087814 13:106586053-106586075 GACAGATCGCACCATGTGCCTGG + Intergenic
1114810676 14:25895215-25895237 CTTATAGAGCCCTATGTGCCAGG - Intergenic
1115015246 14:28603346-28603368 CACATTCAGTACTTTGTGCCTGG - Intergenic
1115334591 14:32232137-32232159 CTTATATAGCATTAAGTGCCAGG - Intergenic
1118524237 14:66621900-66621922 CACCGACAGCACTGTGTGCCTGG - Intronic
1123826965 15:24092167-24092189 AACAGCTTGCACTATGTGCCTGG - Intergenic
1123851453 15:24361628-24361650 AACAGCTTGCACTATGTGCCTGG - Intergenic
1123856352 15:24416000-24416022 AACAGCTTGCACTATGTGCCTGG - Intergenic
1128122335 15:65161096-65161118 CACTTATAAAACTATCTGCCAGG - Intronic
1132123387 15:99197513-99197535 CATATTTAGCACTATGTATCAGG + Intronic
1134301685 16:12997226-12997248 CATATATAGCCCTTTGTGCCTGG + Intronic
1136057899 16:27704134-27704156 CATATATACCTCTGTGTGCCAGG - Intronic
1138267332 16:55669053-55669075 CACATATACCCCTATGTGATAGG + Intronic
1143897464 17:10147234-10147256 CACATATTCCACTGTGTGCCTGG + Intronic
1144324753 17:14168363-14168385 GACAGCTTGCACTATGTGCCTGG - Intronic
1145742760 17:27289938-27289960 CATATATAGTACTCTGTGTCAGG + Intergenic
1147713750 17:42489740-42489762 CACATAGACCTCAATGTGCCCGG - Intronic
1149417220 17:56471781-56471803 AACATTTAGCACTTTGTGTCTGG - Intronic
1150350131 17:64437956-64437978 GACAACTTGCACTATGTGCCTGG - Intergenic
1151203371 17:72485731-72485753 ATCATATTCCACTATGTGCCAGG - Intergenic
1152972685 18:179345-179367 CTTATATAGTACTATCTGCCAGG - Intronic
1155818597 18:30347459-30347481 CACATCTTGCACTGTGGGCCTGG - Intergenic
1159261283 18:66016180-66016202 GACAGCTTGCACTATGTGCCTGG - Intergenic
1168477769 19:56689835-56689857 CACAAATACCACTGTGTTCCAGG - Intergenic
925538148 2:4938264-4938286 CACATACAGCTCTATGGACCCGG + Intergenic
925564017 2:5229920-5229942 CACATATATCAAGATGAGCCTGG - Intergenic
927081607 2:19636017-19636039 TACATATAGCACGCTGTGCAGGG - Intergenic
927831522 2:26355111-26355133 CTTATACAGCACTATGTGCCAGG - Intronic
929965451 2:46531279-46531301 AACATATAGCATTTTGTGTCTGG + Intronic
932912233 2:75818121-75818143 AACATCTTGCACTGTGTGCCTGG - Intergenic
936890654 2:117366187-117366209 GACAGCTTGCACTATGTGCCTGG - Intergenic
936952084 2:117987869-117987891 CAGATACAGCAGAATGTGCCTGG - Intronic
937547102 2:123036101-123036123 GACAGCTTGCACTATGTGCCTGG - Intergenic
939050271 2:137299017-137299039 GACAGCTGGCACTATGTGCCTGG + Intronic
939225060 2:139354095-139354117 GACAGATTGCACTATGTGTCTGG + Intergenic
940355597 2:152738299-152738321 GACAGCTTGCACTATGTGCCTGG - Intronic
942118130 2:172749115-172749137 AACAGCTTGCACTATGTGCCTGG - Intronic
942387868 2:175461026-175461048 TACAGATAGCACCGTGTGCCTGG + Intergenic
943421978 2:187676460-187676482 CACGTATATCAGTGTGTGCCAGG - Intergenic
944864437 2:203846923-203846945 AACATTTAGCAATTTGTGCCAGG - Intergenic
945316475 2:208376739-208376761 CACATATAGGAATATGTCCAAGG - Intronic
945333241 2:208562895-208562917 AACAGCTTGCACTATGTGCCTGG - Intronic
1171144153 20:22767051-22767073 CTGACATAGGACTATGTGCCAGG + Intergenic
1173501518 20:43557725-43557747 CACACATAGCAGCATGTGTCTGG - Intronic
1173659924 20:44726167-44726189 CTGATATAGTACCATGTGCCAGG - Intronic
1176884697 21:14241586-14241608 CAAATATACCACAATCTGCCTGG - Intergenic
1177504263 21:22000510-22000532 CACAACTTGCACCATGTGCCTGG - Intergenic
1177881644 21:26702160-26702182 GACATCTTGCACTGTGTGCCTGG - Intergenic
1178337136 21:31753400-31753422 CACTTATACCCCTATGAGCCAGG + Intergenic
1178634900 21:34293728-34293750 AACATCTAGCACAATATGCCTGG + Intergenic
1178718966 21:34991500-34991522 CATAGCTATCACTATGTGCCCGG + Intronic
952793481 3:37218463-37218485 CTCATATTGCACTATTGGCCTGG - Intergenic
954613569 3:51958518-51958540 CAGATATAGCACGAGGTGCAGGG + Intronic
958907977 3:99962648-99962670 CACATATAGCACTGTAGGCCTGG + Intronic
959299385 3:104578555-104578577 GACATTTAGCACTGTGTACCTGG - Intergenic
959818493 3:110704053-110704075 CACAGCTTGCACCATGTGCCTGG - Intergenic
960290239 3:115875488-115875510 CCCAAATATCACTATGTGCTAGG + Intronic
960982920 3:123248904-123248926 CACTTTTAACACTATCTGCCTGG + Intronic
961773649 3:129268447-129268469 CACATTTTGCTCTATCTGCCAGG + Intronic
962499309 3:135973786-135973808 CTAATTTATCACTATGTGCCAGG + Intronic
965025062 3:163291515-163291537 GACAGCTTGCACTATGTGCCTGG - Intergenic
965052050 3:163663481-163663503 AACATCTTGCACTGTGTGCCTGG + Intergenic
968947527 4:3673282-3673304 CACATATAACAGTCTGGGCCAGG - Intergenic
971766106 4:30834103-30834125 AACATATAACACCATGTGCCAGG + Intronic
973094529 4:46179981-46180003 CACAGCTGGCACCATGTGCCTGG + Intergenic
973778031 4:54261391-54261413 CACATTTACATCTATGTGCCAGG + Exonic
974558280 4:63481397-63481419 TTGATATAGCATTATGTGCCAGG - Intergenic
975186561 4:71410245-71410267 CACAGCTTGCACTGTGTGCCTGG + Intronic
975506966 4:75148560-75148582 GACAGATTGCACCATGTGCCTGG - Intergenic
975627038 4:76360423-76360445 GACAGCTTGCACTATGTGCCTGG + Intronic
976743784 4:88383415-88383437 TATATATAGTACCATGTGCCAGG + Intronic
977125163 4:93156175-93156197 CTCATATAACACTGTGTTCCAGG - Intronic
977955138 4:103018057-103018079 CATATATTACACTATGTTCCAGG + Intronic
978591553 4:110329740-110329762 GACATATGGCACTATGTCCTGGG - Intergenic
980153665 4:129079640-129079662 AACAGCTTGCACTATGTGCCTGG - Intronic
980376571 4:131957328-131957350 CACCAACAGCACCATGTGCCTGG - Intergenic
980445696 4:132904490-132904512 CACATGAAGCAATGTGTGCCTGG - Intergenic
982589605 4:157290064-157290086 TACATATAAAATTATGTGCCAGG - Intronic
983085319 4:163436055-163436077 CCTATAAAGCACTATGTACCAGG - Intergenic
983132808 4:164043076-164043098 GACAGCTTGCACTATGTGCCTGG - Intronic
984359515 4:178710719-178710741 CTGAGATATCACTATGTGCCAGG - Intergenic
986933254 5:12853627-12853649 TCCATATAGCACTATGTGGAAGG - Intergenic
987260350 5:16196243-16196265 GACATCTTGCACCATGTGCCTGG - Intergenic
987531209 5:19122338-19122360 CACATACAGCAGTACTTGCCTGG - Intergenic
988327051 5:29783089-29783111 CATAGATAGCACTATGTGTCAGG + Intergenic
989523596 5:42427949-42427971 GACAGTTAGCACCATGTGCCTGG - Intronic
989753455 5:44922914-44922936 CACAGCTTGCACTGTGTGCCTGG + Intergenic
990139400 5:52685491-52685513 GACACATAGAAGTATGTGCCTGG - Intergenic
992400857 5:76410002-76410024 CTTGTTTAGCACTATGTGCCAGG - Intronic
993481566 5:88430766-88430788 AACATGTTGCACTGTGTGCCTGG - Intergenic
993590578 5:89790451-89790473 GACAGCTTGCACTATGTGCCTGG - Intergenic
996026974 5:118657366-118657388 GACATCTTGCACTATGTGCCTGG - Intergenic
996096977 5:119409294-119409316 CTCATTTAGTACCATGTGCCTGG + Intergenic
998653811 5:144152245-144152267 CAAATAGAGCACTATCAGCCTGG + Intergenic
998889398 5:146729997-146730019 GACAGTTTGCACTATGTGCCTGG + Intronic
1003121302 6:3320944-3320966 TACATATGGCACTAGGTGACAGG + Intronic
1003339049 6:5202359-5202381 CACATACTGCACAATGAGCCAGG - Intronic
1005889005 6:30121039-30121061 CACATTAAGAACTTTGTGCCGGG - Intergenic
1005984086 6:30859750-30859772 CACAGCTTGCACTGTGTGCCTGG - Intergenic
1007748090 6:44055471-44055493 AACACATAGCACTATGTGCCAGG - Intergenic
1009618211 6:66038295-66038317 TACAGCTTGCACTATGTGCCTGG - Intergenic
1010248302 6:73682540-73682562 CACAGCTTGCACTGTGTGCCTGG - Intergenic
1010473509 6:76259344-76259366 CTTATGTAACACTATGTGCCAGG + Intergenic
1010517357 6:76789738-76789760 GACAGCTTGCACTATGTGCCTGG - Intergenic
1010544427 6:77132869-77132891 GACATATAGCATTTTGTGTCTGG - Intergenic
1011060322 6:83258639-83258661 TATATCTAGCACTATGTGTCAGG + Intronic
1011436665 6:87345534-87345556 CACATTTACTATTATGTGCCAGG - Intronic
1013599441 6:111690649-111690671 AACATTTATCACTATGTGCTGGG + Intronic
1013872167 6:114778068-114778090 CATATATAGCATTATGTATCTGG + Intergenic
1014940090 6:127428117-127428139 CATTTATATCACTATGTGTCCGG + Intergenic
1020471184 7:8536995-8537017 CACATACAGCTCTATGTTCTGGG + Intronic
1021863899 7:24935705-24935727 CACATGTGTCTCTATGTGCCTGG + Intronic
1024058320 7:45680298-45680320 CCCAGATAGCACAATGTACCTGG - Intronic
1024446521 7:49485645-49485667 CACAATAAACACTATGTGCCAGG - Intergenic
1024736725 7:52312996-52313018 CATATATAGCACCATGCCCCAGG - Intergenic
1027480705 7:78693223-78693245 TACACAAAGCACTATGTGACAGG - Intronic
1030956610 7:115860707-115860729 CACATCTAACACTATGTGCCAGG + Intergenic
1038843983 8:31211989-31212011 ATTATATAGCATTATGTGCCAGG - Intergenic
1042460312 8:69058157-69058179 AATATTTAGCACTTTGTGCCAGG + Intergenic
1045508338 8:102794458-102794480 CACAGAGAGCCCTTTGTGCCTGG + Intergenic
1046951632 8:120025003-120025025 CACATATAGTACACTGTGGCAGG + Intronic
1047723335 8:127662909-127662931 TACTTATAGTACTAAGTGCCAGG - Intergenic
1051619554 9:19036859-19036881 GACAAATTGCACTGTGTGCCTGG + Intronic
1051750523 9:20336699-20336721 CACACTTAGCACACTGTGCCTGG - Intergenic
1054267820 9:62937092-62937114 GACATTTTGCACCATGTGCCTGG + Intergenic
1055885986 9:81063596-81063618 GACAGATAGCAGTATGTGCTGGG + Intergenic
1055958249 9:81794395-81794417 CTCTTATAGCACTCTGTGCTTGG + Intergenic
1056159992 9:83879575-83879597 CTTATCTAGTACTATGTGCCAGG - Intronic
1056360234 9:85850243-85850265 CTTATCTAGTACTATGTGCCAGG + Intergenic
1056695178 9:88842888-88842910 CAAACTTAGCACTGTGTGCCGGG - Intergenic
1058372342 9:104284442-104284464 TATATATACCACTATGTGCCAGG - Intergenic
1058713542 9:107702289-107702311 GAAACATAGCACCATGTGCCAGG + Intergenic
1058966546 9:110044255-110044277 AACAAATAGCTCTATGTCCCTGG - Intronic
1059197447 9:112383628-112383650 CACATATAGCGCTCTGTTTCTGG + Intronic
1059437409 9:114284961-114284983 CACATTCAGCACTATGTGCTGGG + Intronic
1060500625 9:124151186-124151208 CAAATATAGACCTCTGTGCCTGG + Intergenic
1061102691 9:128504230-128504252 AAAATATAGTACTATGTGCGCGG - Intergenic
1188259663 X:28008011-28008033 AACAGCTTGCACTATGTGCCTGG - Intergenic
1188748183 X:33873098-33873120 GACAGCTAGCACTATGTACCTGG - Intergenic
1189314436 X:40044247-40044269 CACATCTAGCACTAAGTTCTTGG - Intergenic
1190797906 X:53760997-53761019 CGCATATAGAAATGTGTGCCTGG + Intergenic
1190917253 X:54820213-54820235 CGCATATAGAAATGTGTGCCTGG - Intergenic
1194905986 X:99576665-99576687 CACAGATTGCACCAAGTGCCTGG + Intergenic
1195444297 X:104933571-104933593 CACTTATAGCATTATGTTTCTGG - Intronic
1196664796 X:118304930-118304952 CACAGCTTGCACTGTGTGCCTGG - Intergenic
1196829081 X:119762249-119762271 CAGATATAAGACTCTGTGCCTGG + Intergenic
1197160950 X:123321290-123321312 CATTTATAGCAATTTGTGCCTGG - Intronic
1199463787 X:148113316-148113338 CTTATATAGCACTATGTGCCAGG + Intergenic