ID: 1097996545

View in Genome Browser
Species Human (GRCh38)
Location 12:65893649-65893671
Sequence CCTGCATTTCAGGGGGTGAA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 431
Summary {0: 1, 1: 0, 2: 1, 3: 25, 4: 404}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1097996536_1097996545 18 Left 1097996536 12:65893608-65893630 CCCTCTTGTGTTTGACTGCAGCC 0: 1
1: 0
2: 1
3: 11
4: 143
Right 1097996545 12:65893649-65893671 CCTGCATTTCAGGGGGTGAATGG 0: 1
1: 0
2: 1
3: 25
4: 404
1097996537_1097996545 17 Left 1097996537 12:65893609-65893631 CCTCTTGTGTTTGACTGCAGCCT 0: 1
1: 0
2: 0
3: 18
4: 158
Right 1097996545 12:65893649-65893671 CCTGCATTTCAGGGGGTGAATGG 0: 1
1: 0
2: 1
3: 25
4: 404
1097996539_1097996545 -3 Left 1097996539 12:65893629-65893651 CCTTCGAGGTTTAGAGCTGTCCT 0: 1
1: 0
2: 0
3: 10
4: 110
Right 1097996545 12:65893649-65893671 CCTGCATTTCAGGGGGTGAATGG 0: 1
1: 0
2: 1
3: 25
4: 404

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1097996545 Original CRISPR CCTGCATTTCAGGGGGTGAA TGG Intronic
900432491 1:2609482-2609504 CGAGCACTTCAGGGGGTGTAGGG - Intronic
900771418 1:4547785-4547807 CCTGGATTGAATGGGGTGAATGG + Intergenic
900934367 1:5755893-5755915 CCTGCATCTCAGGTGGGTAAGGG + Intergenic
900937502 1:5775800-5775822 CGTGCATTTCAGGGCCTGAATGG + Intergenic
901292200 1:8132808-8132830 CCTGGCTTTCAGGCAGTGAAGGG + Intergenic
902350569 1:15850539-15850561 CCTGGATTTTGGGGGGTGAGGGG - Intronic
902619708 1:17643810-17643832 TCTGCATTTCAGATGGGGAATGG + Intronic
903919689 1:26790793-26790815 CCTGAATTCCTGGTGGTGAAAGG + Exonic
904375120 1:30076307-30076329 CCTGAATTTCAGAGGATGTATGG + Intergenic
904506676 1:30961816-30961838 GCTGAATTTTAAGGGGTGAAGGG + Intronic
905644002 1:39611843-39611865 CCTGCATTACCAAGGGTGAAGGG + Intergenic
908885194 1:68780871-68780893 CCTAGATTTCAGAGGGTGTATGG + Intergenic
911335278 1:96573951-96573973 TCTGTATTGCAGGGGATGAAGGG + Intergenic
911780359 1:101868964-101868986 CCTGGATTTCAGAGGATGTATGG + Intronic
912740318 1:112188890-112188912 CATCCATTTCAGGCTGTGAATGG + Intergenic
913668378 1:121071279-121071301 CCTAGATTTCAGGGGATGTATGG - Intergenic
916552832 1:165865396-165865418 CATGCTTTGCAGGGGGTGGAGGG - Intronic
916851805 1:168711726-168711748 CCTGCATCTGGGAGGGTGAAGGG + Intronic
918700749 1:187603795-187603817 CCTGCATTGGAGTGGGTAAAAGG - Intergenic
919011744 1:191974024-191974046 CCTGGATTTCAGGGTATGTATGG - Intergenic
919156792 1:193776001-193776023 CCTACATTTCAGAGGATGTATGG - Intergenic
919522088 1:198600967-198600989 CCTAAATTTCAGGGGATGTATGG - Intergenic
919930501 1:202218252-202218274 CCTGCTATTCAGGGGGTGTTTGG + Intronic
920100156 1:203512275-203512297 CCTACATCTCAGGGGCTGATGGG + Intergenic
920785302 1:209035140-209035162 CCTGGATTTCAGAGGATGTATGG - Intergenic
920800525 1:209183334-209183356 CCTAGATTTCAGGGGATGTATGG + Intergenic
921344497 1:214168267-214168289 CCTGCATTTGAGAAGGGGAAGGG + Intergenic
921466356 1:215492688-215492710 CCTACATTTCAGAGGTTGTATGG + Intergenic
923932840 1:238722144-238722166 CCTAGATTTCAGAGGGTGTATGG + Intergenic
924104104 1:240633579-240633601 TCAGTATTTCAGGGGATGAAAGG - Intergenic
1063037243 10:2298575-2298597 GATGCATTTCAGGCAGTGAAGGG - Intergenic
1064029715 10:11876082-11876104 CAGGCAGTTCATGGGGTGAAAGG - Intergenic
1064450665 10:15439468-15439490 CCTGCATTTCCCGTGGTGAAGGG - Intergenic
1066012242 10:31205445-31205467 CATGCATTTCATGGGGAGCATGG - Intergenic
1066452412 10:35542665-35542687 GCTGCAGTTCAGGGGTTGAATGG - Intronic
1067380464 10:45768433-45768455 CCTGCATTTCACAGGGTGCCTGG - Intronic
1067888166 10:50109084-50109106 CCTGCATTTCACAGGGTGCCTGG - Intronic
1069159788 10:65079549-65079571 CCTAGATTTCAGAGGATGAATGG + Intergenic
1069441078 10:68428570-68428592 CCAGATTTTCAGAGGGTGAATGG + Intronic
1070401107 10:76054310-76054332 CCCTCATTTCAGGGGGTGACTGG + Intronic
1070419070 10:76218428-76218450 CCTGCAATGCAGGGAGTGATTGG + Intronic
1072143347 10:92610304-92610326 ACTGGCTTTCATGGGGTGAAAGG + Intronic
1072358239 10:94633373-94633395 CCTGGATTTCAGAGGATGTATGG + Intergenic
1073713151 10:106068972-106068994 CCTGCCATGCAGGGGGTGAGTGG - Intergenic
1073746819 10:106478612-106478634 CCTGGCTTTCAGGGGCTTAATGG + Intergenic
1074242135 10:111650141-111650163 CCTAGATTTCAGGGGATGTATGG + Intergenic
1074505471 10:114066595-114066617 GATGCATTTCACGGGGAGAAAGG - Intergenic
1076689750 10:132216859-132216881 CCTGCATTTCAGAGGATGTATGG + Intronic
1078152695 11:8772827-8772849 CCTGCCTTTCCAGGGGTGAGTGG + Intronic
1078379103 11:10823604-10823626 CCTCCATTTTGGGGGGAGAATGG + Intronic
1078978609 11:16505912-16505934 CCTGGATTTCAGAGGATGTATGG + Intronic
1079659659 11:23021968-23021990 CCTGGCTTTCATGGGGTGGAGGG + Intergenic
1080946731 11:36982081-36982103 CCTAGATTTCAGAGGATGAATGG - Intergenic
1081966446 11:47173075-47173097 GGTGCATTTCCGGGGGTGGAGGG - Intronic
1083495816 11:63052236-63052258 CCTGGATTTCAGAGGATGTATGG + Intergenic
1085379205 11:76097417-76097439 GCTGGATTTCAGTGAGTGAAAGG - Intronic
1086006768 11:82047302-82047324 CCTAGATTTCAGGGGATGTATGG + Intergenic
1086171326 11:83839881-83839903 CCTGAATTAGAGGGGATGAAGGG - Intronic
1086826738 11:91507868-91507890 CCTGGATTTCAGAGGATGTATGG - Intergenic
1087474624 11:98620465-98620487 CCTAGATTTCAGAGGATGAATGG + Intergenic
1087731111 11:101779581-101779603 CCTGGATTTCAGAGGATGTATGG + Intronic
1087877478 11:103375230-103375252 CCTAGATTTCAGAGGGTGTATGG + Intronic
1090485364 11:127107789-127107811 GCTGCATTGCAGGAGGTGAGTGG + Intergenic
1091638764 12:2218194-2218216 CCTGCATCTCAGGGAGTGAGAGG - Intronic
1092615726 12:10213739-10213761 CTTGCATTACAGGGGGTTAGGGG + Intronic
1093570528 12:20661735-20661757 CCTATATTTCAGAGGGTGTACGG + Intronic
1094798468 12:34002469-34002491 CCTGGATTTCAGAGGATGTATGG - Intergenic
1095919731 12:47517079-47517101 CCTGAATTTCAGAGGATGTATGG - Intergenic
1096566092 12:52480483-52480505 CCTAGATTTCAGAGGGTGTATGG + Intergenic
1097147348 12:56950923-56950945 CCTGAATATCAGGGGATGAGAGG - Intergenic
1097996545 12:65893649-65893671 CCTGCATTTCAGGGGGTGAATGG + Intronic
1099214608 12:79838758-79838780 CCTAGATTTCAGAGGGTGTATGG + Intronic
1099905451 12:88764680-88764702 GCTGCATTTCATTGGGAGAATGG + Intergenic
1100393516 12:94164517-94164539 CATGCATTCCAGGGTGTGAAAGG - Intronic
1101193041 12:102354519-102354541 CCTACATTTCAGAGGGTGTATGG - Intergenic
1102618086 12:114172239-114172261 ACAGCATTTCAGGAGGGGAAGGG + Intergenic
1103941961 12:124506085-124506107 CCTGCTTTGCCTGGGGTGAAGGG - Intronic
1104186129 12:126433586-126433608 TGTGCCTTTCAGAGGGTGAAGGG - Intergenic
1105528900 13:21200536-21200558 CCTAGATTTCAGAGGGTGTATGG - Intergenic
1108186485 13:47893081-47893103 CCTGAATTTAAGAGGGAGAATGG - Intergenic
1108326988 13:49343487-49343509 CCTGCCTCTTAGGGGGTGCAAGG + Intronic
1108345797 13:49545973-49545995 TCTGCATTGCATGGGGTGGAGGG - Intronic
1108410276 13:50138864-50138886 GCTGCATTTTAGGGGGTGAGTGG + Intronic
1108885676 13:55178467-55178489 CCTGGATTTCAGAGGATGTATGG + Intergenic
1109098287 13:58145256-58145278 CCTGGATTTCAGAGGATGTATGG + Intergenic
1109494211 13:63146973-63146995 CCTGGATTTCAGGGGATGTATGG - Intergenic
1109717402 13:66234440-66234462 CCTAGATTTCAGAGGGTGTATGG + Intergenic
1110718316 13:78732846-78732868 CCTGAATTCCAGAGGGAGAAGGG - Intergenic
1111227105 13:85288606-85288628 CCTAGATTTCAGAGGGTGTATGG - Intergenic
1111472048 13:88695777-88695799 CCTAGATTTCAGGGGATGTATGG - Intergenic
1111693939 13:91599703-91599725 CCTCCATTTCAGGGTGGGATTGG + Intronic
1112428985 13:99332891-99332913 CCTGCTTTTCAGAGGGTCTATGG + Intronic
1113212656 13:108001542-108001564 CCTAGATTTCAGAGGATGAATGG + Intergenic
1114367303 14:22043230-22043252 ACTGCAATTCAGTGGGGGAAAGG - Intergenic
1115932135 14:38508787-38508809 CCTGGATTTCAGAGGATGTATGG - Intergenic
1117206764 14:53451454-53451476 ACTGCATTTCAGGGAGAAAAGGG + Intergenic
1117854180 14:60010231-60010253 CCTAGATTTCAGTGGGTGTATGG - Intronic
1119007372 14:70943975-70943997 CCTGGATTTCAGAGGATGTATGG + Intronic
1119226791 14:72950504-72950526 CCTGGATTTCAGTGGAGGAAAGG + Intronic
1119450141 14:74702301-74702323 CCTGGATTTCAGAGGATGTATGG - Intronic
1122198967 14:100110519-100110541 CCTGCAGGGCTGGGGGTGAATGG + Intronic
1126154866 15:45556453-45556475 CCTGGCTTTCAGGAAGTGAAAGG - Intergenic
1126381890 15:48056988-48057010 ACTGCCTTTCAATGGGTGAATGG + Intergenic
1126533248 15:49733233-49733255 CCTAGATTTCAGAGGGTGTATGG - Intergenic
1128305996 15:66599425-66599447 CCTACCTTTTTGGGGGTGAAGGG - Intronic
1128363156 15:66976812-66976834 CCTGAAGGGCAGGGGGTGAAGGG + Intergenic
1128646001 15:69379465-69379487 CCTGCATGTCAGGGGCTGGTGGG - Intronic
1129453616 15:75664282-75664304 CCTTCAAGTCAGTGGGTGAAAGG + Intergenic
1129812781 15:78524207-78524229 CCTGGATTTCAGAGGATGTATGG - Intronic
1131427037 15:92354228-92354250 CCTAGATTTCAGAGGGTGTATGG + Intergenic
1131921452 15:97332899-97332921 CCTGGATTTCAGAGGGTATATGG + Intergenic
1132662808 16:1069136-1069158 CCTGCTTTTCAGTGAGTGGAGGG - Intergenic
1133043075 16:3070942-3070964 CCTAGATTTCAGGGGATGGATGG - Intronic
1133218854 16:4309722-4309744 CCTGCATTCCAGGGCGGGGACGG - Intergenic
1133402966 16:5502265-5502287 TCTCCATTTCATGGGGTGAAAGG - Intergenic
1133804480 16:9114305-9114327 CCAGCCTTTCAGGGGCAGAAGGG + Intronic
1137571211 16:49567587-49567609 AGTGCATTTCAGGGTGGGAATGG - Intronic
1138108326 16:54303742-54303764 CATGACTTTCAGGGGGTGGATGG + Intergenic
1139172765 16:64650821-64650843 CCTGGATTTCAGAGGATGTATGG - Intergenic
1139198121 16:64944698-64944720 CCTGGGTTTCTGGGGGTGACAGG - Exonic
1142250752 16:88990752-88990774 CCTGCCTTTCGGGGGGATAAAGG + Intergenic
1142261890 16:89046780-89046802 CCTCCAGGTCAGGGAGTGAAGGG - Intergenic
1142551985 17:746515-746537 CCTGCGTTCCTGGGGGCGAAAGG - Exonic
1148602030 17:48901480-48901502 CCTGCAAGTCAGGGCCTGAAGGG - Intergenic
1149606132 17:57926400-57926422 CACCTATTTCAGGGGGTGAAGGG - Intronic
1151500982 17:74488706-74488728 CCTGGATTTCAGAGGATGTATGG - Intergenic
1152620252 17:81359890-81359912 GATGCCTTTCAGTGGGTGAATGG - Intergenic
1152723831 17:81935667-81935689 CCTCCATTTCTGGGTGGGAAGGG - Intronic
1152750604 17:82060818-82060840 CCGGCCTTGCAGGGGGTGAGGGG - Intronic
1152989415 18:349390-349412 CCTGGATTTCAGAGGATGTATGG + Intronic
1153153766 18:2126111-2126133 CCTTCATTTCAGAGGGTCTAGGG - Intergenic
1153549548 18:6247309-6247331 CCTGCTTTGCAGGCGGTGTATGG - Intronic
1154508055 18:15061692-15061714 CCTGCATTGCAGTAGCTGAAGGG + Intergenic
1155108169 18:22687860-22687882 CCTAGATTTCAGAGGATGAATGG - Intergenic
1155274604 18:24174119-24174141 CATGCCCTTCAGTGGGTGAATGG - Intronic
1155939998 18:31793499-31793521 CTTGCATCTCAAAGGGTGAAAGG - Intergenic
1156265901 18:35488352-35488374 CCTACATTTCAGAGGATGTATGG - Intronic
1156607208 18:38680337-38680359 CCTAGATTTCAGGGGATGTAAGG - Intergenic
1156615006 18:38772655-38772677 CCTACATTTCAGAGGATGTATGG - Intergenic
1156904449 18:42336901-42336923 CCTAGATTTCAGAGGGTGTATGG - Intergenic
1157414150 18:47488350-47488372 CCTGACTTTCAGGGAGTGACTGG - Intergenic
1157608214 18:48939527-48939549 CCTGCATTTCAGGAGAGGACCGG + Intronic
1158857415 18:61556770-61556792 CCTGCCTTTCATGGGAAGAAAGG - Intergenic
1159215574 18:65387030-65387052 CCTACATTTCAGAGGATGTATGG + Intergenic
1160060800 18:75527203-75527225 CCTCCTTTTCAGGGGGTGCAGGG - Intergenic
1161280709 19:3444024-3444046 CCGGCATTTCAGTGGGAGATGGG + Intronic
1161662328 19:5554524-5554546 CCTGCAAATCACAGGGTGAAAGG + Intergenic
1162306776 19:9879516-9879538 CATTCATGGCAGGGGGTGAAAGG - Intronic
1165554203 19:36615995-36616017 CCTACATTTCTGGGGGTGTTAGG + Intronic
1168044207 19:53782419-53782441 CCAGCATTTTGGGAGGTGAAGGG - Intergenic
1168189963 19:54730821-54730843 CCTGCCCATCAGTGGGTGAATGG - Intronic
1168194248 19:54761742-54761764 CCTGCCCATCAGTGGGTGAATGG - Intronic
1168196294 19:54776474-54776496 CCTGCCCATCAGTGGGTGAATGG - Intronic
1168202080 19:54822871-54822893 CCTGCCCATCAGTGGGTGAATGG - Intronic
1168206889 19:54856926-54856948 CCTGCCTATCAGTGGGTGAATGG - Intronic
1168296496 19:55379553-55379575 CTTGGATTTCAGGGCGTTAAAGG - Intronic
925817029 2:7763661-7763683 CCTGGATTTCAGAGGATGTATGG - Intergenic
925902198 2:8516585-8516607 GCTGCATTTCAGGGAGAGATGGG - Intergenic
927181609 2:20450532-20450554 CCAGCATTTAAGTGGGTGAAAGG - Intergenic
928862153 2:35872203-35872225 TCTTCAGTTCAAGGGGTGAAAGG - Intergenic
929382499 2:41369049-41369071 CCTACATTTCAGAGGATGTATGG - Intergenic
930419673 2:51135056-51135078 CCTAGATTTCAGAGGATGAAAGG + Intergenic
930480612 2:51943891-51943913 GCTGCATTTCAGAGGATGTATGG + Intergenic
930623980 2:53675894-53675916 CCTGCATTGCAGGGCATGGAGGG + Intronic
931529657 2:63199620-63199642 CCTACATTTCAGAGGATGTATGG + Intronic
933046190 2:77540042-77540064 CCTGGATTTCAGAGGATGTATGG + Intronic
933813605 2:86048589-86048611 ACTGCATTAAAGGGGCTGAATGG - Intronic
934767553 2:96888422-96888444 CCTGCCTTTCAGGGGGACAGAGG + Intronic
934960489 2:98668458-98668480 CCTAGATTTCAGAGGATGAATGG + Intronic
936289265 2:111207253-111207275 TCTGCATTTCAGTGCTTGAAAGG + Intergenic
936603400 2:113922921-113922943 CCTGCATTTCAGCGATTGAGAGG + Intronic
937259115 2:120574183-120574205 CCTGGAGTTCAGGGGAGGAAAGG - Intergenic
937267056 2:120623293-120623315 CCAGCATTTCAGGAGGCCAAGGG + Intergenic
938329788 2:130441526-130441548 CCTGCATCTCAGAGGGTGGGTGG - Intergenic
938360158 2:130679977-130679999 CCTGCATCTCAGAGGGTGGGTGG + Intergenic
938436561 2:131286684-131286706 CCTGCATCTCAGAGGGTGGGTGG + Intronic
938850026 2:135250750-135250772 CCTGGATTTCAGGAGATGTATGG + Intronic
940311451 2:152283192-152283214 GCTGTATTTCAGGGGCTCAAAGG - Intergenic
940473469 2:154130012-154130034 CCTGCAAGTCAGTGAGTGAAAGG - Intronic
941165493 2:162078926-162078948 CCTAGATTTCAGAGGATGAATGG - Intergenic
941344003 2:164345020-164345042 CCTTTATTTCAGGGAGTGTAGGG + Intergenic
942254112 2:174075242-174075264 CCTGCATTTCATGGGGGGGGGGG + Exonic
942889012 2:180964813-180964835 CCTGCATTTCAGAAGTTGTATGG + Intergenic
943271566 2:185811903-185811925 CCTAGATTTCAGAGGGTGTATGG + Intronic
944711906 2:202342123-202342145 CCAGTATTCCTGGGGGTGAAGGG - Intergenic
944800175 2:203231237-203231259 CCTAGATTTCAGGGGATGTATGG + Intergenic
945172154 2:207008051-207008073 CCTTCCTTTCAGAGGATGAAGGG + Intergenic
945775644 2:214103291-214103313 CCAACATTTCAGTGGGTGATGGG + Intronic
946580977 2:221128064-221128086 CCTAAATTTCAGAGGGTGTATGG + Intergenic
946937439 2:224736586-224736608 CCTGGATTTCAGAGGATGTATGG + Intergenic
947396695 2:229694206-229694228 CCTACATTTCAGAGGGTGCATGG + Intronic
947597275 2:231421037-231421059 CCCCCTTTTCAGGGGATGAATGG + Intergenic
948177846 2:235958270-235958292 CCTGGATTTCAGGGAGTACAGGG - Intronic
1169489469 20:6058866-6058888 CCTGGAGTTCTGGGGGTAAATGG - Intergenic
1169721462 20:8681997-8682019 CCTGGGTTTCAAGGGGTGAATGG + Intronic
1169857987 20:10124208-10124230 CCTGGATTTCAGAGGATGTATGG - Intergenic
1170837956 20:19901091-19901113 CCTGTATTTCAATGAGTGAACGG + Intronic
1170973309 20:21137257-21137279 CCTGCACTTCAAGGGGAAAAAGG - Intronic
1171230855 20:23483532-23483554 CCTGCATTTACATGGGTGAATGG + Intergenic
1172616254 20:36287061-36287083 CCTGAAATTCAGTGGGGGAAAGG - Intergenic
1173333917 20:42098013-42098035 GCTGCATTGCAGAGGGGGAAGGG + Intronic
1173577681 20:44123583-44123605 CCAGCAGCTCACGGGGTGAAGGG + Intronic
1175638146 20:60602672-60602694 CCTGGAGTGCTGGGGGTGAAGGG + Intergenic
1175824722 20:61930703-61930725 CCGGCTTTTCAAGGGGTGATAGG - Intronic
1175867409 20:62186903-62186925 CCTTTATTTCAGTGTGTGAAAGG + Intronic
1176059638 20:63166854-63166876 CCTTCAGTTCAGGAGGAGAAGGG + Intergenic
1176790024 21:13310107-13310129 CCTGCATTGCAGTAGCTGAAGGG - Intergenic
1177085247 21:16695044-16695066 CCTAGATTTCAGTGGATGAATGG - Intergenic
1177473087 21:21584105-21584127 CCTACATTTCAGAGGATGTATGG + Intergenic
1177478165 21:21651116-21651138 CCTACATTTCAGAGGATGTATGG + Intergenic
1177694553 21:24555042-24555064 CCCACTTTCCAGGGGGTGAACGG - Intergenic
1178154207 21:29832465-29832487 CCTAGATTTCAGAGGGTGTATGG - Intronic
1179907708 21:44432795-44432817 CCTGCATTTCTGGAGCTGAGTGG + Intronic
1179964187 21:44791581-44791603 CCTACATTTCAGAGGATGTAGGG + Intronic
1182327153 22:29522017-29522039 TCTCCATTTGAGGTGGTGAAGGG - Intronic
1183831646 22:40421243-40421265 TCTGCTTTTCACGGGGTGTACGG - Intronic
1184799224 22:46750007-46750029 ACTGCCTTGCAGGGGATGAAGGG + Intergenic
1184799254 22:46750119-46750141 ACTGCCTTGCAGGGGATGAAGGG + Intergenic
949436554 3:4035892-4035914 ACTGCAGTTTAGGGGGTGAGTGG + Intronic
949770352 3:7570866-7570888 CCTGGATTTCAGAGGATGTATGG - Intronic
950484487 3:13265033-13265055 TCTGCTTTCCAGGGGGAGAAGGG - Intergenic
951659418 3:25046107-25046129 CCACCATTTCTGGGGTTGAATGG + Intergenic
952546445 3:34424908-34424930 CCTGCTTTGCAGTGGCTGAATGG + Intergenic
953456546 3:43046959-43046981 CCTGTATTTCAGAGGATGTATGG + Intronic
953575651 3:44111255-44111277 CCTGCAAAGCAGGGGGTGTAAGG - Intergenic
954516940 3:51186855-51186877 CCTGGATTTCAGAGGATGTATGG + Intronic
955465254 3:59230363-59230385 CCTGGATTTCAGAGGATGTATGG - Intergenic
955487558 3:59449846-59449868 CCTTCATTTCAAGGGGAGGAGGG + Intergenic
956807921 3:72835557-72835579 TCTACATTTCAGAGGGTAAATGG + Intronic
957300916 3:78390352-78390374 CCTACATTTCAGAGGATGTATGG + Intergenic
957557522 3:81780783-81780805 CCTACATTTCAGAGGATGTATGG - Intergenic
958463262 3:94426370-94426392 CCTAGATTTCAGAGGGTGTATGG + Intergenic
958650067 3:96927046-96927068 CCTGCATTTCAGAGAATGTATGG - Intronic
959267950 3:104167805-104167827 CCTACATTTCAGAGGATGTATGG - Intergenic
961314992 3:126028480-126028502 CCTGGATTTCAGAGGATGTATGG + Intronic
961787634 3:129357231-129357253 CCTGCTTTGCTGGGGGAGAAAGG + Intergenic
962525182 3:136231853-136231875 CGTGCATTTCAGGAGTTGACAGG + Intergenic
962589331 3:136872899-136872921 CCTGCATTTCAGAAGATGTATGG + Intronic
962815685 3:138995935-138995957 ACTGCAATTCAGTGGGAGAAAGG - Intergenic
963011666 3:140775874-140775896 CCTAGATTTCAGAGGATGAATGG - Intergenic
963922916 3:150923377-150923399 TCTTCATTTCAGTGGGTGATGGG + Intronic
965404862 3:168255881-168255903 CCTGGATTTCAGAGGATGTATGG - Intergenic
966544579 3:181131435-181131457 CCTGCATTTTATGGGCTGAGTGG + Intergenic
967106040 3:186255741-186255763 CCTGCATGTCACTGGGTGCATGG - Intronic
967564660 3:190959543-190959565 CCTGGATTTCAGAGGATGTATGG + Intergenic
967609158 3:191483286-191483308 CCTAGATTTCAGAGGGTGTATGG + Intergenic
967777016 3:193395308-193395330 CCTACATTTCAGAGGATGTATGG - Intergenic
970360946 4:15308365-15308387 CCTGGATTTCAGAGTGTGTATGG - Intergenic
971072837 4:23114065-23114087 CTTGCATTTCAGAGGGGGCAAGG + Intergenic
971900307 4:32650090-32650112 CCTGAATTTCAGAGGATGTATGG - Intergenic
972057849 4:34826713-34826735 CCTGGATTTCAGGAGATGTATGG - Intergenic
972367804 4:38392618-38392640 CCTAGATTTCAGGGGATGTATGG + Intergenic
972744574 4:41920936-41920958 CCTACATTTCAGAGGATGCATGG + Intergenic
974071445 4:57127736-57127758 CCTGGATTTCAGAGGATGTATGG + Intergenic
974145118 4:57937245-57937267 CCTAGATTTCAGAGGATGAATGG + Intergenic
975196898 4:71536252-71536274 CCTCCATTCAAGGGGGTGAGGGG + Intronic
976269520 4:83217164-83217186 CACGCCTTTCAGGGGGAGAAAGG - Intergenic
977063795 4:92288315-92288337 CCTGGATTTCAGAGGATGTATGG - Intergenic
978265624 4:106821222-106821244 ACTGCATTTCAGAGGCTGTATGG + Intergenic
979079153 4:116312215-116312237 CCTGGATTTCAGAGGATGTATGG - Intergenic
979146169 4:117251457-117251479 CCTAAATTTCAGAGGGTGTATGG + Intergenic
979601506 4:122590983-122591005 CCTACATTTCAAAGGCTGAATGG - Intergenic
979885336 4:126020650-126020672 CTTGCATTCCAGTGTGTGAAGGG - Intergenic
979951333 4:126897285-126897307 CCTGGATTTCAGAGGATGTATGG - Intergenic
980084456 4:128377224-128377246 CCTGGATTTCAGAGGATGTACGG - Intergenic
980396602 4:132223552-132223574 CCTGGATTTCAGAGGATGTATGG + Intergenic
980408219 4:132381312-132381334 CCTAGATTTCAGAGGATGAACGG - Intergenic
981131380 4:141161870-141161892 CCTGTATTTCAGAGGATGTATGG + Intronic
981242394 4:142493164-142493186 CCTAGATTTCAGAGGGTGTATGG + Intronic
982060300 4:151598018-151598040 CCTGCTTTTAGGGGAGTGAACGG + Intronic
982310007 4:153974809-153974831 CCTTGATTTCAGGGGATGTATGG + Intergenic
982832939 4:160086381-160086403 CCTAGATTTCAGGGGATGTATGG - Intergenic
984232088 4:177112028-177112050 CCTAGATTTCAGGGGATGTATGG - Intergenic
985973499 5:3395416-3395438 CCTGCATTTCAGAGGGACTAGGG + Intergenic
986137834 5:4999273-4999295 CCTACATTTCAGAGGATGTATGG - Intergenic
987597532 5:20020688-20020710 CCTCAATTTCAGAGGGTGTATGG + Intronic
988074779 5:26338676-26338698 CCTACATTTCAGAGGATGTATGG - Intergenic
988359098 5:30212389-30212411 CCTAGATTTCAGAGGATGAATGG + Intergenic
988918354 5:35918451-35918473 CATGAACTTCAGGGGGTGGAGGG + Intronic
990291263 5:54354322-54354344 CCTGGATTTCAGAGGATGTATGG + Intergenic
991776359 5:70089533-70089555 CCTGGATTTCAGAGGATGTATGG + Intergenic
991855646 5:70964980-70965002 CCTGGATTTCAGAGGATGTATGG + Intergenic
991869658 5:71097758-71097780 CCTGGATTTCAGAGGATGTATGG + Intergenic
992048399 5:72921067-72921089 CCTGCATTCCAAGGTGAGAATGG - Intergenic
992310951 5:75498650-75498672 CCTACATTTCAGAGGATGTATGG + Intronic
993881558 5:93368275-93368297 ACTGCATTTCAATGGGGGAATGG - Intergenic
993945915 5:94116752-94116774 CCTAGATTTCAGAGGATGAAAGG + Intergenic
994764545 5:103900154-103900176 CCTAGATTTCAGGGGATGTATGG + Intergenic
995336681 5:111007578-111007600 CCTGCAAGTCTTGGGGTGAAAGG - Intergenic
995925546 5:117369420-117369442 CCTGGATTTCAGGTGATGTATGG + Intergenic
996236891 5:121141551-121141573 CCTAGATTTCAGGGGGTGTATGG - Intergenic
997273747 5:132564944-132564966 CCTAGATTTCAGGGGATGTATGG + Intronic
997274619 5:132574229-132574251 CCTAGATTTCAGAGGGTGTATGG - Intronic
997446260 5:133942654-133942676 GCTGCATCTCAGGCAGTGAAAGG + Intergenic
997465835 5:134087505-134087527 ACTGCCTTTCAGTGGGTGCAAGG - Intergenic
997862335 5:137429169-137429191 GCTGCATTTCAGGAACTGAAAGG - Intronic
998873466 5:146575754-146575776 CCTAGATTTCAGGGGATGTATGG - Intergenic
998945943 5:147339352-147339374 CCTGGATTTCAGAGGATGTATGG + Intronic
999873958 5:155781884-155781906 TCTGCATTTCATGGGATGAAAGG - Intergenic
999986224 5:157007816-157007838 CCTGGGTTTCAGAGGTTGAATGG - Intergenic
1000050233 5:157556617-157556639 CCTTCATTGCAGGGTGTGGAAGG - Intronic
1000548851 5:162634155-162634177 CCTGTATTTCAGAGGATGTATGG - Intergenic
1000786622 5:165552526-165552548 GCAGAATTTCAGGGTGTGAAGGG - Intergenic
1001684916 5:173586115-173586137 CCTAGATTTCAGGGGATGCATGG - Intergenic
1002177436 5:177409258-177409280 CCTGCATTTCTGGGGGAGATGGG - Intronic
1003000236 6:2325228-2325250 CCTAGATTTCAGAGGGTGTATGG + Intergenic
1003636874 6:7840078-7840100 TCTGCCTGTCAGCGGGTGAATGG - Intronic
1005570124 6:27137018-27137040 CCTGCTTTTAAGGGGGTAAAAGG + Intergenic
1007074522 6:39058010-39058032 CCTGCCTTTCCTGGGGTGAGGGG + Intronic
1008174245 6:48247116-48247138 GCTTCATTTCAGTGGGAGAAAGG + Intergenic
1008631452 6:53366195-53366217 CCTAGATTTCAGGGGATGTATGG - Intergenic
1009284964 6:61804610-61804632 CCTACATTTCAGAGGATGTATGG - Intronic
1009550773 6:65089026-65089048 CCTAGATATCAGGGGATGAATGG + Intronic
1010517402 6:76789948-76789970 CCTGGATTTCAGAGGGCGAATGG - Intergenic
1010610787 6:77952004-77952026 CCTAGATTTCAGAGGGTGTATGG + Intergenic
1011382730 6:86760090-86760112 CCTAGATTTCAGTGGGTGTATGG + Intergenic
1011491368 6:87896745-87896767 CGTGCATTTCGGGGTGCGAAAGG - Intergenic
1011774002 6:90707800-90707822 TCAGCATTTCAGGGGGTGAAAGG - Intergenic
1011784233 6:90826391-90826413 CCTGGATTTCAGAGGATGTACGG + Intergenic
1011942289 6:92857425-92857447 CCTAGATTTCAGAGGGTGTATGG - Intergenic
1012014890 6:93837650-93837672 GGTGCTTTTCAGAGGGTGAAGGG + Intergenic
1012732398 6:102899494-102899516 CCTGGATTTCAGAGGATGTATGG - Intergenic
1013557471 6:111271068-111271090 ACTGCATTTCAGTAGGTTAAAGG - Exonic
1013928609 6:115502835-115502857 CCTGGATTTCAGAGGATGAATGG + Intergenic
1014247719 6:119084768-119084790 CCTAGATTTCAGAGGGTGTATGG - Intronic
1014621693 6:123674952-123674974 CCTAGATTTCAGAGGATGAATGG - Intergenic
1015238541 6:130997742-130997764 ATTGCATTTCAGGGGGGAAAAGG + Intronic
1015347267 6:132174894-132174916 CCTAGATTTCAGAGGGTGTATGG - Intergenic
1016166023 6:140944863-140944885 CCTAGATTTCAGAGGTTGAATGG + Intergenic
1017034694 6:150256706-150256728 TCTTCATCTCAGGTGGTGAAAGG - Intergenic
1017720794 6:157241733-157241755 CCTACATTTCTGGGGATGACTGG + Intergenic
1018075337 6:160207399-160207421 CCTCGATTTCAGAGGGTGTATGG - Intronic
1018482435 6:164205452-164205474 CCTGGATTTCAGAGGATGTATGG + Intergenic
1018911706 6:168104749-168104771 GATGCCCTTCAGGGGGTGAATGG + Intergenic
1020579037 7:9971356-9971378 CCTGTATTTCAGAGGATGTAAGG + Intergenic
1020581787 7:10011793-10011815 CCTAGATTTCAGAGGGTGTATGG + Intergenic
1020837203 7:13168400-13168422 CCTACATTTCAGAGGATGTATGG - Intergenic
1022164026 7:27740349-27740371 CCTACAGTACAGGGGCTGAAGGG - Intronic
1022705994 7:32802465-32802487 CCTAGATTTCAGAGGGTGTATGG - Intergenic
1022712568 7:32865410-32865432 CCTGGATTTCAGAGGTTGTATGG - Intergenic
1022852752 7:34282189-34282211 CCTGTATTTCAGAGGATGTATGG - Intergenic
1022910432 7:34895589-34895611 CCTGGATTTCAGAGGATGTATGG + Intergenic
1023589160 7:41762867-41762889 ACTGCATTTCAGGCTGTGATGGG - Intergenic
1023690302 7:42779336-42779358 CCTGGATTTCAGAGGATGTATGG + Intergenic
1024729258 7:52236109-52236131 CCTACATTTCAGAGGATGTATGG + Intergenic
1028032430 7:85932956-85932978 CCTAGATTTCAGAGGGTGTATGG + Intergenic
1028099082 7:86798033-86798055 CCTGGATTTCAGAGGATGTATGG + Intronic
1030714393 7:112790806-112790828 CCTGCATTTGAGGAACTGAAAGG - Intergenic
1031194200 7:118591321-118591343 CCTACATTTCAGAGGATGTATGG + Intergenic
1031275223 7:119712698-119712720 CCTACATTTCAGAGGATGTATGG - Intergenic
1031872528 7:127102681-127102703 CCTACATTTCAGAGGATGTATGG + Intronic
1032416807 7:131741780-131741802 CCTTCATTTCAGGAGGTGAGAGG - Intergenic
1033444191 7:141405713-141405735 CCTGCCTTTCAGAGGGGAAAGGG + Intronic
1033998733 7:147385942-147385964 CCTGGATTTCAGAGGATGTATGG - Intronic
1034106974 7:148498449-148498471 GCTGCATAGCAGGAGGTGAATGG + Intergenic
1034212159 7:149373310-149373332 CCTGGATTTCAGAGGTTGTATGG - Intergenic
1035080745 7:156214069-156214091 CGTGCATTTCTGTGGGTGAGAGG + Intergenic
1035926556 8:3734204-3734226 CCTGCATTTCACGATGAGAATGG + Intronic
1037081963 8:14797957-14797979 CCTGGATTTCAGAGGATGTAGGG + Intronic
1039121951 8:34157521-34157543 CCTGGATTTCAGAGGATGTAGGG + Intergenic
1039322180 8:36444333-36444355 ACTGAATTTCAAGAGGTGAAAGG - Intergenic
1039880535 8:41622601-41622623 CCTGCAGTTCAGGGAGTGGGTGG + Exonic
1041030638 8:53732531-53732553 CATGTATTTCAGGTGGTGACAGG + Intronic
1043002806 8:74780130-74780152 CCTGAATTTCAAAGGGAGAAGGG - Intronic
1043062131 8:75517938-75517960 CCTAGATTTCAGCGGGTGTATGG - Intronic
1043241221 8:77938000-77938022 CCTGGATTTCAGAGGATGTATGG - Intergenic
1043266284 8:78270978-78271000 CCTGGATTTCAGAGGATGTATGG - Intergenic
1043714697 8:83467270-83467292 CCTCAATTTCAGAGGGTGTATGG + Intergenic
1043803689 8:84643889-84643911 CCTGCATTTCAGGAGGATCATGG - Intronic
1044326915 8:90869174-90869196 CCTAGATTTCAGAGGATGAATGG + Intronic
1044462234 8:92458816-92458838 CCCGCCTTTCAGAGGGTAAAAGG + Intergenic
1046257667 8:111722138-111722160 CCTAGATTTCAGCGGGTGTATGG - Intergenic
1046786473 8:118272142-118272164 CCTGGATTTCAGAGGATGTATGG - Intronic
1048107501 8:131427571-131427593 CCTGGATTTCAGAGGATGTATGG - Intergenic
1048138385 8:131768925-131768947 CATGCATTTGATGGGGGGAAAGG - Intergenic
1048857609 8:138697741-138697763 CCTGCACTGCAGGGGCTCAAAGG + Intronic
1049210934 8:141386129-141386151 CCTGCATTGGTGGGGGTGAAAGG + Intergenic
1052701333 9:31941457-31941479 CCTACATTTCAGAGGATGTATGG + Intergenic
1052705399 9:31988580-31988602 CCTGGATTTCAGAGGATGTATGG - Intergenic
1052782558 9:32795998-32796020 CCTACATTTCAGGAGATGTATGG - Intergenic
1053571953 9:39318858-39318880 CCTGGATTTCAGAGGATGTATGG + Intergenic
1053703846 9:40729953-40729975 CCTGGATTTCAGAGGATGTAAGG - Intergenic
1054093507 9:60877569-60877591 CCTGGATTTCAGAGGATGTATGG + Intergenic
1054114990 9:61153489-61153511 CCTGGATTTCAGAGGATGTATGG + Intergenic
1054125192 9:61300153-61300175 CCTGGATTTCAGAGGATGTATGG - Intergenic
1054413929 9:64853562-64853584 CCTGGATTTCAGAGGATGTAAGG - Intergenic
1054592766 9:67029045-67029067 CCTGGATTTCAGAGGATGTATGG - Intergenic
1055274710 9:74601798-74601820 GTTGTATTTTAGGGGGTGAATGG + Intronic
1055679864 9:78704169-78704191 CCTGTATTTCAGGAGATGTATGG + Intergenic
1055688581 9:78805389-78805411 GCTGCATTTCAGGGGTTGGTTGG - Intergenic
1057231333 9:93323420-93323442 CCTGCCTTCCAGGTGGTTAAGGG + Intronic
1057236761 9:93367203-93367225 CCTGCCTTCCAGGTGGTTAAGGG - Intergenic
1058210455 9:102161510-102161532 CCTAGATTTCAGGGGATGTATGG - Intergenic
1058292218 9:103256890-103256912 CCTAGATTTCAGAGGGTGTATGG - Intergenic
1058521665 9:105818693-105818715 CCTGATATTCAGGGGGTGAGTGG + Intergenic
1059187067 9:112283997-112284019 CCTACATTTCAGAGGATGTATGG + Intronic
1060191584 9:121597370-121597392 CCTGCAGGTCAGTGGGAGAAGGG - Intronic
1203358750 Un_KI270442v1:192462-192484 CCTGAATGTCACGGGGAGAATGG - Intergenic
1186488561 X:9953125-9953147 CCTAGATTTCAGGGGATGTATGG - Intergenic
1189896159 X:45658784-45658806 CCTGTATTTCAGAGGATGCATGG + Intergenic
1189980637 X:46506826-46506848 CCAGCAATGCAGAGGGTGAAGGG + Intronic
1190794100 X:53725283-53725305 CCTGGATTTCAGAGGTTGTATGG + Intergenic
1191606898 X:63072117-63072139 CCTGGATTTCAGAGGATGTATGG - Intergenic
1191923216 X:66279301-66279323 CCTGGATTTCAGAGGATGTATGG - Intergenic
1192321735 X:70095422-70095444 CCTACAATACAGGGGGTGAGAGG - Intergenic
1192545706 X:72011193-72011215 CATGCCCTTCAGTGGGTGAATGG - Intergenic
1193226466 X:78989756-78989778 CCTGAATTTCAGAGGATGTATGG + Intergenic
1193246549 X:79236960-79236982 CCTAGATTTCAGGGGATGTATGG - Intergenic
1193506231 X:82348073-82348095 CCTAGATTTCAGAGGGTGTACGG - Intergenic
1193865059 X:86720866-86720888 CCTACATTTCAGAGGATGTATGG - Intronic
1193887948 X:87006511-87006533 CCTGGATTTCAGAGGATGTATGG - Intergenic
1194194106 X:90870674-90870696 CCTGGATTTCAGAGGATGTATGG + Intergenic
1194397532 X:93404079-93404101 CCTAGATTTCAGAGAGTGAATGG - Intergenic
1194500222 X:94673053-94673075 CCTAGATTTCAGAGGGTGTACGG - Intergenic
1194624565 X:96213313-96213335 CCTAGATTTCAGGGGATGTATGG - Intergenic
1194886124 X:99318296-99318318 TCTGGATTTCAGAGGATGAAAGG + Intergenic
1194895292 X:99432584-99432606 CCTGCATTTCAGAGGATGTATGG + Intergenic
1195816777 X:108896761-108896783 CCTACATTTCAGAGGATGTATGG + Intergenic
1196313495 X:114196573-114196595 CCTATATTTCAGAGGGTGTATGG - Intergenic
1196540384 X:116900431-116900453 CCTGGATTTCAGAGGATGTATGG - Intergenic
1197054286 X:122097995-122098017 CCTAGATTTCAGGGGATGTATGG + Intergenic
1197058932 X:122153901-122153923 CCTGAATTTCAGAGGATGTATGG + Intergenic
1197223147 X:123932452-123932474 CCTACATTTCAGAGGATGTATGG + Intergenic
1197581903 X:128294314-128294336 CCTAGATTTCAGGGGATGTATGG + Intergenic
1198941990 X:141966103-141966125 CCTGGATTTCAGAGGATGTATGG + Intergenic
1199112819 X:143955329-143955351 CCTAGATTTCAGGGGATGTATGG + Intergenic
1199235493 X:145487859-145487881 CCTAAATTTCAGAGGATGAATGG - Intergenic
1199928427 X:152494100-152494122 CCTAGATTTCAGAGGATGAATGG + Intergenic
1200540715 Y:4453058-4453080 CCTGGATTTCAGAGGATGTATGG + Intergenic
1202387157 Y:24336971-24336993 TCAGCATCTCAGGGGGGGAATGG + Intergenic
1202483629 Y:25333157-25333179 TCAGCATCTCAGGGGGGGAATGG - Intergenic