ID: 1098002350

View in Genome Browser
Species Human (GRCh38)
Location 12:65958744-65958766
Sequence CTAGATTACCAAGTATTTGT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 175
Summary {0: 1, 1: 0, 2: 1, 3: 11, 4: 162}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1098002346_1098002350 0 Left 1098002346 12:65958721-65958743 CCATTTAGCCATAACTACCCTTT 0: 1
1: 0
2: 2
3: 18
4: 258
Right 1098002350 12:65958744-65958766 CTAGATTACCAAGTATTTGTAGG 0: 1
1: 0
2: 1
3: 11
4: 162
1098002347_1098002350 -8 Left 1098002347 12:65958729-65958751 CCATAACTACCCTTTCTAGATTA 0: 1
1: 0
2: 2
3: 13
4: 226
Right 1098002350 12:65958744-65958766 CTAGATTACCAAGTATTTGTAGG 0: 1
1: 0
2: 1
3: 11
4: 162

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1098002350 Original CRISPR CTAGATTACCAAGTATTTGT AGG Intronic
900887362 1:5424410-5424432 CTAGAATCCCAATTAATTGTTGG + Intergenic
902229446 1:15018632-15018654 CTAAATTAGGAAGTAGTTGTGGG + Intronic
902458621 1:16554364-16554386 CAAGGTTACCAAGTATTTTGAGG + Intergenic
902493536 1:16853552-16853574 CAAGGTTACCAAGTATTTTGAGG - Intronic
903151806 1:21415124-21415146 CAAGGTTACCAAGTATTTTGAGG + Intergenic
903750775 1:25618833-25618855 CTAGATTACAAAATATTTGCAGG - Intronic
904223870 1:28997996-28998018 CCAGTTTAACAAGTATTTGCAGG + Intronic
907157798 1:52350466-52350488 CTTGTTTTCCAAGTATTTGTGGG - Intronic
909603964 1:77490063-77490085 CTAGAACAACAAATATTTGTTGG + Intronic
913520414 1:119640299-119640321 CTAGATTTCCTAGTCTTTTTAGG - Intronic
916238765 1:162617589-162617611 CTAGATTACCAAGAATATGTAGG + Intergenic
917399079 1:174626253-174626275 CTAGATTACTTAGAATCTGTGGG + Intronic
919723540 1:200866323-200866345 GTAAATTTCCAAGTATTTGCAGG - Intergenic
922012339 1:221602592-221602614 TTAGATTGCCATGTATTTGGGGG - Intergenic
923374474 1:233346880-233346902 CTAAATTCCCAAGATTTTGTAGG + Intronic
923826629 1:237507922-237507944 CTAGGTACCCAAGTGTTTGTTGG - Intronic
1062912120 10:1217970-1217992 CTAGTTCTCCAAGTAATTGTGGG - Intronic
1063245190 10:4210225-4210247 CTAATTCACCAAGTATTGGTTGG - Intergenic
1064621554 10:17222547-17222569 CTGGATTATGGAGTATTTGTAGG - Intergenic
1066503851 10:36021598-36021620 CTAAAACACCAAGTATTTGAGGG + Intergenic
1069097258 10:64273980-64274002 ATAGTTTAGGAAGTATTTGTAGG - Intergenic
1070295712 10:75159615-75159637 GTAAATTTCCAAGTATTTTTTGG - Intronic
1070815719 10:79321810-79321832 CTAGATTAGCCATTTTTTGTGGG - Intergenic
1070953510 10:80449483-80449505 CCAGACTACCAAGGATTAGTCGG - Intergenic
1074379046 10:112963679-112963701 CAAGATTAGCAAGTATTACTTGG + Intronic
1075896302 10:125998054-125998076 CTAGATGAGCAAGTGTTTTTAGG - Intronic
1076337998 10:129722581-129722603 CTTGATTACCACAGATTTGTAGG - Intronic
1077759334 11:5074552-5074574 CCAAATTACCATGAATTTGTAGG - Intergenic
1078993873 11:16676932-16676954 CTAGATTACCAGGAATATGTGGG + Intronic
1079773163 11:24489810-24489832 CTAGAGTGCCCAGGATTTGTGGG - Intergenic
1081559634 11:44201583-44201605 TTAGATTACCATTTAGTTGTAGG + Intronic
1084398057 11:68927550-68927572 CTAGATTCCCAGGAATATGTTGG + Intronic
1088127388 11:106445089-106445111 CTAACTTACAAAGTTTTTGTGGG + Intergenic
1090302058 11:125651053-125651075 TTAGATTCCCAGGTATATGTTGG + Intronic
1090822350 11:130355063-130355085 CTAGGTTACCCAGTGTGTGTTGG + Intergenic
1090876469 11:130792770-130792792 TTACATTTCCAAGTATTTGGAGG + Intergenic
1091117289 11:133025465-133025487 CTAGATTACCAAATAGTTAAGGG - Intronic
1093103595 12:15057842-15057864 CTAGATTACAAGGTAGTTGATGG + Intergenic
1098002350 12:65958744-65958766 CTAGATTACCAAGTATTTGTAGG + Intronic
1098089238 12:66883308-66883330 CTAGATTATAAATTATTTGAGGG + Intergenic
1099013934 12:77323715-77323737 CTAGATTACCAACACCTTGTGGG - Intergenic
1101171569 12:102102023-102102045 CTAGTTTAAAAAGTAGTTGTTGG - Intronic
1106430524 13:29676337-29676359 CTATAGTACCAACTATTTGGGGG + Intergenic
1106722874 13:32454049-32454071 CTAGATTCCCAGGAATATGTGGG - Intronic
1107565270 13:41596283-41596305 TTAAGTTTCCAAGTATTTGTGGG - Intronic
1109258990 13:60120516-60120538 GTAGATAATCAAGTATTTTTTGG - Intronic
1110661071 13:78059921-78059943 CAAGAATACCAATTATTTTTAGG + Intergenic
1110787479 13:79547280-79547302 AAAGATTTCCAATTATTTGTTGG - Intronic
1110873638 13:80482430-80482452 CTAGATTACCATGTATTGCATGG + Intergenic
1111048026 13:82841793-82841815 CTTTATTAACAAATATTTGTGGG + Intergenic
1115400968 14:32959744-32959766 CGAGATTCCCGAGTATTTTTGGG + Intronic
1115607760 14:35021833-35021855 CTAGATAACCATTTATTTGGGGG + Intronic
1116885673 14:50218721-50218743 TTAAATTACCAAGTATTGGCAGG + Intronic
1117806848 14:59502316-59502338 CTAGATTAGCAAGTATAGGATGG - Intronic
1119966255 14:78919024-78919046 CTAGTTTACCAATTATATTTGGG - Intronic
1125416226 15:39456128-39456150 GAAGTTTACTAAGTATTTGTAGG - Intergenic
1126057555 15:44745012-44745034 CTAGATTACCAGGAATATGTGGG - Intronic
1126353225 15:47767060-47767082 CCAGATTACAAAATATTTGGCGG + Exonic
1127002430 15:54525286-54525308 CTAGATAACAAAGCCTTTGTTGG - Intronic
1128828102 15:70740093-70740115 TTAGATTAACAAATATTTCTTGG - Intronic
1129489896 15:75914463-75914485 CCAAATTAGGAAGTATTTGTGGG + Intronic
1130897268 15:88181268-88181290 CAAGATTCCCAAGGCTTTGTGGG - Intronic
1130940945 15:88508555-88508577 CAAGAGAACCAAGTATTTCTTGG + Intergenic
1131658835 15:94492250-94492272 ATAGTTTACCAAATATGTGTGGG - Intergenic
1132268019 15:100494871-100494893 CTAGATTTCCAAGAACATGTTGG + Intronic
1138004395 16:53317614-53317636 CTACAGTCCCAGGTATTTGTTGG - Intronic
1138627092 16:58261080-58261102 CTAGTTTACCAATTATTTCAAGG - Intronic
1138663634 16:58543356-58543378 GTAGATACCCAAATATTTGTTGG - Intronic
1149507455 17:57206187-57206209 CTAGAATACAAGGTATTTGGGGG + Intergenic
1150657292 17:67047781-67047803 CTAGATTCCCAGGAATATGTTGG - Intronic
1153390906 18:4558252-4558274 GTAGATTGGCAAATATTTGTAGG + Intergenic
1153580403 18:6567765-6567787 CAAGTTTCCAAAGTATTTGTTGG + Intronic
1156111002 18:33727159-33727181 CTAGATTGCTTAGTATTTCTCGG + Intronic
1157731110 18:50005323-50005345 GTGGCTTACCAAGAATTTGTTGG - Intronic
1158508727 18:58070540-58070562 CTAGATTCCCAGGAATATGTTGG - Intronic
1165351004 19:35275683-35275705 CTTAATTTCCAAATATTTGTGGG + Intronic
1165411338 19:35664056-35664078 CTAGATTTCCAAGAATATTTTGG + Intergenic
1166314504 19:41981493-41981515 CCAGAGTACCTGGTATTTGTTGG + Exonic
1167484375 19:49752767-49752789 CTACATTCCCAGGAATTTGTTGG - Intronic
927758454 2:25727900-25727922 CTGGATTATAAAGTATTTGATGG - Intergenic
928069513 2:28200732-28200754 CTAGTTTACCAGGTATCTATGGG + Intronic
928654579 2:33437321-33437343 GTAGCTTTCCAAGTTTTTGTGGG - Intronic
931586819 2:63838889-63838911 CTCGCTTACAAAGTGTTTGTGGG + Intergenic
933830246 2:86201220-86201242 CCAGATTAACAAAAATTTGTAGG - Intronic
935893715 2:107710302-107710324 CTAGATTCCCATGAATATGTCGG - Intergenic
941305720 2:163863396-163863418 CTAAATTTCCAAGTATTTTGTGG + Intergenic
941756648 2:169193469-169193491 GGAGACAACCAAGTATTTGTGGG + Intronic
945723047 2:213442830-213442852 CTAGATTACCTTGGATTTGGTGG + Intronic
945901821 2:215546796-215546818 CTAAATTACCAAGTACTGCTTGG - Intergenic
947562951 2:231173943-231173965 CTAGATTATCAAGCCTTTCTTGG + Intergenic
1170415614 20:16135889-16135911 CTAGATTTCCAAGAACATGTTGG - Intergenic
1178725006 21:35043613-35043635 CTAAATTACCAAGTTCCTGTTGG - Intronic
1184325795 22:43783322-43783344 CTAGATTCCCAAGAATATGTGGG - Intronic
957312316 3:78536828-78536850 ATAGCTTTTCAAGTATTTGTTGG - Intergenic
960022535 3:112971394-112971416 CTGTATTTCCAAGTATCTGTAGG + Intronic
960166125 3:114403502-114403524 CTAGAGTTCCAGATATTTGTTGG - Intronic
960934482 3:122889297-122889319 CTAGATAACCAAGAATTTACTGG - Intergenic
960981848 3:123236415-123236437 CAAGATTACTAAGAATTAGTGGG + Intronic
961846161 3:129765645-129765667 CTAGCTTACCCAGAATTTGAAGG + Intronic
965176405 3:165339858-165339880 CCAGATTAACAAGTATATTTTGG - Intergenic
966165768 3:177014733-177014755 CTAGATTGCCAAGAATTCTTTGG - Intergenic
967387048 3:188922149-188922171 CTAGAATACAAAGAGTTTGTGGG - Intergenic
967712523 3:192725774-192725796 CTAGCTGACTAAGTATTTCTGGG - Intronic
971774182 4:30939584-30939606 TTACATTACCAAGTATTTTATGG - Intronic
974514515 4:62891668-62891690 CCAGCTTATCAATTATTTGTAGG + Intergenic
975911785 4:79275887-79275909 TTAAATTAACAAGCATTTGTTGG - Intronic
975950175 4:79761104-79761126 TTAGATCACAAAGTGTTTGTAGG - Intergenic
977966439 4:103155128-103155150 CTATGTTACCAAGTATATGCTGG - Intronic
978761972 4:112362602-112362624 TGAGAATACCAATTATTTGTAGG - Intronic
979812829 4:125061050-125061072 GTAGCTTAATAAGTATTTGTAGG - Intergenic
982031402 4:151304732-151304754 CTAGATTCCCAGGAATATGTGGG - Intronic
982721798 4:158867714-158867736 CTAGAATAATAAGAATTTGTTGG - Intronic
983842252 4:172471587-172471609 CTAGATCACTACATATTTGTTGG - Intronic
985596603 5:794470-794492 CTAGATTACAGAGGATGTGTTGG + Intergenic
986511112 5:8506989-8507011 CTAGTTAACCAAGTAGTTGTGGG - Intergenic
987724335 5:21678568-21678590 TTAGATTTCCAAGAATATGTTGG + Intergenic
988120413 5:26954174-26954196 CTGGATTACCAGGTCTCTGTTGG + Intronic
988643726 5:33070265-33070287 CTAGACTGTCAAGTATTTGTGGG - Intergenic
990723755 5:58730170-58730192 CTACATTAGAAACTATTTGTAGG + Intronic
992390967 5:76330677-76330699 CTTGATTACCTGGTTTTTGTTGG + Intronic
994570153 5:101505351-101505373 CTAGATTTCCAAGGATATATGGG + Intergenic
997669487 5:135658696-135658718 CTAGATTTCAAAGGATTTATGGG - Intergenic
999000397 5:147915310-147915332 CTAAATTACAAGGTTTTTGTGGG - Intergenic
1003009059 6:2409456-2409478 CCAGAATACCAAGTAGTTGGAGG + Intergenic
1003863173 6:10340469-10340491 CTAGATCACCAGGGACTTGTAGG - Intergenic
1005351876 6:24944085-24944107 CTAGATTCCCAGGAATATGTGGG - Intronic
1005908182 6:30283968-30283990 CTAGATTTCAGAGTATGTGTGGG - Intergenic
1009245301 6:61230614-61230636 CTAGATTTCCAGATATATGTTGG - Intergenic
1010590636 6:77707916-77707938 CTAGATTTCAAAGGATGTGTAGG + Intronic
1012206718 6:96470176-96470198 GCAGGTTTCCAAGTATTTGTTGG - Intergenic
1013278771 6:108613993-108614015 TTAAATTTCCAAGTATTTGGAGG + Intronic
1013929273 6:115511037-115511059 TTAGATTATAAGGTATTTGTGGG + Intergenic
1015696724 6:135988872-135988894 CAAGCTTACCAACTATTTATTGG - Intronic
1018607532 6:165613859-165613881 ATAGATTTTGAAGTATTTGTTGG - Intronic
1021032592 7:15756203-15756225 CTAGATTCCCAGGAATATGTTGG - Intergenic
1024735414 7:52299481-52299503 GTAGATTCACATGTATTTGTAGG + Intergenic
1026075316 7:67161447-67161469 TTAGATTACCACGTATCTTTTGG + Intronic
1026343050 7:69450647-69450669 ATAGATTACAAAGTGTTTGTAGG + Intergenic
1026701534 7:72650756-72650778 TTAGATTACCACGTATCTTTTGG - Intronic
1028096722 7:86769849-86769871 CTATATTAGCAAATATATGTGGG + Intronic
1028700343 7:93771139-93771161 CTAGATTCCCAGGAATATGTAGG - Intronic
1028822081 7:95223932-95223954 GGAATTTACCAAGTATTTGTTGG + Intronic
1031710361 7:125037369-125037391 CTAGTTTACCACTTATCTGTAGG + Intergenic
1032826215 7:135570994-135571016 CTAGATTAAAAAGTAGCTGTGGG + Intronic
1033527645 7:142232296-142232318 CTAGATTCCCATATATTTGAAGG - Intergenic
1034056005 7:148035605-148035627 CTAGATTTCAAAGGATGTGTTGG + Intronic
1037231373 8:16662819-16662841 TTAACTTACCAAGTATTTTTGGG - Intergenic
1037287488 8:17316995-17317017 CAGCATTACCAAGTATTAGTTGG - Intronic
1038114746 8:24540803-24540825 CTAGATCACAAAGCAGTTGTAGG - Intergenic
1038527250 8:28286404-28286426 ATAGATTAGCAAATATGTGTTGG - Intergenic
1041086647 8:54262701-54262723 CTAGATTAAAAAATAGTTGTCGG - Intergenic
1041276073 8:56158696-56158718 GTAGATAATCAAGTATTTGTTGG - Intergenic
1046296902 8:112231536-112231558 ATACATTACCCAGTCTTTGTAGG + Exonic
1047689440 8:127336245-127336267 CTAGCTTACCAATTCTTTCTGGG - Intergenic
1050493091 9:6210485-6210507 CTTGATTCCCCAGTATATGTGGG + Intergenic
1052166319 9:25334294-25334316 CTATTTTACCAAGTTATTGTTGG + Intergenic
1052313969 9:27097372-27097394 CTAGATTTCAAAGAATGTGTAGG + Intergenic
1055269194 9:74536995-74537017 ATATATTACCAAGTGGTTGTAGG - Intronic
1186219818 X:7337792-7337814 CTAGATTAACAACAGTTTGTTGG + Intronic
1189194598 X:39142193-39142215 CTAGACTACCAAGTAGTTTATGG + Intergenic
1190211446 X:48451784-48451806 CTAGATTCCCAGGCATGTGTTGG - Intergenic
1192575234 X:72238479-72238501 CTAGATTACAAACAATTTGGGGG + Intronic
1192593303 X:72380118-72380140 TTAGATTCCCAGGTATTTGTTGG + Intronic
1193202343 X:78706440-78706462 CTATATTTCAAAATATTTGTAGG - Intergenic
1194076183 X:89397384-89397406 CTTCATTTCCATGTATTTGTAGG + Intergenic
1194474556 X:94342812-94342834 CTAGATTACAAGTTATTTGAGGG + Intergenic
1194651899 X:96525023-96525045 CTAGCTTCCATAGTATTTGTGGG - Intergenic
1199431271 X:147762881-147762903 CAAGATTACCAAGTAAGTGGTGG - Intergenic
1200427336 Y:3035652-3035674 CTAGCTTACCAAATATTTGCTGG - Intergenic
1200428821 Y:3052906-3052928 CTTCATTTCCATGTATTTGTAGG + Intergenic
1201612958 Y:15863619-15863641 CATGTTTACCAAGTATTTGGAGG + Intergenic
1202166145 Y:21990804-21990826 CTATATTACCAAGTACGTTTTGG + Intergenic
1202225213 Y:22595569-22595591 CTATATTACCAAGTACGTTTTGG - Intergenic
1202317901 Y:23600092-23600114 CTATATTACCAAGTACGTTTTGG + Intergenic
1202552865 Y:26069966-26069988 CTATATTACCAAGTACGTTTTGG - Intergenic