ID: 1098002730

View in Genome Browser
Species Human (GRCh38)
Location 12:65962202-65962224
Sequence CTCACTAACGACGCTTTTAT CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 27
Summary {0: 1, 1: 0, 2: 0, 3: 1, 4: 25}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1098002728_1098002730 20 Left 1098002728 12:65962159-65962181 CCGTCTTATGAGACAATGTGCAG 0: 1
1: 0
2: 0
3: 12
4: 109
Right 1098002730 12:65962202-65962224 CTCACTAACGACGCTTTTATCGG 0: 1
1: 0
2: 0
3: 1
4: 25

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1098002730 Original CRISPR CTCACTAACGACGCTTTTAT CGG Intronic
1072036850 10:91570601-91570623 CTCACTCAGGCCTCTTTTATAGG - Intergenic
1075627674 10:123974221-123974243 CTAACTAGCGACCCATTTATAGG + Intergenic
1081329035 11:41781546-41781568 CTCAATAACTATGTTTTTATAGG - Intergenic
1087061563 11:93983732-93983754 CTCACTAGGGAGGGTTTTATAGG + Intergenic
1098002730 12:65962202-65962224 CTCACTAACGACGCTTTTATCGG + Intronic
1116386755 14:44340343-44340365 CTCTCTAGGGACTCTTTTATAGG + Intergenic
1128388261 15:67165578-67165600 CTCACTAGTGATGCTTTTCTTGG + Intronic
1153487190 18:5611603-5611625 CTCTCTAATGAAGCTTTTCTTGG - Intronic
1162967661 19:14163678-14163700 CTCACTAACCCCGCTCTTAATGG - Intronic
932314674 2:70771976-70771998 CTCACTCACGCATCTTTTATGGG + Intergenic
944593018 2:201236033-201236055 ATCACTGACGATGCTTTTCTTGG + Intronic
945539141 2:211061857-211061879 TTCACAAACCATGCTTTTATTGG + Intergenic
947129808 2:226909644-226909666 CTCTCTGAGGTCGCTTTTATAGG - Intronic
950190975 3:10975939-10975961 CTCACTAAACACTCTTTCATGGG + Intergenic
964733972 3:159897377-159897399 CTCACTAACAAGGCTTATACTGG + Intergenic
967655411 3:192042421-192042443 ATCACTAAAGGCGTTTTTATGGG + Intergenic
969968645 4:11022999-11023021 TTCAGTAAGGACGCTTTTGTGGG - Intergenic
989975237 5:50577958-50577980 CTCTATAACGAAGCTTTTCTGGG + Intergenic
990934952 5:61138176-61138198 CTCACTAACAACCCTTTAAATGG - Intronic
1002510753 5:179715219-179715241 CACACTTAAGATGCTTTTATGGG + Intronic
1007991741 6:46262979-46263001 CTCACTAACAACACTGTTATGGG - Intronic
1028748902 7:94359963-94359985 CTCAATAACTATGCTTCTATTGG - Intergenic
1029815180 7:103086452-103086474 CTCACTACCCATACTTTTATAGG - Intronic
1056100323 9:83294678-83294700 GTGACTAAAGACGCTTATATGGG + Intronic
1198397459 X:136234775-136234797 CTGGCTAATGACGCTTTTGTTGG + Intronic
1198509176 X:137331958-137331980 CTCAATAAAGATGCTTTCATAGG - Intergenic
1201347032 Y:12996121-12996143 CAAACTAATGACGATTTTATAGG + Intergenic