ID: 1098004860

View in Genome Browser
Species Human (GRCh38)
Location 12:65985555-65985577
Sequence TTTGTTAGGTTCTTTTTTCA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1098004860_1098004864 10 Left 1098004860 12:65985555-65985577 CCATGAAAAAAGAACCTAACAAA No data
Right 1098004864 12:65985588-65985610 CTTGAAGAGTGAAGGCCTCCTGG No data
1098004860_1098004862 2 Left 1098004860 12:65985555-65985577 CCATGAAAAAAGAACCTAACAAA No data
Right 1098004862 12:65985580-65985602 ATGCCTCTCTTGAAGAGTGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1098004860 Original CRISPR TTTGTTAGGTTCTTTTTTCA TGG (reversed) Intergenic
No off target data available for this crispr