ID: 1098013620

View in Genome Browser
Species Human (GRCh38)
Location 12:66081014-66081036
Sequence ACCAATATTTAAGCCTTTTG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1098013620_1098013623 0 Left 1098013620 12:66081014-66081036 CCACAAAAGGCTTAAATATTGGT No data
Right 1098013623 12:66081037-66081059 GGCACAACATCTTTGGTAGCAGG No data
1098013620_1098013625 7 Left 1098013620 12:66081014-66081036 CCACAAAAGGCTTAAATATTGGT No data
Right 1098013625 12:66081044-66081066 CATCTTTGGTAGCAGGGATGAGG No data
1098013620_1098013622 -7 Left 1098013620 12:66081014-66081036 CCACAAAAGGCTTAAATATTGGT No data
Right 1098013622 12:66081030-66081052 TATTGGTGGCACAACATCTTTGG No data
1098013620_1098013624 1 Left 1098013620 12:66081014-66081036 CCACAAAAGGCTTAAATATTGGT No data
Right 1098013624 12:66081038-66081060 GCACAACATCTTTGGTAGCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1098013620 Original CRISPR ACCAATATTTAAGCCTTTTG TGG (reversed) Intergenic
No off target data available for this crispr