ID: 1098013623

View in Genome Browser
Species Human (GRCh38)
Location 12:66081037-66081059
Sequence GGCACAACATCTTTGGTAGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1098013620_1098013623 0 Left 1098013620 12:66081014-66081036 CCACAAAAGGCTTAAATATTGGT No data
Right 1098013623 12:66081037-66081059 GGCACAACATCTTTGGTAGCAGG No data
1098013618_1098013623 1 Left 1098013618 12:66081013-66081035 CCCACAAAAGGCTTAAATATTGG No data
Right 1098013623 12:66081037-66081059 GGCACAACATCTTTGGTAGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1098013623 Original CRISPR GGCACAACATCTTTGGTAGC AGG Intergenic
No off target data available for this crispr