ID: 1098014147

View in Genome Browser
Species Human (GRCh38)
Location 12:66086597-66086619
Sequence TCTCCTCTTATGTGTACCTC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1098014143_1098014147 25 Left 1098014143 12:66086549-66086571 CCACAAGTTGTGTGTGCCTTTAG No data
Right 1098014147 12:66086597-66086619 TCTCCTCTTATGTGTACCTCTGG No data
1098014144_1098014147 9 Left 1098014144 12:66086565-66086587 CCTTTAGTTTTGAGTCTTGAGTG No data
Right 1098014147 12:66086597-66086619 TCTCCTCTTATGTGTACCTCTGG No data
1098014142_1098014147 26 Left 1098014142 12:66086548-66086570 CCCACAAGTTGTGTGTGCCTTTA No data
Right 1098014147 12:66086597-66086619 TCTCCTCTTATGTGTACCTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1098014147 Original CRISPR TCTCCTCTTATGTGTACCTC TGG Intergenic
No off target data available for this crispr