ID: 1098018075

View in Genome Browser
Species Human (GRCh38)
Location 12:66127385-66127407
Sequence CTGGCTTATTTCCCTTAGCA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 463
Summary {0: 1, 1: 16, 2: 56, 3: 97, 4: 293}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1098018075_1098018080 30 Left 1098018075 12:66127385-66127407 CCATGCTAAGGGAAATAAGCCAG 0: 1
1: 16
2: 56
3: 97
4: 293
Right 1098018080 12:66127438-66127460 TTATAAGAAATATTCAAAACAGG 0: 1
1: 1
2: 32
3: 220
4: 1620

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1098018075 Original CRISPR CTGGCTTATTTCCCTTAGCA TGG (reversed) Intronic
900795789 1:4707527-4707549 CTGGCTTCTTTCCCTGCTCAGGG + Intronic
900925434 1:5703273-5703295 CTGGCTTATTTCACTTAGCACGG + Intergenic
901459717 1:9384317-9384339 CTGGCTTTCTGCCCTTGGCACGG - Intergenic
901562125 1:10080783-10080805 CTGGCTTATTTCACTTAGCATGG - Intronic
901659838 1:10792187-10792209 CTGTTTTATTTCCTATAGCAGGG + Intronic
902578246 1:17392093-17392115 CTGGCTTCTCTCCCATGGCAGGG + Exonic
903571115 1:24306199-24306221 CTGGCTTCTTTCATTTAACATGG + Intergenic
903851393 1:26308682-26308704 CTTGCTTATCTCCATGAGCAAGG - Intronic
905861299 1:41353781-41353803 CTGGCCTCTGTCCCTTAACATGG - Intergenic
905897175 1:41555902-41555924 CTGGCTTAGTTCACGCAGCATGG + Intronic
905946592 1:41906410-41906432 CTGGCTTCTTTCTCTTAGCATGG - Intronic
906111758 1:43328475-43328497 CTGGCTTCTTTCACTTAGCATGG - Intergenic
906124672 1:43420462-43420484 AGGGCTTAATTCTCTTAGCATGG + Intronic
906462950 1:46050918-46050940 CTGGCTTCTTTCACTTAGCATGG - Intronic
906623852 1:47308485-47308507 CTGGCTTATTTCACTTAACATGG - Intronic
906830124 1:49022199-49022221 CTGGCTTATTTACCATACCTTGG - Intronic
908126811 1:61040313-61040335 ATGGCTTATTTTCCTTATTAAGG - Intronic
908533425 1:65055270-65055292 CTGGCTTATTTCACTTAGCATGG + Intergenic
912327030 1:108775674-108775696 CTGGCTTATTTCGCTTAACATGG + Intronic
913462345 1:119100930-119100952 CTGGCTTATTTCACTTGCCAGGG - Intronic
913577239 1:120189044-120189066 CTGGCTTCTTTCAGTTAGTATGG - Intergenic
914409275 1:147409795-147409817 GTGGTTTTTGTCCCTTAGCAAGG - Intergenic
914559152 1:148800471-148800493 CTGGCTTCTTTCAGTTAGTATGG - Intergenic
914613681 1:149329752-149329774 CTGGCTTCTTTCAGTTAGTATGG + Intergenic
914785678 1:150827445-150827467 CTGGCTTCTTTCATTGAGCATGG + Intronic
918521665 1:185421375-185421397 CTGGATTCCTTCCCCTAGCATGG + Intergenic
918664706 1:187136032-187136054 CTGCCTTATTTCACTTAATATGG - Intergenic
918933232 1:190884700-190884722 CTGGCTTATTTCCTTTAACATGG - Intergenic
919069988 1:192742177-192742199 CTACCTTTTTTCCCTAAGCATGG + Intergenic
919491206 1:198207571-198207593 ATGACTTCTTTCACTTAGCATGG - Intronic
919923119 1:202177974-202177996 CTGGCTGATATCCCTTTCCATGG + Intergenic
921342820 1:214151655-214151677 CTGGCTTGTTTCACTTAGCATGG - Intergenic
921653844 1:217710927-217710949 ATGACTTCTTTCACTTAGCATGG + Intronic
921895535 1:220396007-220396029 TTGGCTTCCTTGCCTTAGCAAGG + Intergenic
921895825 1:220399502-220399524 CTGGCTTTGTTCCTTTTGCAAGG + Intergenic
922135025 1:222815812-222815834 TTGTCTTATTTCCCTTGTCATGG + Intergenic
922817898 1:228464016-228464038 ACGGCATATTTCCCTTAGAAAGG - Intergenic
924487577 1:244501006-244501028 CTCTCTTATTTCCTTGAGCAGGG + Intronic
924669125 1:246105199-246105221 CTGGCTAAATTGACTTAGCAGGG + Intronic
924761569 1:246992270-246992292 CTGGCTTATTTTACTTAACGTGG - Intronic
924919079 1:248607200-248607222 TTGGCTTTTTTCTTTTAGCACGG - Intergenic
1062999124 10:1897892-1897914 CAGGCTTATTTCACTCATCATGG - Intergenic
1063600115 10:7473733-7473755 CTGGCTCCTTTCCCTGAGCAGGG - Intergenic
1064300773 10:14120859-14120881 CTGGCTGATGTCCCTTCACATGG + Intronic
1064488091 10:15818708-15818730 CTGGCTCCTTTCACTTAGCATGG - Intronic
1065629694 10:27665841-27665863 CTGCCTTATTTCACTTAATATGG - Intergenic
1067679136 10:48416488-48416510 TTGGGTTATTTCCCTTAAGAAGG - Intronic
1068409933 10:56641533-56641555 CTCTCTTATTTCCTTGAGCAGGG + Intergenic
1068430378 10:56923754-56923776 CTTGCTTATTTCACTTAGCTTGG + Intergenic
1068478465 10:57559014-57559036 CTGGCTTATTTCACTTAACATGG + Intergenic
1068976038 10:63010694-63010716 CTGGCTTCTTTCTCTCAACATGG - Intergenic
1070663928 10:78330137-78330159 CTGGCTTTTTTCCCAAAGCCAGG + Intergenic
1071105659 10:82091434-82091456 CTGGTGTATTTCACTAAGCATGG + Intronic
1073372809 10:103006128-103006150 TTGTCTTATTTCCCATTGCAGGG + Intronic
1074765628 10:116697946-116697968 CTGGCTTCTTTCACTTCACATGG + Intronic
1075005514 10:118827286-118827308 CTGGCTCAGTTCCCCAAGCAGGG - Intergenic
1075980870 10:126738032-126738054 CTGGCTTCTTTCACTTACCCTGG + Intergenic
1076589879 10:131575567-131575589 CTGGCTTATTTCACTTAGCACGG - Intergenic
1076658669 10:132040950-132040972 CTGGCTTATTTCACTTAGCATGG + Intergenic
1076664075 10:132076276-132076298 CTGGCTGCTTTCACTTAGCGTGG + Intergenic
1077325364 11:1961565-1961587 CTGGCTTATTTCACTTGGTGTGG + Intronic
1077517229 11:3009313-3009335 CTGGCTTATTTCGCTGATCACGG - Intronic
1078178233 11:8987040-8987062 CTGGCTAATTACCCTTATGATGG + Intronic
1078495472 11:11812336-11812358 CTGGCTTCTTTCACATAGCATGG - Intergenic
1079688854 11:23397461-23397483 CTGGCTTATTTCACTTACTGTGG - Intergenic
1080700435 11:34639769-34639791 CTGGCTGCTTTCCCTTGGAAAGG + Intronic
1080879470 11:36306000-36306022 CTAGCTTATGTCACTTAGCCAGG + Intronic
1081226627 11:40531812-40531834 CTGTCTTCTTTCCTTTACCATGG - Intronic
1081769546 11:45640341-45640363 CTGGCTTCTTTCACTTAGGATGG - Intergenic
1081791469 11:45789767-45789789 CTGACTTCTTTCACTTAACATGG - Intergenic
1081967461 11:47178311-47178333 CTGCCTTATCTGCCTGAGCAGGG - Intronic
1082209515 11:49481360-49481382 CTGGCTTATTTTACTTAACATGG + Intergenic
1082755493 11:57071971-57071993 AAGGCTCACTTCCCTTAGCAAGG - Intergenic
1084272747 11:68037991-68038013 CTGGGTTCTTTCCCTTACCGTGG + Intergenic
1084724347 11:70931089-70931111 CTGGCTGCTTTCACTGAGCATGG - Intronic
1085841942 11:80022014-80022036 CTGGCTTATTTCACTTAGCCAGG + Intergenic
1086640160 11:89144173-89144195 CTGGCTTATTTTACTTAAAATGG - Intergenic
1087977825 11:104571851-104571873 TTGGCTTATTTCACTTAGCATGG - Intergenic
1088127992 11:106451498-106451520 CTGACTTCTTTCACTTATCACGG + Intergenic
1088912587 11:114203177-114203199 CTTGCTTGTTTCACTTAGCACGG - Intronic
1090920144 11:131199605-131199627 CTGGCTTCTTTCACTAAGCATGG + Intergenic
1202808345 11_KI270721v1_random:16744-16766 CTGGCTTATTTCACTTGGTGTGG + Intergenic
1091480061 12:818742-818764 TTGGCGTCTTTCACTTAGCATGG + Intronic
1092027545 12:5255411-5255433 CTGACTTATTTCACTTAACATGG + Intergenic
1092130306 12:6107129-6107151 CTGGCTTCTTTCATTTAACATGG - Intronic
1094860578 12:34461657-34461679 CTGCATTCTTTTCCTTAGCAAGG - Intergenic
1095260633 12:40094798-40094820 CTGGGTTATTCCCATAAGCATGG - Intronic
1097258928 12:57702350-57702372 CTGGCTTATTTCACTTAGCATGG + Intronic
1097562856 12:61230060-61230082 CTGGCTTATTAAGCTCAGCATGG + Intergenic
1098018075 12:66127385-66127407 CTGGCTTATTTCCCTTAGCATGG - Intronic
1098219645 12:68255419-68255441 CTGATTTATTTCACTTAACATGG - Intergenic
1098879023 12:75897682-75897704 CTGGATTATGTTCCTTAGAAAGG - Intergenic
1098966729 12:76798227-76798249 CTGTGATATTTCCCTTAGCACGG - Intronic
1098975907 12:76901891-76901913 CTGGGTCATTTCACTTAGGAGGG - Intergenic
1099856299 12:88171471-88171493 CTGGCTTATTTCTCTTAACATGG + Intronic
1100271599 12:93030240-93030262 TTGGCTTCTTTCACTTAGCCTGG + Intergenic
1101154911 12:101918245-101918267 CTGTCTCATTTCACATAGCAAGG + Intronic
1101327605 12:103729785-103729807 CTGGCTTTTTTCCTTCTGCAAGG - Intronic
1101349516 12:103915859-103915881 CTGGCTCATTTCTCTTTGCTTGG + Intergenic
1102150187 12:110683993-110684015 CTGGCTTTTTTCACTTAGCATGG - Intronic
1102549493 12:113681302-113681324 CTGGCTTCTTTCACTTAACATGG - Intergenic
1102586141 12:113924269-113924291 CTGGGTTATCTCCCTCAGAAGGG + Intronic
1103047349 12:117748177-117748199 CTGGTTTGTTTCACTTAGCATGG - Intronic
1103793396 12:123487240-123487262 CTGGCTCCTTTCACTTAGCACGG + Intronic
1103820157 12:123691416-123691438 CTGGCTTCTTTCACTGAGCATGG + Intronic
1104046372 12:125165981-125166003 CTGGCTTATTTACATTAGCCAGG - Intergenic
1104206757 12:126645951-126645973 CTGGCTTCTTTCACTTAACATGG + Intergenic
1104302709 12:127580000-127580022 CTTTCTTATTTCTCTTTGCATGG + Intergenic
1104406620 12:128523130-128523152 CTGTCTTATTTCACTTAGCACGG - Intronic
1104584930 12:130040598-130040620 CTGGCTTCTTTCACTTAGCGTGG - Intergenic
1104683127 12:130765963-130765985 CTGGCTTCTTTCCCTTGGTGTGG - Intergenic
1106338107 13:28803204-28803226 CTGTCTTTCCTCCCTTAGCAGGG - Intergenic
1106993825 13:35457552-35457574 CTGCCTTCTTTCACTTAGCATGG + Intronic
1107165540 13:37278480-37278502 CTGGCTCATTTCACTTAACGTGG + Intergenic
1107288022 13:38818406-38818428 CTGGCTTATTTCACTTAACATGG - Intronic
1107556080 13:41517706-41517728 CTGGCTTGTTTCCATCACCATGG - Intergenic
1107794201 13:44033195-44033217 CTGGCTTATTTCTTTTTGGATGG - Intergenic
1108728784 13:53210330-53210352 CTGGTTTATTTTACTTAGCGTGG - Intergenic
1109664249 13:65509837-65509859 CTGGTTTATTTCACTTAGCAAGG + Intergenic
1110507836 13:76309614-76309636 CTGGCTTATTTTACTTAGCAGGG - Intergenic
1111684808 13:91488858-91488880 CTGAATTATTTTCCTCAGCAAGG + Intronic
1112395383 13:99025908-99025930 GGGGCTTCTTTCACTTAGCATGG - Intronic
1113283724 13:108821604-108821626 CTGGCTTATTTCCCAGACAAGGG + Intronic
1113486691 13:110658247-110658269 CTGGCTTATTTCACTTAGCATGG - Intronic
1113845954 13:113391706-113391728 CTGGCTAATTTCACTCAGCATGG + Intergenic
1114194995 14:20469365-20469387 CTGGCTTATATCCCTTGCCCTGG - Exonic
1114695746 14:24625884-24625906 CTGGCTTATCTTGCTTAGCATGG - Intergenic
1115063498 14:29224252-29224274 CTGTCTTGTTTTCCTTAGCTTGG - Intergenic
1115404367 14:32998248-32998270 CTGGCTTCTTTCACTTAGCGTGG - Intronic
1115779383 14:36752601-36752623 CTGGCTTATTCCATGTAGCATGG - Intronic
1115825698 14:37270609-37270631 CTGGCTTATTTGCCAAAGGAGGG + Intronic
1115962839 14:38854828-38854850 CTTGATTATTTGCCTTAGCCTGG - Intergenic
1116115462 14:40643869-40643891 CTGGCTTGTTTCACTTAGCATGG + Intergenic
1116177819 14:41495569-41495591 CTCTCTTATTTCCTTGAGCAGGG - Intergenic
1116380368 14:44260554-44260576 TTGGCTTATTTCACTTGACATGG - Intergenic
1116745712 14:48816024-48816046 TTGACTTATTTCACTTAACACGG - Intergenic
1117079944 14:52141486-52141508 GTGGCTTATTTGGGTTAGCAAGG + Intergenic
1118101863 14:62614705-62614727 CTGGCTTATTTTATTGAGCATGG - Intergenic
1118231407 14:63953856-63953878 CTGGCTTATTTCACTTGGCATGG + Intronic
1118754558 14:68830497-68830519 TTGGCTTATTTCACTTAACATGG + Intergenic
1120162371 14:81159827-81159849 CTGAGTTATTTCACTTAGGATGG - Intergenic
1120393199 14:83934635-83934657 TTGGCTTATTTCTCTTTGCATGG + Intergenic
1120582222 14:86266747-86266769 CTCTCTTATTTCCTTGAGCAGGG - Intergenic
1120995831 14:90418143-90418165 CTGGCTTTTTTCACTTAGCATGG + Intergenic
1121851404 14:97224304-97224326 CTGGCTTATTCCCATTCGTATGG + Intergenic
1124348604 15:28939126-28939148 CTGTCTTATTTCACTTCGCATGG + Intronic
1124909829 15:33908623-33908645 CTGGCTTATTTGTCTCAGCAAGG + Intronic
1126740160 15:51769251-51769273 CTGGTGTATTTCTCTTAGCCTGG + Intronic
1128373384 15:67057695-67057717 CTGATTTATTTCACTTAACATGG + Intergenic
1128977122 15:72162148-72162170 CTGGCTTCTGACCCTAAGCAAGG - Intronic
1129142271 15:73610475-73610497 CTGGGTTATTTCACTTAACATGG + Intronic
1129832075 15:78677220-78677242 CTGGCTTACTTCACTTAACATGG - Intronic
1131283882 15:91041868-91041890 CTGGCTTATTTCACTTAACATGG + Intergenic
1132226539 15:100146716-100146738 CTGAATTATTTTTCTTAGCAAGG + Intronic
1132575970 16:664323-664345 CTGGCTTCTCACCCTGAGCATGG + Intronic
1133260579 16:4547098-4547120 CTGGCTTCTTTCACTTAGGAAGG - Intergenic
1133497621 16:6334639-6334661 CTGTCTTATTTCACTCAGCCTGG - Intronic
1133521688 16:6564520-6564542 CTGGCTTATCTCACTTAGCACGG - Intronic
1135514808 16:23122673-23122695 CTGGCTTCTTTCACTTAGCATGG - Intronic
1137967326 16:52949009-52949031 CTGGCTTATTTCACTTAACAAGG - Intergenic
1138102708 16:54266828-54266850 CTGGCTTCTTTCATTTAGCATGG + Intronic
1138887592 16:61098303-61098325 CTGACTTGTTTTGCTTAGCATGG + Intergenic
1139840953 16:69879490-69879512 CTGGCTTATTTCACTTAATGTGG + Intronic
1140584453 16:76273254-76273276 CTGACTGATTTCGCTTAGCATGG - Intergenic
1140616376 16:76669225-76669247 CTGGCTTCCTTCACTTAGTATGG + Intergenic
1140860702 16:79015243-79015265 CTCGCTTTTTCCCCTTAGCTAGG - Intronic
1141458885 16:84164535-84164557 CTGGCTTCTTTCACTTAGCAAGG + Intronic
1141550932 16:84806328-84806350 CTGCCTTATTTTCCCTAACAGGG - Intergenic
1141648736 16:85381223-85381245 CTGGCTTCTTTCACTCAGCGTGG + Intergenic
1142368350 16:89663185-89663207 TTGGCTTTTTTCACTCAGCATGG - Intronic
1203116230 16_KI270728v1_random:1493430-1493452 CTAGCTAATCTCACTTAGCAAGG + Intergenic
1142524325 17:528367-528389 CTGGCTTCTTTCACTTAACATGG + Intronic
1142535088 17:609267-609289 CTGGCTTCTTTCACTCGGCATGG + Intronic
1142653573 17:1373930-1373952 CTGGCTTCTTTCCCATAGCATGG + Intronic
1142824926 17:2504091-2504113 GTGGTTTATTTCCCTTAGCATGG - Intronic
1143305110 17:5940385-5940407 ATAGCTTATTTCACTTAGCATGG - Intronic
1143468187 17:7152642-7152664 CTGGATAATTTTCCTTTGCATGG - Intergenic
1143930330 17:10416223-10416245 CTGGCTTATTTCACTCAGCATGG + Intronic
1144144736 17:12386548-12386570 CTGGCTTAAATCCCTGATCAAGG + Intergenic
1144235110 17:13253188-13253210 CTGGCTTGTTTCACTGAGGATGG + Intergenic
1144492424 17:15725128-15725150 CTTGCTCATTTCCCACAGCAAGG + Intergenic
1144908051 17:18654058-18654080 CTTGCTCATTTCCCCCAGCAAGG - Intronic
1147442084 17:40453559-40453581 CTGGCTAATTTCCCTTCTGAAGG + Intronic
1150120478 17:62597277-62597299 CTGGCTTCTTTCACTTACCATGG + Intronic
1150755666 17:67910140-67910162 CTGGCTTCATCCACTTAGCATGG + Intronic
1151016338 17:70558033-70558055 CTGAGATATTTCCCTTACCAGGG + Intergenic
1151231683 17:72689665-72689687 CTGGCTGCTTTCACTTAGCATGG - Intronic
1151692520 17:75695387-75695409 CTGGCTTCTTTCACTCAGCACGG + Intronic
1152024528 17:77800166-77800188 CTGGCTTCTTTCACTGAGCATGG - Intergenic
1203168910 17_GL000205v2_random:128589-128611 GTGGCTTATTTTACTTAACATGG - Intergenic
1153391584 18:4567954-4567976 TTGGTTTCTTTCACTTAGCATGG - Intergenic
1153824046 18:8858372-8858394 CTGGTTTCTTTCACTTAGCATGG - Intergenic
1154001333 18:10484687-10484709 TTGGCTTATTTCACTTACCAGGG + Intronic
1154469526 18:14685406-14685428 CTGGCTTATTTTACTTAACACGG + Intergenic
1155140936 18:23043904-23043926 CTGGTTTATTTCACTTAGCATGG - Intergenic
1155590076 18:27417888-27417910 CTGGCCTCTTTGACTTAGCATGG + Intergenic
1157162741 18:45329191-45329213 ATGTCTTATTTCCTTTGGCAAGG + Intronic
1158277300 18:55781919-55781941 CTGGATTATTTCCTTTAAAAAGG + Intergenic
1158512545 18:58104184-58104206 CTGGCTTCTTTCACTTAGCATGG - Intronic
1159068744 18:63598530-63598552 CTGGCGTCTTGCACTTAGCATGG + Exonic
1159610381 18:70518532-70518554 CTGGCTGATTTCCCTGCCCACGG + Intergenic
1160604193 18:80037036-80037058 CTGAATTATTCCCTTTAGCACGG + Intronic
1161245307 19:3248482-3248504 CTGGCTTATTTCACCGAGCATGG + Intronic
1162156668 19:8683189-8683211 CTGGCTTCTTTCACTTACTAAGG - Intergenic
1162330144 19:10023086-10023108 CTGGTTTATTTCACTCAGTATGG - Intergenic
1164204665 19:23048151-23048173 ATGCCCTAATTCCCTTAGCAGGG - Intergenic
1164726177 19:30467384-30467406 CTGGCTTATTTTGCTTAGCATGG + Intronic
1165604930 19:37093685-37093707 TTGGCTTCTTTCACTTGGCATGG - Intronic
926225325 2:10962897-10962919 CTGGCTTCTTTCACTTAGCATGG + Intergenic
926774036 2:16404667-16404689 TTGGCTTATTTCCCATCTCATGG + Intergenic
927858027 2:26539322-26539344 CTGCCTTTTTTCCCTTACCATGG - Intronic
928507987 2:31973689-31973711 CTGGCTTCTTTCACTTAGCATGG - Intronic
929480170 2:42298898-42298920 TAGGCTTATTTCCCTGTGCATGG - Intronic
929621072 2:43354625-43354647 CTGGCTTATTTCACTTAACATGG + Intronic
929643793 2:43607635-43607657 ATGGCTTATTGCCCTCTGCATGG - Intergenic
929895441 2:45956082-45956104 TTGGCTTTTTTCATTTAGCATGG + Intronic
929994201 2:46815118-46815140 CTGGCTTTCTTCCCTTTGCCTGG - Intergenic
930083214 2:47471531-47471553 CTGTGTTATTGCCCTTAGAATGG + Intronic
930282431 2:49386311-49386333 CTGGCTTTTTTCGCTTAACATGG + Intergenic
931812664 2:65869628-65869650 CTGACTTCTTTCCCTTATTAAGG - Intergenic
932738242 2:74270900-74270922 ATGGCCTCTTTCCCTTAGAATGG + Intronic
933511957 2:83251454-83251476 CTGGCTTCCTTCACATAGCATGG - Intergenic
933578468 2:84097705-84097727 ATGGCTTATCTCACTTAGCTTGG - Intergenic
933914087 2:86970894-86970916 CTGGCTTCTTTCATTTAGCAAGG + Intronic
934008906 2:87799004-87799026 CTGGCTTCTTTCATTTAGCAAGG - Intronic
935142132 2:100362553-100362575 CTGAATTATTTTTCTTAGCAAGG - Intergenic
935171802 2:100615999-100616021 CTGGCTTTTCTCCCTGGGCAGGG + Intergenic
935290567 2:101607322-101607344 CTGGCTTATTTCACTTAACTTGG - Intergenic
935772552 2:106440004-106440026 CTGGCTTCTTTCATTTAGCAAGG - Intronic
935907520 2:107855910-107855932 CTGGCTTCTTTCATTTAGCAAGG + Intronic
935930821 2:108122687-108122709 CTGACTTATTTCCCTGTGTATGG - Intergenic
935993922 2:108748065-108748087 CTGGCTTCTTTCATTTAGCAAGG + Intronic
936129311 2:109821050-109821072 CTGGCTTCTTTGATTTAGCAAGG + Intronic
936215386 2:110550435-110550457 CTGGCTTCTTTGATTTAGCAAGG - Intronic
936424523 2:112405008-112405030 CTGGCTTCTTTGATTTAGCAAGG - Intronic
936738843 2:115479283-115479305 CTAGCTTATTTCCCTTAGCATGG - Intronic
937226068 2:120369603-120369625 CTGGCTTCTTTCACTTGGCATGG + Intergenic
937812665 2:126216466-126216488 CTGGCTTATATCTCTTTCCAGGG - Intergenic
938203073 2:129392816-129392838 CTGTCTTATTTCATTTAACATGG - Intergenic
938252995 2:129830431-129830453 TTGGCTTATTTCACTTAAGATGG - Intergenic
939119809 2:138102607-138102629 CTTGCATATCTCCATTAGCATGG - Intergenic
940085771 2:149856796-149856818 TTTGCTGAATTCCCTTAGCAAGG + Intergenic
940759756 2:157724808-157724830 CTGGCTTATTTCGGTTAGCATGG - Intergenic
940936553 2:159502041-159502063 CTGGCTTCTTTTACTTAGCTCGG - Intronic
941126300 2:161587903-161587925 CTGGCTTATTTCTCTTAGCATGG + Intronic
941467609 2:165848249-165848271 TTGGCTTATTTCACTTAATATGG + Intergenic
942304603 2:174593881-174593903 ATGGCTTATTGCTCTGAGCAAGG - Intronic
942327254 2:174786538-174786560 CTGGCTTATTTCCCTTGGCACGG - Intergenic
942742313 2:179194745-179194767 CTGTCTTATTTCCCTTAGTTTGG - Intronic
942857811 2:180571914-180571936 CTGGCTTCTTTCACTTAGCATGG - Intergenic
942978750 2:182052445-182052467 CTTGATTATTTCACTTATCAAGG - Intronic
944159904 2:196648023-196648045 CTGGCTTATTTCCCTATTGATGG + Intronic
944495454 2:200303265-200303287 CTGGGTTATCTCCCATAGGAAGG - Intergenic
944546376 2:200802986-200803008 CTGGCTTATTTCATTTAGCAAGG - Intergenic
944847443 2:203682774-203682796 CTTCCTTCATTCCCTTAGCACGG - Intergenic
944938788 2:204599455-204599477 CTGGCTTATTTCACTTAACCTGG + Intronic
945287080 2:208093842-208093864 CTGGCTTGTTTTCCTTAGGCAGG + Intergenic
947224546 2:227827138-227827160 CTGGCTTCTTTACCATGGCATGG + Intergenic
948538897 2:238671069-238671091 CTGGCTTCTTTCGCTCAACATGG + Intergenic
1169584977 20:7071371-7071393 CTGTGTTATTTTCCTTAGTAAGG + Intergenic
1171026819 20:21638390-21638412 CTGGCTTATTTCACTTAGCGTGG + Intergenic
1171119061 20:22552522-22552544 CTAGCTTATTTGACTTAGCTTGG - Intergenic
1171441875 20:25170743-25170765 CTCTCTTATTTCCTTGAGCAGGG - Intergenic
1172059783 20:32179372-32179394 CTTGCTTATTTCCCTCATTATGG + Intergenic
1172784256 20:37456080-37456102 CTGTCTTTTTTCCATTAACATGG + Intergenic
1174407716 20:50312931-50312953 TGGGCTTATTTTCCTTGGCAAGG + Intergenic
1175435309 20:58943070-58943092 CCAGCTTCTTTCGCTTAGCATGG - Intergenic
1176333016 21:5567148-5567170 GTGGCTTATTTTACTTAACATGG + Intergenic
1176394741 21:6253804-6253826 GTGGCTTATTTTACTTAACATGG - Intergenic
1176402844 21:6330565-6330587 GTGGCTTATTTTACTTAACATGG + Intergenic
1176410069 21:6444832-6444854 CTAACTTATTTCACTTTGCATGG - Intergenic
1176434313 21:6658539-6658561 GTGGCTTATTTTACTTAACATGG - Intergenic
1176442416 21:6735300-6735322 GTGGCTTATTTTACTTAACATGG + Intergenic
1176458575 21:6985609-6985631 GTGGCTTATTTTACTTAACATGG - Intergenic
1176466678 21:7062370-7062392 GTGGCTTATTTTACTTAACATGG + Intronic
1176490239 21:7444148-7444170 GTGGCTTATTTTACTTAACATGG + Intergenic
1176804977 21:13472244-13472266 CTGGCTTATTTTACTTAACACGG - Intergenic
1177578518 21:22989423-22989445 CTGGTTTATTTCACTTGACATGG - Intergenic
1177891780 21:26813406-26813428 TTGGCTTCTTTCCCTCAGAATGG - Intergenic
1179491643 21:41745048-41745070 TTGCCTTCTTTCCCTTATCAGGG + Intronic
1179685562 21:43053154-43053176 CTAACTTATTTCACTTTGCATGG - Intergenic
1179882347 21:44298399-44298421 CTGTCTTATTTTACTCAGCATGG + Intronic
1180730461 22:17978263-17978285 CTGGCTGCTTTCACTTAGCATGG - Intronic
1180929828 22:19581818-19581840 CTGGCTTATTTCACCGGGCATGG - Intergenic
1181328190 22:22067560-22067582 TTGGCTCATTACCCTTTGCAAGG + Intergenic
1181365718 22:22375754-22375776 CTGGCAGAGTTCCCTGAGCAGGG + Intergenic
1182014558 22:27028787-27028809 CTGGCTTCTTTCACTTAGCGTGG - Intergenic
1182342490 22:29635036-29635058 CTGGCTTTTATCTTTTAGCAGGG - Intronic
1182878275 22:33711187-33711209 CTTGCATAGCTCCCTTAGCAGGG - Intronic
1183286013 22:36964490-36964512 CTGGCTTATTCCCCTCCACATGG - Intergenic
1184044397 22:41963675-41963697 CAGCCTTCTTTCCCTTTGCAGGG - Intergenic
1185379352 22:50500700-50500722 CTGGCTTCTTTCACTCAGCACGG - Intergenic
949300808 3:2581868-2581890 CTGGCTTCATTCACTTAGCACGG - Intronic
949724652 3:7029577-7029599 CTGGCTTATTACCCTTTGCAAGG - Intronic
950047833 3:9961066-9961088 CTGACTTTTGTCCCTAAGCACGG + Intergenic
952150588 3:30585670-30585692 CTGCTTTATCTCCCTTAGCAGGG - Intergenic
952381005 3:32805294-32805316 ATGGCTTATTTCACTTATTATGG - Intergenic
952461588 3:33532245-33532267 CTGGCTTATTTCATTTAGCGTGG - Intronic
952665076 3:35894567-35894589 GTGGCTTCTATCCCTGAGCAAGG - Intergenic
953011224 3:39027195-39027217 CTGTCTTGTTTACCTTGGCATGG + Intergenic
953280801 3:41554427-41554449 CTGGCTGATTTCACTTAACATGG - Intronic
954667182 3:52262128-52262150 CTGGCTTCTTTTACTTAGCATGG - Intronic
955101665 3:55855794-55855816 ATGCCTTATTTCCCTTCCCATGG + Intronic
955310578 3:57882589-57882611 ATGGCTAATTTCCCTTATAATGG - Intronic
956158747 3:66325728-66325750 CTGGCTCATTTCCCATAACCGGG - Intronic
956159857 3:66338845-66338867 CTGGCTTATTTTACCTGGCATGG + Intronic
956301251 3:67775010-67775032 CTGGCTCTTTGCCCTTACCAGGG - Intergenic
956630007 3:71307262-71307284 CTGCCCTATTTCCCTTGGCTAGG - Intronic
957354127 3:79059998-79060020 CTGAATTATTTTCCTCAGCAAGG + Intronic
958015918 3:87940479-87940501 CTCTCTTATTTCCTTGAGCAAGG - Intergenic
958542198 3:95493058-95493080 CTGGCTTACTTTCCCAAGCATGG + Intergenic
958646392 3:96880802-96880824 CTGGCTTCTTTTACTTAGCGTGG + Intronic
959473304 3:106779672-106779694 CTGACTTATTTCACTTAAAAAGG - Intergenic
959818149 3:110700791-110700813 CTGGCTTATTTCACTTAACATGG + Intergenic
960338404 3:116445767-116445789 CTGGCTGATTTCCTTAAGAAGGG + Intronic
961380797 3:126495417-126495439 CTGGGTTATTTCACTTAGCATGG + Intronic
961967180 3:130917910-130917932 CTGGCTTATTTCACTTAGCATGG + Intronic
962143038 3:132810647-132810669 CTGGCATATTCTACTTAGCATGG + Intergenic
962585206 3:136835742-136835764 TTGGCTTATTTCCATCAGCGTGG + Intronic
963702000 3:148638221-148638243 CTGAGTTATTTCTCTTAGAATGG - Intergenic
964350759 3:155801595-155801617 CTGGCTTTTTTCACTTAGCCTGG - Intronic
964372393 3:156014149-156014171 CTGGCTTATCTCATTTAACATGG - Intergenic
964554446 3:157920595-157920617 CGGGATGATTTCCCTTAGAAAGG - Intergenic
964865438 3:161254410-161254432 CTGGTTTCTTTCACTCAGCATGG + Intergenic
965050259 3:163637726-163637748 CTGGCTTATTTCACTTAGCATGG - Intergenic
966600244 3:181767701-181767723 TTGGCTTTTTACTCTTAGCAAGG - Intergenic
968232823 3:197014230-197014252 CTGGCTTATTTCACATAACACGG - Intronic
968719585 4:2191218-2191240 TTGGCTTATTTCACTTAACATGG - Intronic
968886565 4:3337575-3337597 CTGGCTGATTTTGCTGAGCATGG - Intronic
968961887 4:3749771-3749793 CTGGCTGATTTCGCTGAGCATGG + Intergenic
970338421 4:15078704-15078726 CTGACTTATTTCATGTAGCACGG - Intergenic
970367519 4:15374807-15374829 CAGGCTTTTTTTCCTTAGAAAGG + Intronic
971831093 4:31696095-31696117 TTGGCTTTTTTCACTTACCAGGG + Intergenic
974351849 4:60758452-60758474 CAGGCTTCTTCCCCTTTGCAGGG - Intergenic
976171049 4:82304691-82304713 CTGTCTTATTTCACTTAGTGAGG - Intergenic
976497232 4:85744299-85744321 CTGGCTTATGTTCCTTGGAATGG + Intronic
978608087 4:110504297-110504319 CTGGCTTCTTTTCCTTAGGGTGG + Intronic
978925690 4:114240214-114240236 CTGAGTTATTTCACTTAGGATGG + Intergenic
979026729 4:115587030-115587052 CTCTCTTATTTCCTTGAGCAGGG + Intergenic
981316852 4:143349085-143349107 CTTGCTTATTTCCCCTCCCATGG + Intronic
982361782 4:154526209-154526231 CTAGCCTATTTCACTCAGCATGG - Intergenic
982639539 4:157940950-157940972 CTGGCTTATTTCACTTGGTATGG - Intergenic
983309899 4:166046260-166046282 CAGGCTTGTTTCCCTCTGCATGG - Intronic
984893767 4:184517104-184517126 CTGGTTACTTTCCCTTAGGAGGG + Intergenic
987538078 5:19214349-19214371 CTGACTTATTTCACTTAACATGG - Intergenic
987769698 5:22284865-22284887 CTGGCTTCTTTCCCTTTTCCTGG - Intronic
989441672 5:41479205-41479227 CTGGCTTATTTCACTTTGCATGG - Intronic
993310372 5:86323434-86323456 CTGGCTTATTTCATGTAACATGG - Intergenic
993392952 5:87343940-87343962 CTGGCTTATTTCACTTAACATGG - Intronic
993981883 5:94552741-94552763 CTGGCTTATTTCATTTAACATGG - Intronic
995600713 5:113792287-113792309 CTGGCTTTTTTCATTTAGTATGG - Intergenic
997183184 5:131854211-131854233 CTAGTTTATGTCACTTAGCATGG - Intronic
997653611 5:135539432-135539454 CTTGCTTCTTTCTCTGAGCAGGG + Intergenic
997709114 5:135988488-135988510 CTGGCTTATTTTGCTTAACATGG + Intergenic
998290958 5:140914402-140914424 CTGTTTTGTTTCCATTAGCAAGG + Intronic
999451209 5:151679535-151679557 AAGGCATATTTCCCTTGGCATGG + Intronic
1001681691 5:173562657-173562679 CGGGCTTGTTTCCCTTAAGATGG + Intergenic
1002312149 5:178321406-178321428 CTGTCTTGTTTCCCTGAGCATGG + Intronic
1005054623 6:21717857-21717879 GAGGGTTATTTCCCTTTGCAAGG + Intergenic
1005178552 6:23076379-23076401 CTTGCTTATTTCACTTAACATGG - Intergenic
1005215928 6:23527929-23527951 CTGGCTTATTTCACTTATTTAGG - Intergenic
1008434312 6:51457096-51457118 CTCGAATATTTCCCTTAACATGG - Intergenic
1008894229 6:56534132-56534154 CTGGCTTATTTCACTTAGCATGG - Intronic
1010500129 6:76588519-76588541 ATGGTTTACTTCCCTTTGCATGG + Intergenic
1010838292 6:80616531-80616553 CTCTCTTATTTCCTTGAGCAGGG - Intergenic
1011109634 6:83822739-83822761 CTTGCTTCTTTTACTTAGCATGG + Intergenic
1011147803 6:84237973-84237995 CTCTCTTATTTCCTTGAGCATGG - Intergenic
1011339276 6:86294795-86294817 CTGGCTTCTTTCTCTCAACAAGG + Intergenic
1012486505 6:99727474-99727496 CTGGCTTATTTCACTTAATATGG + Intergenic
1014029598 6:116685240-116685262 CCGGCTTCTTTCATTTAGCACGG - Intronic
1014478599 6:121906567-121906589 CTGCCTTATTTCACTCAACATGG + Intergenic
1015904051 6:138098017-138098039 CTGGCTTCTTTCACTGAGTATGG + Intronic
1016012703 6:139154887-139154909 CAAGCTTATTTTCCTAAGCAAGG + Intronic
1016604202 6:145900374-145900396 CTGGTTTATTTCAGTTAGCATGG - Intronic
1019149694 6:169997064-169997086 CTGGCTTATTCCACTGAGCATGG - Intergenic
1019303322 7:320476-320498 CTGGCTTCTTTCCCTGAGCAGGG - Intergenic
1020916069 7:14194419-14194441 CTGGCTTATTTCGGTTAACACGG - Intronic
1023149438 7:37187181-37187203 CTGGCTTCTTTCACTTAGCATGG - Intronic
1023197176 7:37653876-37653898 CTGGCTTAGTTTATTTAGCATGG + Intergenic
1025880953 7:65536082-65536104 CTGGCTTATTTCACTTTACATGG - Intergenic
1028146276 7:87323374-87323396 CTGTCTTATTTCCCTCCTCAAGG + Intergenic
1028781397 7:94741161-94741183 CTGGCTTATTTCGCTTAGCCTGG - Intergenic
1029062195 7:97810186-97810208 CTGGCTTACTTCTCTTAACATGG - Intergenic
1030947536 7:115742415-115742437 CTGGCTTCTTTCACTTAGCATGG - Intergenic
1031797672 7:126196847-126196869 CTGGCTTCTTTTACTTAACATGG - Intergenic
1032161985 7:129517966-129517988 CTGGCGTCTTTCACTTAGCACGG - Intergenic
1032755517 7:134887016-134887038 CTGTCTTATTGCCCTTATAATGG - Intronic
1035622833 8:1047255-1047277 CTGGTTTCTTTCACTTAGCAAGG + Intergenic
1035818236 8:2563145-2563167 CTGGCTTATTTCACTTAGCATGG + Intergenic
1036198704 8:6747247-6747269 CTGGCTTCTTTCGCTCAGCATGG - Intronic
1036584866 8:10114082-10114104 CTGGCTTCTTTTGCTTAGCATGG + Intronic
1038001668 8:23397076-23397098 CTGGCTCATTTTACTTAGCATGG - Intronic
1038599308 8:28923293-28923315 CTGGCTTATTTTGCATAGCCAGG + Intronic
1039625205 8:39043028-39043050 CTGCCTTATTTCTCTTAGCATGG + Intronic
1039740611 8:40379445-40379467 CTGGCTTCTTTCCCTTGCCCTGG + Intergenic
1040092436 8:43411737-43411759 CTGGCATGTTTCACTTAGCATGG + Intergenic
1040367836 8:46737378-46737400 CTGGCTTACTTCACTTAACATGG + Intergenic
1040674575 8:49733443-49733465 CTGGCTTGCTTCTCTTGGCAGGG - Intergenic
1040732489 8:50465718-50465740 TTGGCTTTTTTCACTTAGCAAGG + Intronic
1040893696 8:52343214-52343236 CTGGTTTATTTCCATACGCAGGG - Intronic
1041262405 8:56033192-56033214 CTGGCTTATTTCACTTAACATGG - Intergenic
1041513826 8:58678010-58678032 CTGACTTCCTTCACTTAGCATGG + Intergenic
1042084451 8:65092564-65092586 CTGAATTATTTTTCTTAGCAAGG + Intergenic
1042230564 8:66550125-66550147 CTGGCTTATTTCACTTAGCAAGG - Intergenic
1042953809 8:74227149-74227171 ATTCCTTATTTACCTTAGCATGG - Intergenic
1043594306 8:81866035-81866057 CTCTTTTATTTCCATTAGCATGG - Intergenic
1043705919 8:83350547-83350569 CTGGGTTATTTCACCTAGCATGG + Intergenic
1043960122 8:86408164-86408186 TTGGCTTCTTTCACTTAGCAAGG + Intronic
1044634202 8:94306367-94306389 CTGACTTCTTTCACTTAGCATGG - Intergenic
1046487563 8:114907888-114907910 CTGGCTTATTTTACTTAACACGG - Intergenic
1047328851 8:123866204-123866226 CTTGCTTATTTTACTTAGCACGG + Intronic
1047543167 8:125790322-125790344 CTGTCTTATTACCCTTGGCCAGG + Intergenic
1047766334 8:127992897-127992919 CTGGCTTGTATCCCTTGACAGGG - Intergenic
1049201414 8:141342323-141342345 CTGGCTTCTTTCACTTAGCACGG + Intergenic
1049984592 9:937114-937136 CTGGCTTATTTCACTAAGCACGG + Intronic
1050050410 9:1595180-1595202 CTGACTTCTTTCACTTAGCGTGG - Intergenic
1050865562 9:10493077-10493099 CTCTCTTATTTCCGTCAGCAGGG - Intronic
1050953404 9:11626068-11626090 TTGGCTTCTTTCACTTAGCATGG - Intergenic
1052321932 9:27176955-27176977 CTGGCTTATTTCACTTAGCATGG + Intronic
1052452102 9:28644397-28644419 CTAGCTTATGTCACTTAGCCAGG - Intronic
1052642191 9:31182552-31182574 CTGGCTTATTTCACCTAGCATGG - Intergenic
1053551881 9:39089323-39089345 GTGGCCTCTTTCACTTAGCATGG + Intronic
1053816012 9:41909461-41909483 CTGGCCTCTTTCACTTAACATGG + Intronic
1054614585 9:67277980-67278002 CTGGCCTCTTTCACTTAACATGG - Intergenic
1055191576 9:73530847-73530869 GTGGCTTATTTCCTTTGGGATGG - Intergenic
1055289787 9:74770694-74770716 CTGGCTTTTTGCCCGAAGCAGGG - Intronic
1055424762 9:76182743-76182765 CTGGATAATTTCTCTTAACAAGG + Intronic
1057461090 9:95262832-95262854 TTGTCTGATTTCACTTAGCATGG - Intronic
1059649484 9:116302495-116302517 CTGGATTATTTCCCTTAACATGG + Intronic
1059987062 9:119830713-119830735 CTGACTTCTTTCCCCTATCAGGG + Intergenic
1060572605 9:124656453-124656475 CAGGCTTATTTCACTTAGCATGG - Intronic
1061228632 9:129297762-129297784 CTCTCTTATTTCCTTGAGCAGGG + Intergenic
1062002412 9:134223205-134223227 CCGGCTTCTTTCACTGAGCATGG + Intergenic
1062113146 9:134793317-134793339 CTGTCTTCTTGCCCTTAGGAAGG - Intronic
1062484460 9:136768148-136768170 CTGGCTTCTGTCCCTCTGCAGGG - Intergenic
1203429069 Un_GL000195v1:73134-73156 GTGGCTTATTTTACTTAACATGG - Intergenic
1203437223 Un_GL000195v1:150103-150125 GTGGCTTATTTTACTTAACATGG + Intergenic
1185837347 X:3357355-3357377 CTGGCTTCTTTTACTGAGCATGG + Intergenic
1186142860 X:6595382-6595404 CTGGCTTCTTTCACTGAGCTTGG - Intergenic
1186879292 X:13848926-13848948 CTGGCTTTTTTCTCTGAGCATGG - Intronic
1188275162 X:28191649-28191671 CTGGCTTATTTCACTTAATATGG + Intergenic
1188772409 X:34168754-34168776 CTCTCTTATTTCCTTGAGCATGG - Intergenic
1189081166 X:37973925-37973947 TTGGCTTATTTCACTTAGCATGG - Intronic
1189327064 X:40119170-40119192 CTGGCTTCTTTTCATTTGCAAGG - Intronic
1189451295 X:41133707-41133729 TTGGCTTATTTCACTTACCATGG + Intronic
1189711750 X:43819807-43819829 ATGTCTCATTTCCTTTAGCAAGG - Intronic
1192002016 X:67161697-67161719 CTTTCTTATTTCCATTGGCAAGG - Intergenic
1192301204 X:69904793-69904815 CTGACTTATTTCATTTAACATGG + Intronic
1193843144 X:86434469-86434491 ATGGCTCATTTCTCTTATCATGG + Intronic
1193920676 X:87421956-87421978 CTGGGTTATTTCACTTGGCATGG + Intergenic
1195831664 X:109066124-109066146 CTGGCTTATTTCACTTATCATGG + Intergenic
1196267987 X:113675339-113675361 CTGGCTTCCTTCCCTTTCCATGG - Intergenic
1197006173 X:121501396-121501418 CTGGGTTTTTTCACTTAGCATGG + Intergenic
1197661297 X:129176357-129176379 TTGGTTTGTTTCCATTAGCATGG + Intergenic
1199179372 X:144835637-144835659 CTGGCTTATTTCACTTAACATGG - Intergenic
1199395884 X:147337017-147337039 CTAGCTTTTTTCACTTGGCATGG - Intergenic
1200013112 X:153135435-153135457 CTGGCCTATTTCACGTAACATGG + Intergenic
1200026488 X:153264488-153264510 CTGGCCTATTTCACGTAACATGG - Intergenic
1200271910 X:154693468-154693490 CTGGCTTCTTTCACTCAGAATGG - Intronic
1200860991 Y:7992451-7992473 CTGAATTATTTCTCTCAGCAAGG - Intergenic
1201238458 Y:11934437-11934459 CTGGCTTCATTCACTAAGCATGG - Intergenic
1201624215 Y:15996398-15996420 CTGACTTATTTCACTGAGCCCGG - Intergenic
1201688957 Y:16741229-16741251 CTGAGTTACTTCCCTTAGAATGG + Intergenic