ID: 1098018358

View in Genome Browser
Species Human (GRCh38)
Location 12:66130258-66130280
Sequence CAGTCTGGGGAGAGGGTCGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 472
Summary {0: 1, 1: 0, 2: 1, 3: 29, 4: 441}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1098018358_1098018368 -2 Left 1098018358 12:66130258-66130280 CCCCCGACCCTCTCCCCAGACTG 0: 1
1: 0
2: 1
3: 29
4: 441
Right 1098018368 12:66130279-66130301 TGTAGACTCCACGAAGGTAGAGG 0: 1
1: 0
2: 0
3: 8
4: 149
1098018358_1098018369 -1 Left 1098018358 12:66130258-66130280 CCCCCGACCCTCTCCCCAGACTG 0: 1
1: 0
2: 1
3: 29
4: 441
Right 1098018369 12:66130280-66130302 GTAGACTCCACGAAGGTAGAGGG 0: 1
1: 0
2: 1
3: 7
4: 56
1098018358_1098018370 4 Left 1098018358 12:66130258-66130280 CCCCCGACCCTCTCCCCAGACTG 0: 1
1: 0
2: 1
3: 29
4: 441
Right 1098018370 12:66130285-66130307 CTCCACGAAGGTAGAGGGAAAGG 0: 1
1: 0
2: 0
3: 8
4: 191
1098018358_1098018367 -8 Left 1098018358 12:66130258-66130280 CCCCCGACCCTCTCCCCAGACTG 0: 1
1: 0
2: 1
3: 29
4: 441
Right 1098018367 12:66130273-66130295 CCAGACTGTAGACTCCACGAAGG 0: 1
1: 0
2: 9
3: 67
4: 458

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1098018358 Original CRISPR CAGTCTGGGGAGAGGGTCGG GGG (reversed) Intronic
900140796 1:1138845-1138867 CCGTCTGGGGACAGGTTGGGGGG + Intergenic
900520780 1:3104614-3104636 GGGTCTGGGGAGAGGGCCGCTGG - Intronic
900534394 1:3169801-3169823 CAGCCAGGGGAGAGGGCCCGAGG - Intronic
900887120 1:5423049-5423071 CAGTTTGTGGAGAGGGTAAGAGG - Intergenic
901823552 1:11846126-11846148 CAGGCTGGGGTGGGGGCCGGTGG - Intronic
902050768 1:13562169-13562191 CAGTCTGGGGAGGAGGTGAGAGG - Intergenic
902112964 1:14098600-14098622 CAGTCTGGGCAGAGGGATGCTGG - Intergenic
902140677 1:14351065-14351087 CACTCTGCGGAGAGGGACTGGGG - Intergenic
902568721 1:17332802-17332824 CAGGCTGGGGAGGGGGTGGTCGG + Intronic
902641522 1:17769280-17769302 GAGTGTAGGGAGAGGGTCTGGGG + Intronic
902962926 1:19977468-19977490 CACTGTGGGGACAGGGTCGATGG - Intronic
903065476 1:20697006-20697028 CTGTTTGGGGAGAGGCTCGATGG - Intronic
903322097 1:22549576-22549598 GAGGCTGGGGAGACGGTAGGTGG - Intergenic
903682782 1:25108276-25108298 AAGTCTGGGGACAGGGACAGTGG + Intergenic
903686316 1:25134918-25134940 TAGTCTGGGGACATGGTGGGTGG - Intergenic
904047704 1:27618621-27618643 AAGTCTGGGGAGGTGGTAGGAGG - Intronic
905227985 1:36492555-36492577 CAGCCTGGGGAGAGAGGCTGGGG - Intergenic
905253600 1:36665727-36665749 GAGTGTGGGGAAAGGGTCGAAGG + Intergenic
905269217 1:36775953-36775975 CAGACTGGGGAGAGGGTCCAAGG - Intergenic
905314407 1:37072597-37072619 CTGGCTGGGCAGAGGGTTGGGGG - Intergenic
905399573 1:37691886-37691908 CAGTCTGGGCAGCGAGTGGGGGG - Intronic
905457839 1:38100679-38100701 CAGTCTGGGAAGAGGGGCCTTGG + Intergenic
905485381 1:38292420-38292442 CAGGCTGGGCAGCGGGCCGGTGG - Intergenic
905791642 1:40792660-40792682 CAGTCTGGTGGGAGAGACGGGGG + Intronic
905869434 1:41394707-41394729 CCCTCTGGGGAGAGGGTGGTGGG + Intergenic
907091542 1:51729877-51729899 CAGTCCGGGGATCGGGTCGAGGG + Intronic
907251693 1:53143770-53143792 CAGTCTGCAGTGAGGGTGGGAGG + Intergenic
907695314 1:56720764-56720786 CTGTCTGGGGATAGGGTGCGGGG - Intronic
909729290 1:78873548-78873570 CAGTCTGGGGAGGAGGTGAGAGG - Intergenic
910236126 1:85038141-85038163 CAGCCTAGGGAGTGGGTGGGAGG + Intronic
910430428 1:87154655-87154677 CAGTCTGGGCAGAGGGGAGTGGG - Intronic
911666066 1:100554020-100554042 GACTCTGGGGAAAGGGTGGGAGG - Intergenic
914835698 1:151205109-151205131 CAAACTGGGGAGAGGGAAGGTGG + Intronic
915004424 1:152623302-152623324 CAGGCAGGGGAGAGGGCCGGAGG - Intergenic
915206358 1:154273215-154273237 GAAGCTAGGGAGAGGGTCGGAGG - Intronic
915278290 1:154804888-154804910 CAGTGTGTGCAGAGGGTTGGAGG - Intronic
915361338 1:155288026-155288048 GAGTCAGGGGAGAGGGGCAGAGG - Exonic
920237221 1:204516252-204516274 TAGTCCGGGGAGAGAGTCGTGGG - Intergenic
920585748 1:207158209-207158231 CATTCTGGGAAGAGGGCCTGGGG + Intergenic
922845554 1:228681388-228681410 CAGTCTGGGGAGGAGGTGAGGGG + Intergenic
1063094257 10:2895753-2895775 CAGCCTGGGGAGAGGCTGAGAGG + Intergenic
1063355865 10:5397857-5397879 GAGTCTGGGAAGATGGTCTGGGG - Intronic
1063428598 10:5968335-5968357 CAGGCTGGGGGCAGGGTGGGAGG + Intronic
1065445108 10:25790181-25790203 CAGCCTGGGGTGGGGGTGGGTGG + Intergenic
1067341978 10:45412949-45412971 TAGTCCTGGGATAGGGTCGGGGG - Intronic
1067563133 10:47317839-47317861 GAGTCTAGGGAGAGGGCCAGAGG - Intergenic
1069605738 10:69737597-69737619 CAGGCTGGGCACAGGGTGGGCGG - Intergenic
1069841295 10:71341039-71341061 CAGTCTGGGGAGAGGAGAGGCGG + Intronic
1069948809 10:72005607-72005629 CTGTCTGGAGAGTGGGTCTGGGG + Intronic
1070357386 10:75653590-75653612 CAGTCTTGGGAGAGTGCCTGTGG + Intronic
1070683490 10:78465285-78465307 TGGGCTGGGGAGAGGGTGGGGGG + Intergenic
1070807117 10:79277097-79277119 CAGTCTGGGGAGAGTTGGGGGGG + Intronic
1073013786 10:100382284-100382306 CAGCCTGGGGAGAAGGGGGGAGG - Intergenic
1073563246 10:104514931-104514953 CAGACTGGGGGCAGGGTGGGGGG - Intergenic
1074574077 10:114651988-114652010 CAGTCAGGAGAGCGGGTCTGAGG + Intronic
1074971854 10:118545469-118545491 CAGTGTGGGGAGAGGGTGCTGGG - Intergenic
1075512188 10:123081509-123081531 CTGGCTGGGGAGAGGGGCGGCGG - Intergenic
1075847498 10:125556492-125556514 TAGGGTGGGGAGAAGGTCGGGGG + Intergenic
1076211229 10:128646618-128646640 AAGTCTGGGGAGATGCTCAGTGG + Intergenic
1076497300 10:130905496-130905518 CAGTAGGGGCAGAGGCTCGGCGG - Intergenic
1076799657 10:132814715-132814737 CAGTCAGGGGGGATGGTCCGGGG + Exonic
1077150825 11:1072398-1072420 CAGGGTGGGGAGAGGCTGGGGGG + Intergenic
1077199490 11:1298378-1298400 CAGTCGGGGGAGGGTGTGGGTGG + Intronic
1077426597 11:2482643-2482665 CAGTGTGGGGTGGGGGTTGGCGG - Intronic
1077747908 11:4928037-4928059 GCGTGTGGGGAGAGGGTCGAGGG + Intronic
1078427270 11:11261938-11261960 CAGTCAGGGGAGACGGGAGGAGG + Intergenic
1079244751 11:18743959-18743981 GGGTCTGGAGAGAGGGTGGGTGG - Intronic
1081520975 11:43880850-43880872 CAGACTGCGGAGTGGGTCAGGGG + Exonic
1081617914 11:44601402-44601424 CATTCTGGGGTTAGGGTGGGTGG + Intronic
1083159215 11:60844283-60844305 AAGTCTGGAGAGAGGGTGTGTGG + Intronic
1083470611 11:62881507-62881529 CCGTCTGGGGACAGGGGAGGGGG - Intronic
1083491873 11:63019651-63019673 CAGTCTGGGGAGCAGGACAGGGG - Intergenic
1083752148 11:64766682-64766704 GTGTCTGGGGAGAGGTTCGTGGG - Intronic
1083962107 11:66020386-66020408 CAGGCTGGGGAGAGGGACAGGGG + Exonic
1083993577 11:66261156-66261178 GAGGCTGGGGAGAGGGGTGGGGG + Intronic
1084047070 11:66575241-66575263 CAGCCTGGGGAGCGGGGAGGAGG - Intergenic
1084376023 11:68778226-68778248 TAGTCTTGGGAGAGGGTAGCAGG + Intronic
1084490664 11:69476566-69476588 CGGGCTGGGGAGAGGGAAGGGGG - Intergenic
1085237655 11:75027454-75027476 CAGTTTAGGCAGAGGGGCGGGGG - Intergenic
1085280227 11:75325252-75325274 GGGGCTGGGGTGAGGGTCGGGGG - Intronic
1085986059 11:81789928-81789950 CATTCGGGGGAAAGGGTGGGAGG + Intergenic
1089334340 11:117712847-117712869 CAGGGTGGGGAGAGAGGCGGGGG - Intronic
1090483679 11:127091663-127091685 GACTCTGGGGAAAGGGTGGGGGG + Intergenic
1091324050 11:134670898-134670920 CAGTCTGAGATGAGGGTGGGTGG + Intergenic
1093490685 12:19700941-19700963 CAGTCGGGGGAGGGTGTGGGTGG - Intronic
1093639503 12:21509978-21510000 CAGTGTTTGGAGAAGGTCGGGGG + Intronic
1095930183 12:47617830-47617852 CAGGTTGGGGAGAGGGTAAGAGG - Intergenic
1095999182 12:48114559-48114581 CAGTCTGGGGAGGAGGTGAGAGG + Intronic
1096113107 12:49040537-49040559 CACTCGGGAGAAAGGGTCGGAGG + Exonic
1096122105 12:49094847-49094869 CGGTCTTGGGAGAAGGGCGGAGG - Intergenic
1096756205 12:53802134-53802156 CAGTCTGGGAAGTGGGTGGGTGG + Intergenic
1096788076 12:54029220-54029242 CAGTCTGAGGAGAAGGGAGGGGG + Intronic
1097185869 12:57196024-57196046 CAGTCTGGGGAGGGGGCAGAGGG - Intronic
1097899518 12:64858840-64858862 CAGTGTGGGGAGTGCGTCGAGGG + Intronic
1098018358 12:66130258-66130280 CAGTCTGGGGAGAGGGTCGGGGG - Intronic
1098024300 12:66186599-66186621 CTGTCAGGGGAGGGGGTAGGGGG - Intergenic
1098065973 12:66616614-66616636 CAGTGTGGGGAGAGGATGGTGGG + Intronic
1098370072 12:69749350-69749372 CAGACAGGGCAGAGGGTGGGAGG - Intronic
1100537752 12:95527053-95527075 GATTCAGGGGAGAGGGTGGGAGG - Intronic
1101365228 12:104064530-104064552 CATTGTGGGCAGAGGGGCGGGGG + Exonic
1101565079 12:105897295-105897317 CAGTTTGGGGAAAGGGGTGGGGG + Intergenic
1101943894 12:109121346-109121368 TAGACTGGGGAAGGGGTCGGGGG + Intronic
1101968149 12:109294760-109294782 CAGTGTGGGCAGGGGGTTGGGGG - Intronic
1102604326 12:114057110-114057132 CAGTCTGGTGAGAAGGTGAGAGG - Intergenic
1103043150 12:117712320-117712342 AAGTCTGGGGACAGGGTCTCAGG + Intronic
1103209795 12:119157785-119157807 CAGCCTGGGCAGAGGGGAGGGGG - Exonic
1103604533 12:122077392-122077414 CAGTCTGGGGTGGGGGTGGCAGG - Intergenic
1103897930 12:124286295-124286317 CAGTCTGGGGTGGGGATTGGGGG - Intronic
1104348691 12:128026059-128026081 CAGTGTGGGGTAAGGGCCGGTGG + Intergenic
1104444755 12:128824000-128824022 CAGTCTCGCGAGAAGGGCGGCGG - Intergenic
1104757661 12:131279154-131279176 CAGTGTGGGGAGAGGGAGAGGGG + Intergenic
1105024993 12:132842250-132842272 CAGTCTGTGGAGAGGGAAGGTGG - Intronic
1106570661 13:30924489-30924511 TAGGCTGGGGGGAGGGTAGGAGG + Exonic
1106580042 13:31009913-31009935 CAGTCAGGAGAGAGGGTGTGAGG + Intergenic
1109308172 13:60663101-60663123 CACCCACGGGAGAGGGTCGGGGG - Intergenic
1109372743 13:61445284-61445306 CCTTCTGGGTAGAGGGTTGGAGG + Intergenic
1111526361 13:89476324-89476346 CAGTATGGGGAGGGAGTAGGTGG + Intergenic
1112504263 13:99966128-99966150 CTGTCGGGGGAGGGGGTCTGCGG - Intronic
1112883029 13:104133044-104133066 CATTCTGGGGAGTGGCTGGGAGG + Intergenic
1113264188 13:108598999-108599021 CACTCTGGGGATGGGGTGGGGGG - Intronic
1113463507 13:110497737-110497759 CAGTCAGGGGTGAGGATCTGGGG + Intronic
1113463516 13:110497780-110497802 CAGTCAGGGGTGAGGATCTGGGG + Intronic
1113463525 13:110497823-110497845 CAGTCAGGGGTGAGGATCTGGGG + Intronic
1113463535 13:110497866-110497888 CAGTCAGGGGTGAGGATCTGGGG + Intronic
1113463545 13:110497909-110497931 CAGTCAGGGGTGAGGATCTGGGG + Intronic
1113463555 13:110497952-110497974 CAGTCAGGGGTGAGGATCTGGGG + Intronic
1113463565 13:110497995-110498017 CAGTCAGGGGTGAGGATCTGGGG + Intronic
1113871775 13:113564415-113564437 CGGTCTGTGGAAAGGGTCTGTGG - Intergenic
1114626096 14:24131412-24131434 CAGGTGGGGGAGAGGGGCGGGGG - Exonic
1117283115 14:54259853-54259875 GAGTCTGGGGAGAAGGATGGTGG - Intergenic
1117388003 14:55236089-55236111 CAGTCTTGGGGAAGGGGCGGGGG + Intergenic
1118030831 14:61816282-61816304 CAGTCCTGGAAGAGGGTGGGTGG + Intergenic
1119001475 14:70885856-70885878 CCGACAAGGGAGAGGGTCGGGGG + Intergenic
1119162110 14:72461250-72461272 CAGGCAGTGGAGAGGGTGGGAGG + Intronic
1119768205 14:77204002-77204024 CAGTCAGGGGAGAGGCTGGAGGG + Intronic
1121417539 14:93789239-93789261 CAGCCTCGGGAGAGGCTTGGGGG - Intergenic
1121503751 14:94460778-94460800 CAGTGTGGGGAGTGGTTAGGTGG - Intergenic
1121600497 14:95199719-95199741 CTGCCTGGGGAGGAGGTCGGAGG + Intronic
1121602120 14:95213191-95213213 TAGTGTGGGGAGAGGGGCTGCGG + Intronic
1122080411 14:99263162-99263184 CTGTCTGCTGAGAGGGTCGAGGG - Intronic
1122445165 14:101762201-101762223 CGGCCCGGGGAGGGGGTCGGAGG + Intronic
1122811865 14:104293253-104293275 CAGTCTGGGGTAAGAGTGGGAGG - Intergenic
1124254635 15:28130861-28130883 CATTCTGGGGAGAGGCTTGCAGG - Intronic
1125360199 15:38857010-38857032 GAGGCTGGGGTGAGGGTTGGGGG + Intergenic
1126099224 15:45109865-45109887 CAGACTGGGGTCAGGGTCAGGGG - Intronic
1126102766 15:45129714-45129736 GGGGCTGGGGAGAGGGTGGGAGG - Intronic
1126348283 15:47718500-47718522 CAGTAAGGGGAGAGGGACGGTGG - Exonic
1126759947 15:51960888-51960910 GAGTGTGGGGAGAGGGAAGGGGG + Intronic
1126877403 15:53059033-53059055 CAGTTTGGGGTGGGGGTGGGAGG + Intergenic
1126988204 15:54339417-54339439 GACTCTGGGGAAAGGCTCGGAGG - Intronic
1127447947 15:59084773-59084795 GAGGCTGGGGAGAGGGTGGGGGG - Intronic
1127588138 15:60397627-60397649 CGGCGTGGGGAGAGGGGCGGAGG - Intronic
1128903487 15:71446980-71447002 AAGTCAGGGGAGTGGGCCGGGGG + Intronic
1129182931 15:73888282-73888304 CAGGCTGGGGAGAGGTCAGGTGG + Intronic
1129234567 15:74216248-74216270 CATTTTGGGGAGAGGGTAGGTGG - Intergenic
1129674073 15:77622915-77622937 CAGTGTGGGCAGAGGGTGGCCGG - Intronic
1132549345 16:547967-547989 CAGTCGGGGCAGTGGGTGGGGGG - Exonic
1132671440 16:1103653-1103675 CAGCCGGGGGTGAGGGTCAGGGG + Intergenic
1132934359 16:2473410-2473432 CAGTCTGGGTAGAAGGTGGGAGG - Exonic
1133836072 16:9368428-9368450 AACTCAGGGGAAAGGGTCGGGGG - Intergenic
1134034205 16:11017057-11017079 CAGTCTGGGGAGAGTCTCTTGGG + Intronic
1134174831 16:11997241-11997263 CAGCAAGGGGAGAGGCTCGGAGG - Intronic
1134222580 16:12366582-12366604 CAGGCTGGTGAGTGGGTGGGAGG - Intronic
1134330910 16:13250371-13250393 CATTGGGGGGAGAGGGTCAGAGG + Intergenic
1135047665 16:19168338-19168360 CAGCCTGGGGAGCGCCTCGGTGG + Exonic
1135238588 16:20782394-20782416 GACTCTGGGGAAAGGGTGGGAGG - Intronic
1135517221 16:23146229-23146251 CAGTGTGGGGTGGGGGGCGGGGG + Intronic
1135597766 16:23756369-23756391 GCATCTGGGGAGAGGGTGGGAGG - Exonic
1135871431 16:26155020-26155042 GGGTCTGGGGAGAGGGTTGTGGG - Intergenic
1136597302 16:31260182-31260204 CAGTCTGGGGAGAGGCAAAGGGG + Intronic
1136895299 16:33992838-33992860 CAGTTTGGGGAGAGGCTCCCAGG + Intergenic
1137808255 16:51328487-51328509 TAGTCAGGGGAGATGGTGGGTGG - Intergenic
1138105923 16:54287084-54287106 CAGCCTGGGGACAGGCTCGGAGG - Intergenic
1138577691 16:57919017-57919039 CGGGATGGGGAGAGGGTCAGGGG - Intronic
1139422005 16:66854789-66854811 CAGCCTGGGGAGGGGGTCCCAGG - Intronic
1139468334 16:67165700-67165722 CCGTCTGGGGAGTGGGGCGTGGG - Exonic
1139477428 16:67209724-67209746 CAGTCTGGGGAGGGGCGCTGAGG - Intronic
1139919352 16:70449545-70449567 CAGTGTGAGGAGAAGGTGGGTGG + Intergenic
1140790496 16:78386626-78386648 CAGGCTGGGGGGTGGGGCGGGGG - Intronic
1141585120 16:85028282-85028304 CATTCTGGGGAGAGGGTGCAAGG + Intronic
1141659718 16:85435428-85435450 CAGTCGAGGGAGAGGGAGGGAGG - Intergenic
1142584823 17:965650-965672 GAGTCTGGGGATAGAGTTGGGGG - Intronic
1142708472 17:1710485-1710507 CAGCCGGGGGAGCGGTTCGGGGG + Intergenic
1142903845 17:3029483-3029505 GAGTCTGGGGAGAGGCAGGGTGG + Intronic
1143278129 17:5729884-5729906 GACTCAGGGGAAAGGGTCGGGGG + Intergenic
1143480454 17:7224938-7224960 CAGCCTGGGGAGAGGGAAGGAGG - Exonic
1143572295 17:7767090-7767112 CAGACTGGGGCGGGGGACGGGGG - Intronic
1144521614 17:15956309-15956331 CAGCTTGGGGAGAGTGTGGGAGG + Intronic
1144662497 17:17080310-17080332 CACTCTGGGGAGTGGCTCTGAGG - Intronic
1145902956 17:28499852-28499874 CAGTCTGGAAAGAGGCTTGGAGG - Intronic
1146616197 17:34359106-34359128 CAATGTGGGGAGAGGGCCTGGGG + Intergenic
1146789377 17:35742865-35742887 GAGTCTGGGGGAAGGGTCGTGGG + Exonic
1147420888 17:40321685-40321707 CAGCCTGGGGAGCCGGTGGGGGG + Intronic
1147911091 17:43856752-43856774 TAGGCTGGGGTGAGGGTCTGAGG - Intronic
1147965527 17:44192491-44192513 CAGTCTGGGGAGTGGGCTGAAGG - Exonic
1148113699 17:45162265-45162287 CAGCTTGGGGAGAAGGTTGGGGG + Intronic
1148155856 17:45425051-45425073 CAATGTGGGGTGAGGGTGGGAGG + Intronic
1148553463 17:48564290-48564312 CAGCCTGGGCCGAGGGTCCGGGG - Intronic
1148770628 17:50064058-50064080 GAGCCTGGGGATAGGGACGGAGG - Exonic
1148987799 17:51638750-51638772 CTGTCTGGGGCGAGGGTGCGGGG + Intronic
1149431067 17:56595920-56595942 CAGGCTGGGCCGAGGGGCGGGGG + Intergenic
1149656208 17:58310808-58310830 CTGTCTGGGGAGAGGGGAGCAGG - Intronic
1150130641 17:62666990-62667012 CAGTCTGGGGAGGGGGGTGGAGG - Intronic
1150387546 17:64773689-64773711 CAATGTGGGGTGAGGGTGGGAGG + Intergenic
1150549503 17:66196109-66196131 CACTTTGGGGAGAGGGTTTGGGG + Intergenic
1152120329 17:78414504-78414526 CTCTCTGGGGAGAGGCTCAGTGG + Intronic
1152181127 17:78822455-78822477 CAATCTGGGAAGAGGGGTGGGGG + Intronic
1152244307 17:79177212-79177234 AAGGCTGGGGAGAGGGCGGGGGG - Intronic
1152320981 17:79608807-79608829 CAGTCCTGGGGGAGGGGCGGGGG + Intergenic
1152496654 17:80677573-80677595 CAGTCTGGTGAGAGGGAAGGTGG - Intronic
1152607775 17:81301681-81301703 CCGTCTGGGAAGAGGGATGGAGG + Intergenic
1152625808 17:81387462-81387484 CCGTCTGGGGAGGCGGCCGGAGG - Intergenic
1152700934 17:81819500-81819522 CAGGATTGGGTGAGGGTCGGAGG + Intergenic
1157369522 18:47097877-47097899 CAGTCAGGGTGGAGGGTGGGAGG - Intronic
1157582647 18:48782424-48782446 CAGGATGGGGAGCGGGTGGGGGG - Intronic
1157810079 18:50688727-50688749 GACTCTGGGGAAAGGGTGGGAGG + Intronic
1157937624 18:51890891-51890913 CAGCCTGGGAAGAGGGCCAGAGG - Intergenic
1158517046 18:58139293-58139315 CTGTATGGGGCGGGGGTCGGGGG - Intronic
1158602134 18:58864145-58864167 CTGTCTGGGGAGGGGGCGGGGGG - Intronic
1160240493 18:77119197-77119219 AAGCCTCGGGAGAGGGCCGGAGG + Intronic
1160513590 18:79466366-79466388 GTATCTGGGGAGAGGGTTGGCGG - Intronic
1160563888 18:79775048-79775070 GGGGCTGGGGAGAGGGTTGGTGG + Intergenic
1160703178 19:517907-517929 CAGGCTGGGTAGAGGCTGGGAGG + Intronic
1160703195 19:517956-517978 CAGGCTGGGTAGAGGCTGGGAGG + Intronic
1160898936 19:1417029-1417051 CAGCCTGGGGCGGGGGTGGGGGG - Intronic
1160982783 19:1823851-1823873 CAGGCTTGGGAGAGGGTGGCTGG + Intronic
1161012616 19:1967854-1967876 CAGCCTGGGGAGAAGGGAGGAGG - Intronic
1161012637 19:1967915-1967937 CAGCCTGGGGAGAAGGGAGGAGG - Intronic
1161636653 19:5393483-5393505 GAGTCTGGGGAGAGGAGCTGGGG - Intergenic
1162041113 19:7971612-7971634 TGCTCTGGGGAGAGGGTCGGGGG - Intronic
1162247157 19:9410906-9410928 CGGGCTGGGGAGAGGGAGGGAGG + Intergenic
1162326331 19:10001970-10001992 CAGTCCGGGGACAGGGACAGAGG + Intronic
1163026037 19:14512918-14512940 CAGTGTGAGGAGTGGGACGGTGG - Intergenic
1163843851 19:19627966-19627988 CAGACTGGGGAAGGGGTAGGGGG + Exonic
1164508528 19:28878665-28878687 CACAACGGGGAGAGGGTCGGAGG + Intergenic
1165086385 19:33350989-33351011 CAGACTGGGGAGGGGGGTGGGGG + Intergenic
1165346221 19:35250055-35250077 CAGGCTGGGAAGAGGGATGGCGG + Intronic
1165407802 19:35641773-35641795 GAGTGAGGGGAGAGGGTCTGGGG - Exonic
1165743895 19:38219055-38219077 CAGTCTGGGGACAGGGCCATGGG + Exonic
1165914142 19:39247667-39247689 CTGGCGGGGGAGAGGGGCGGCGG + Intergenic
1165996290 19:39846266-39846288 CAGGCTGGGGTGAGGGTCCGGGG - Intronic
1166102188 19:40577299-40577321 GAGTTTGGGGCGAGGGTAGGAGG + Intronic
1167150045 19:47703070-47703092 CTAGCTGGGGAGAGGTTCGGGGG - Exonic
1167151655 19:47713620-47713642 CAGACTGGGGACAGGGTGGCAGG - Intronic
1167411657 19:49347628-49347650 GAGGCTGGGGTGAGGGTGGGAGG - Intronic
1167529172 19:50004281-50004303 CAGGGTGGGGAGAGGGCAGGAGG - Intronic
1167648719 19:50718797-50718819 CCGGCCGGGGAGAGGGGCGGGGG + Intronic
1167706935 19:51086674-51086696 CAGTGTGTGGAGAGGGTAGGAGG + Intergenic
1168287843 19:55343202-55343224 CAGTCTGGTGAGGAGGTGGGGGG + Intronic
926145586 2:10395453-10395475 CAGTCAGGGGGGTGGGTTGGTGG + Intronic
926288792 2:11511931-11511953 CAGTCAGAGGAAAGGGGCGGTGG - Intergenic
927114599 2:19888123-19888145 GAGTCTGGGGAGAAGGACAGTGG - Intergenic
927787126 2:25981939-25981961 CAGGCTGCGGAGGGGCTCGGGGG - Exonic
927875849 2:26654720-26654742 CAGTCTGGGGTGGGGGATGGGGG + Intergenic
928272001 2:29864914-29864936 CCTTCAGGGGAGAGGGTGGGAGG - Intronic
928954268 2:36845980-36846002 GAGTTTGGGGAGGGGGTGGGAGG - Exonic
929438539 2:41947773-41947795 CAGTCTGGGGTGAGGGCCACGGG - Intronic
929782800 2:44968155-44968177 GAGTTTGGAGAGAGGGTAGGTGG + Intergenic
930435123 2:51331058-51331080 CATTCTGGGAAGAGGGTTGCAGG + Intergenic
931297629 2:60944408-60944430 GATTCTGGGGAGAGGAGCGGGGG + Intronic
931496155 2:62809353-62809375 CAGTTGGGGGAGAGGGGAGGAGG - Intronic
932374789 2:71226511-71226533 CAGCCCGGGGAGAGGGGCGGGGG + Intronic
932468116 2:71936486-71936508 CACTCTGGGAAGAGGGTGGATGG - Intergenic
932621059 2:73265193-73265215 AAGTCTGGGGAAAGGGGAGGGGG + Intronic
932872746 2:75419731-75419753 CAGTCTTGGCAGAGGGTCAGTGG + Intergenic
933666795 2:84971077-84971099 GAGCCGGGGGAGAGGGGCGGGGG + Exonic
934570451 2:95368369-95368391 GACTCTGGGGAAAGGGTGGGAGG + Intronic
934615705 2:95769363-95769385 CAGTATGGGGAGAGAGGCTGGGG + Intergenic
935356083 2:102201064-102201086 CAGTCTTGGCAGAGGGTCTTGGG + Intronic
935725250 2:106018336-106018358 CAGCCTGGAGAGAGGCTCGTGGG - Intergenic
935736404 2:106110008-106110030 CAGTCTAGGGAGAGACTCGCAGG - Intronic
936525706 2:113240222-113240244 CAGCATGGGGAGAGGGCCTGGGG - Intronic
937481767 2:122268993-122269015 TAGTCTGGAGAGAGGGTGGAAGG - Intergenic
938058859 2:128236658-128236680 GTGTCTGGGGAGAGGGCCTGGGG + Intergenic
941078378 2:161032104-161032126 CACTCTAGGAAGAGGCTCGGTGG + Intergenic
941927032 2:170906128-170906150 CTGTCTGGGGAGAGGAGTGGCGG - Intergenic
942222791 2:173787893-173787915 CAGTCTGGAGAGAGTCTGGGTGG - Intergenic
945129321 2:206551334-206551356 CAGTCTGGGGAGTGTGGCAGTGG - Intronic
946042258 2:216792419-216792441 CAGACTGGGGACAGGGGTGGTGG + Intergenic
946156956 2:217813354-217813376 CAGTCTTGGGAGGTGGTGGGAGG - Intronic
946429420 2:219616780-219616802 GTGTCTGGGGAGAGGGTGTGTGG + Intergenic
946543551 2:220712375-220712397 CAGTGTGGGGTGAAGGTCTGGGG + Intergenic
948177684 2:235956889-235956911 GAGACGGGGGAGAGGGTCAGAGG - Intronic
948370577 2:237487048-237487070 CAGTTTGGGGAGAAAGACGGCGG - Intronic
948453457 2:238093013-238093035 CAGGGTGGGAAGAGGGTTGGAGG - Intronic
948599664 2:239101052-239101074 GAGTCTGTGGGGTGGGTCGGTGG + Intronic
948865083 2:240771103-240771125 CACTGTGGAGAGAGGGTCAGGGG + Exonic
948918937 2:241052462-241052484 CAGGCAGGTGAGAGGGTCAGGGG + Exonic
948918981 2:241052618-241052640 CAGGCAGGTGAGAGGGCCGGGGG + Intronic
948918997 2:241052670-241052692 CAGGCAGGTGAGAGGGTCGGCGG + Intronic
948919023 2:241052733-241052755 CAGGCAGGTGAGAGGGCCGGGGG + Intronic
949031538 2:241799544-241799566 CAGGCAGGGGAGAGGGTCCCAGG - Intronic
1168932598 20:1636119-1636141 CAGCCTGGGGAGAGGGGAGTGGG + Intronic
1169005091 20:2200135-2200157 CAGTAAGGGGATAGGGTGGGAGG - Intergenic
1169077463 20:2770041-2770063 CAGCCTGGGTAGGGGGTAGGTGG - Intergenic
1169327863 20:4690240-4690262 CATTATGGGGTGAAGGTCGGGGG + Intronic
1169346626 20:4834150-4834172 GGGTCAGGGAAGAGGGTCGGGGG + Intergenic
1170677608 20:18497015-18497037 CAGCCTGGAGGGAGGGACGGCGG - Intronic
1171431833 20:25087778-25087800 CAGTCTGGGGAGGGGGTGTATGG + Intergenic
1171483063 20:25468452-25468474 CAGTCGGGGGACAGGGCAGGGGG - Intronic
1171535335 20:25882537-25882559 CAATCTGGGGACATGGTCAGGGG - Intergenic
1172034220 20:32000361-32000383 CAGACTGGGGTGGGGGTCAGGGG - Exonic
1172842718 20:37911661-37911683 CAGGATGGGGAGAGGGGCTGGGG + Intronic
1172848053 20:37941727-37941749 CTGTCTGGGAAGGGGGTCAGTGG + Intronic
1173188067 20:40856555-40856577 CAGTGTGGGGAGAGGGTGGTTGG - Intergenic
1173869261 20:46331426-46331448 CTGTCTGGGCAGGGGGTCTGTGG + Intergenic
1174401420 20:50278012-50278034 GAGGGTGGGGAGAGGGTCGTGGG + Intergenic
1175299541 20:57933243-57933265 CAGGCAGGGGAGAGGGGCTGAGG - Intergenic
1175531608 20:59676923-59676945 GAGTCTGGGGTGAGGGGTGGGGG + Intronic
1175975153 20:62707391-62707413 CAGGCTGGGGCGGGGGTCGCAGG - Intergenic
1176141854 20:63548376-63548398 CTGTCCAGGGAGAGGGTGGGAGG - Intronic
1176233082 20:64041876-64041898 CAGGCTGGGGTGGGGGCCGGTGG - Intronic
1179546886 21:42118606-42118628 CAGTCTGGGGAGAGGTAGGGAGG + Intronic
1179821445 21:43939569-43939591 CAGTTTGGAGAGAGTGTCGCGGG + Intronic
1179987014 21:44927681-44927703 CAGGCTGGGGGCAGGGGCGGGGG + Intronic
1180006024 21:45021118-45021140 CAGTCTGGGGAGGGGCTGTGAGG - Intergenic
1182342257 22:29632830-29632852 CAGTCTCGGGAGATGTTCAGAGG + Intronic
1182436533 22:30334414-30334436 CAATGTGGGGAAAGGGTCAGGGG + Exonic
1183458018 22:37933213-37933235 CAGACTGGGGACAGGGCCAGAGG + Intronic
1183730397 22:39615250-39615272 CACTCGGGGGAGATGGACGGAGG + Intronic
1184768801 22:46586359-46586381 CAGTCCGGTGCGATGGTCGGAGG + Intronic
950043062 3:9932797-9932819 CTGTTAGGGGAGAGGGGCGGAGG - Intronic
950085027 3:10251197-10251219 CAGTCTGGTGGGAGGGCTGGAGG + Intronic
950530280 3:13549061-13549083 GAGTCAGGGGAGGGGGCCGGGGG + Intergenic
950791199 3:15473824-15473846 CACCCTGGGGAGAGGGTGGCAGG - Intronic
952296724 3:32068868-32068890 CAGTCTGGGGAGGAGGTGAGAGG - Intronic
953873248 3:46646116-46646138 CAATCTGGGGGGAGGGAGGGAGG - Intergenic
954224598 3:49173810-49173832 CAGTCTGGGGAGGAGGACTGGGG - Intronic
954295431 3:49672079-49672101 AATTCTGGGGAGAGGGCCAGAGG - Intergenic
954443421 3:50534096-50534118 CAGGCTGGGGAGAGAGACCGGGG - Intergenic
954713132 3:52514682-52514704 CAGGCTGGGGAGAGGGATGGAGG - Exonic
955103987 3:55878400-55878422 CAGGATGGGGAGATGGTGGGAGG - Intronic
955769811 3:62375522-62375544 TAGTTTGGGGAGGGGGTGGGAGG - Intergenic
955947056 3:64205489-64205511 TAGACTGGGGACAGGGTTGGTGG + Intronic
956555789 3:70521065-70521087 CAGTCGGGGGTGGGGGTGGGTGG + Intergenic
959399123 3:105877672-105877694 CAGTCTTGGGAAAGGGACTGGGG + Intergenic
959703029 3:109316192-109316214 GAGTGTGGGGGGAGGGGCGGGGG - Intronic
960273066 3:115695723-115695745 GAGTTTGGGGAGTGGGTAGGAGG - Intronic
960338356 3:116445594-116445616 CAGGGTGGGGGGAGGGTGGGGGG - Intronic
961175939 3:124835019-124835041 CATCCTGGGGAAAGGGTAGGAGG - Intronic
962169241 3:133083185-133083207 CAGGCTGAGGAGTGGGGCGGCGG - Intronic
962485793 3:135841055-135841077 CAGTATGGGGTGAGGGTGGAGGG - Intergenic
962524115 3:136222328-136222350 CAGTCTGGGGAGGAGGTGAGAGG + Intergenic
964486128 3:157186739-157186761 CAGTCAGGGGAGGGTGTGGGTGG - Intergenic
964846596 3:161051110-161051132 CAGTCTGAGGAGATGGCGGGTGG - Intronic
968952536 4:3702392-3702414 CAGTCTGGGCAGTGGGAGGGGGG - Intergenic
969457736 4:7309780-7309802 CAGGCTGGGGAGAGGGCCTGAGG + Intronic
970643014 4:18088605-18088627 CAGAAGGGTGAGAGGGTCGGAGG - Intergenic
972166184 4:36287128-36287150 GACTCTGGGGAAAGGGTGGGAGG - Intronic
972253519 4:37330448-37330470 CAGACTGGGGAGAAAGCCGGTGG + Intronic
972860765 4:43167103-43167125 GACTCTGGGGAAAGGGTGGGAGG - Intergenic
973702024 4:53546812-53546834 AAGGCTGGGGAGGGAGTCGGGGG + Intronic
977047686 4:92088324-92088346 CAGTTTGGGGAAAGGGGTGGGGG - Intergenic
981178417 4:141709918-141709940 TAGTGTGGGGGGAGGGTGGGAGG - Intronic
982169048 4:152643711-152643733 CAGTCAGGGGACAGAGTCCGTGG + Intronic
982200330 4:152954099-152954121 CAGTCTGGGAAGGAGGTGGGTGG + Intronic
984463016 4:180059239-180059261 GAGGCTGAGGAGAGAGTCGGTGG - Intergenic
985558360 5:569072-569094 CAGCCTGGGGCCAGGGTGGGAGG - Intergenic
985703498 5:1387408-1387430 CAGGCTGGGGTGAGGGGAGGAGG + Intergenic
986007791 5:3682834-3682856 GACTCAGGGGAGAGGGTGGGCGG - Intergenic
986708327 5:10469557-10469579 CAGTGTGGGGAGGGGGGTGGTGG + Intronic
988882830 5:35522252-35522274 GACTCTGGGGAAAGGGTGGGAGG + Intergenic
990209268 5:53464793-53464815 CAGTCTGGTGAAATGGTTGGGGG - Intergenic
991594488 5:68288628-68288650 CAGGCTGGGGGGAGGTGCGGGGG + Intronic
992996549 5:82339726-82339748 CAGTCCTGGGAGAAGGTAGGAGG + Intronic
993752583 5:91689581-91689603 GACTCTGGGGAAAGGGTGGGGGG - Intergenic
993915889 5:93742149-93742171 CAGTTTGGGGGTGGGGTCGGGGG - Intronic
994375892 5:99015408-99015430 CAGTCTGGGGAGGAGGTAAGAGG + Intergenic
994648555 5:102498922-102498944 CAGCCTGGCGAGGGCGTCGGAGG + Exonic
995907781 5:117146667-117146689 CAGTTTTGGGAGGGGGTTGGAGG - Intergenic
996699395 5:126435168-126435190 CAGTCTGGGGAGAGGGGAATGGG + Intronic
997294013 5:132758647-132758669 CAGCCTGGGGCCAGGGTCGGTGG + Intronic
998152597 5:139765677-139765699 GCGGCTGGGGAGAGGGTCGAGGG + Intergenic
999242185 5:150134065-150134087 CAGCTTGGGGATAGGGTAGGGGG + Intronic
999755718 5:154663030-154663052 CAGTCTGGGGCTGGGGGCGGTGG - Intergenic
1000352276 5:160361283-160361305 CAGTCTGGGCAGAGGGCCCTTGG - Intronic
1001049608 5:168403975-168403997 CTGGGTGGGGAGGGGGTCGGGGG - Intronic
1001972507 5:175967898-175967920 CAGGCTAGGGAGAGGGGCCGTGG - Intronic
1002244932 5:177875882-177875904 CAGGCTAGGGAGAGGGGCCGTGG + Intergenic
1002258645 5:177978684-177978706 CAGGCTGGGGTGGGGGTCTGGGG - Intergenic
1002394317 5:178941351-178941373 TCGTCTGGGGAGAAGGGCGGAGG + Exonic
1002501215 5:179648862-179648884 CAGGCTGGGGTGGGGGTCTGGGG + Intergenic
1005415315 6:25593946-25593968 TAGTCAGGGGAGAGGGTTAGGGG + Intronic
1006084800 6:31587969-31587991 GAGTCTGGGGACAGGGAAGGGGG + Intronic
1006171953 6:32098069-32098091 CTGGCTGGGGAGGGGGCCGGGGG + Intronic
1006405280 6:33841463-33841485 CGGGCTGGGGAGAGGGGCTGTGG + Intergenic
1006407945 6:33856063-33856085 CAGTCTGGGGCCAGGGAGGGAGG - Intergenic
1007967163 6:46014029-46014051 CAGCCTGGGGTGGGGGTGGGGGG + Intronic
1008332398 6:50260340-50260362 CAGTGAGGGGAGAGAGTTGGTGG + Intergenic
1013246796 6:108294799-108294821 CAGTCTGGGCAGTGGGAGGGAGG - Intergenic
1013343859 6:109240598-109240620 CAGAGTGGGTAGAGGGTCAGAGG - Intergenic
1015325502 6:131918937-131918959 CAGTGTGGGGAGGGGGTGGATGG - Intergenic
1017074686 6:150606888-150606910 CAGAGTTGGGAGAGGGTGGGAGG - Intronic
1017923000 6:158887469-158887491 CAGTCTGGGGAGGAGGTGAGGGG + Intronic
1017939118 6:159036030-159036052 CAGGCAGGGGAGAGAGTCCGTGG + Exonic
1018092710 6:160358836-160358858 CAGTCTGAGCAGAGGGACGCTGG + Intronic
1018138919 6:160807277-160807299 CAGTTTGGGGAAAGGGGTGGGGG - Intergenic
1018352071 6:162970307-162970329 CAGTCTGAGGAGGGTGTCTGGGG + Intronic
1019477273 7:1249941-1249963 GAGCCTGGGGGGAGGGACGGAGG + Intergenic
1019650455 7:2154907-2154929 CAGCCTGTGGAGAAGGACGGAGG + Intronic
1022455047 7:30551359-30551381 CAGTCTGGAGAGAGGAGCTGTGG - Intronic
1022466570 7:30656312-30656334 TATACTGGGGAGAGGGTTGGGGG - Intronic
1023822275 7:43986784-43986806 CAGCCCGGGGAGGGGGCCGGAGG + Intergenic
1024540643 7:50472883-50472905 CAGTCTGGGGAGAAGATCCCTGG - Intronic
1025094001 7:56083844-56083866 CAGTCTGGGGAGAGGAGCCGGGG + Intronic
1026070681 7:67116680-67116702 CTGTCTGGGGATTGGGCCGGGGG + Intronic
1026706216 7:72695597-72695619 CTGTCTGGGGACTGGGCCGGGGG - Intronic
1026785744 7:73300672-73300694 CTGTCTGAGGAGAGGTTGGGCGG + Intergenic
1026809568 7:73451529-73451551 CAGACTGGGGAGAGGGATGAGGG + Intronic
1027108321 7:75419264-75419286 CTGTCTGAGGAGAGGTTGGGTGG - Intronic
1027878547 7:83802305-83802327 GTGTCTGGGGACAGGGTTGGGGG + Intergenic
1029200712 7:98837384-98837406 CTGTGTGGGGAGAGGGTGGCTGG + Intergenic
1029471693 7:100758673-100758695 CGGCCTGGGGGGAGGGTCTGTGG + Intronic
1029545831 7:101210157-101210179 CAGTCCTGTGAGAGGGTGGGGGG + Exonic
1029750540 7:102540198-102540220 CAGCCCGGGGAGGGGGCCGGAGG + Intronic
1029768493 7:102639306-102639328 CAGCCCGGGGAGGGGGCCGGAGG + Intronic
1030086005 7:105816255-105816277 TGTTCTGGGGAGAGGGTCTGGGG + Intronic
1030480792 7:110101321-110101343 CACTCAGGGGAAAGGGTGGGAGG + Intergenic
1030891787 7:115007803-115007825 TATTTTGGGGAGGGGGTCGGGGG - Intronic
1031643212 7:124190624-124190646 TTGGCTGGGGAGAGGGTTGGGGG + Intergenic
1032087153 7:128890510-128890532 CAGCCTGGGGAGAAGGGCAGGGG + Exonic
1032275576 7:130452422-130452444 AAGTCTGGGATGAGGGTTGGTGG - Intergenic
1032581197 7:133105142-133105164 CAGGCTGGGGCGGGGGTGGGTGG - Intergenic
1034413920 7:150955295-150955317 CAGGCTGGGGAGAGGGCTGCTGG - Intronic
1035204682 7:157287500-157287522 CTGTCTGGGGAAAGGGTCAGGGG - Intergenic
1035323127 7:158047033-158047055 CATTCCGGGGCGAGGGGCGGGGG - Intronic
1035628578 8:1091775-1091797 AGGAGTGGGGAGAGGGTCGGGGG - Intergenic
1035702744 8:1649018-1649040 ATGTCTGGGGAGAGGTCCGGAGG + Intronic
1036669960 8:10776832-10776854 CAGTGTGGGGGAAGGGTTGGCGG - Intronic
1037759465 8:21732443-21732465 GAGTCTGCGGAGAGGGGAGGGGG + Intronic
1038339097 8:26669211-26669233 CAGCTTGGGGAAAGGGACGGGGG + Intergenic
1038339470 8:26673048-26673070 CAGTCTGGGGAGATGCTCTGTGG + Intergenic
1041727743 8:61033547-61033569 CAGTCAGGGGGGAGTGTGGGTGG + Intergenic
1042801727 8:72725712-72725734 CAGTCTGGGCAGAAGGACCGGGG - Intronic
1047168524 8:122466851-122466873 CAGTGTGGGGAGGGAGTGGGTGG - Intergenic
1048550904 8:135432917-135432939 CAGCCTTGGGAGAGGGAGGGAGG + Intergenic
1048825200 8:138417387-138417409 CAGCATGGGGAGAGGGTTGCTGG - Intronic
1048998604 8:139809909-139809931 GAGTCAGGGAAGAGGGTCTGGGG - Intronic
1049060497 8:140272724-140272746 CAGTGAGGGGAGAGGGGAGGAGG + Intronic
1049217592 8:141415239-141415261 CAGGCTGGGAAGAGGGTCCCAGG - Intronic
1049273805 8:141709682-141709704 CGGTGTGGGGCGAGGGTCAGAGG + Intergenic
1049381923 8:142320459-142320481 CAGTGTGGGGAAGTGGTCGGAGG - Intronic
1052995093 9:34547713-34547735 CAGTTTGGGGAGAGGCTGGAAGG - Intergenic
1056133672 9:83609482-83609504 GACTCTGGGGAAAGGGTGGGAGG + Intergenic
1056555786 9:87686219-87686241 GAGGCTGTGGAGAGGGTGGGAGG - Intronic
1057739171 9:97697062-97697084 CAGTCTGGGGACCGGGGAGGCGG + Intronic
1058412322 9:104747666-104747688 CAGGCTGGGGCGGGGCTCGGCGG - Exonic
1060103391 9:120858702-120858724 CAGTCTGGTGAGAGGCAAGGTGG - Intronic
1061420912 9:130472425-130472447 ATGTCTGGGGAGCGGGCCGGGGG + Intronic
1061507366 9:131039076-131039098 CAGGAAAGGGAGAGGGTCGGAGG - Intronic
1061601743 9:131674911-131674933 AAGTCTGGAGAGAGGGGTGGGGG + Intronic
1062544639 9:137055954-137055976 CAGACTTGGGAGAGCGTCAGAGG + Intergenic
1062681946 9:137786889-137786911 CAGGCTGGGGAGTGGCTCCGAGG + Intronic
1186426340 X:9466053-9466075 CAGGCCGGGGAGATGGGCGGAGG - Intronic
1186530777 X:10293095-10293117 CAGTGTGGGAAGAGGGTGAGAGG + Intergenic
1188009165 X:25039465-25039487 CAGTATGGAGAGAAGGACGGTGG + Intergenic
1189243176 X:39541337-39541359 CAGTCTGGAGAGAGGGTCCGAGG - Intergenic
1189252589 X:39612990-39613012 CACTCTGGGGAGTGGGACGTGGG - Intergenic
1189333191 X:40155334-40155356 CGACCGGGGGAGAGGGTCGGGGG + Intronic
1189853658 X:45201081-45201103 CAGGCTGGGGAGGGGCTCGCTGG + Intergenic
1190745817 X:53321201-53321223 CAGCCGGGGGAGGGGGCCGGCGG + Exonic
1192583710 X:72304837-72304859 CAGGCTGGGGTCAGGGTGGGTGG - Intronic
1194331555 X:92590167-92590189 CAGTTTGGGGAAAGGGGTGGGGG - Intronic
1194454257 X:94082586-94082608 CACTCAGGGGAAAGGGTGGGAGG + Intergenic
1194516377 X:94860085-94860107 GACTCTGGGGAAAGGGTGGGAGG + Intergenic
1195732604 X:107981588-107981610 CATTCTGGGGACAGGGCAGGGGG + Intronic
1197525091 X:127551437-127551459 GAGGCTGGGCAGAGGGTGGGAGG - Intergenic
1198733324 X:139758431-139758453 CAGCCTCGGGGGAGGGGCGGGGG - Intronic
1200182305 X:154158198-154158220 CTGTCTGGTGAGCGGCTCGGAGG - Intronic
1200187959 X:154195312-154195334 CTGTCTGGTGAGCGGCTCGGAGG - Intergenic
1200193609 X:154232452-154232474 CTGTCTGGTGAGCGGCTCGGAGG - Intronic
1200199364 X:154270256-154270278 CTGTCTGGTGAGCGGCTCGGAGG - Intronic