ID: 1098023797

View in Genome Browser
Species Human (GRCh38)
Location 12:66182030-66182052
Sequence CTTTGTGAGGCTAAGGTGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1098023793_1098023797 -8 Left 1098023793 12:66182015-66182037 CCTATAATCTCAGCACTTTGTGA 0: 14
1: 2469
2: 51469
3: 349191
4: 241558
Right 1098023797 12:66182030-66182052 CTTTGTGAGGCTAAGGTGGAAGG No data
1098023791_1098023797 19 Left 1098023791 12:66181988-66182010 CCAAGTAGCCAGGTGCAGTGGTT No data
Right 1098023797 12:66182030-66182052 CTTTGTGAGGCTAAGGTGGAAGG No data
1098023792_1098023797 11 Left 1098023792 12:66181996-66182018 CCAGGTGCAGTGGTTTATGCCTA No data
Right 1098023797 12:66182030-66182052 CTTTGTGAGGCTAAGGTGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1098023797 Original CRISPR CTTTGTGAGGCTAAGGTGGA AGG Intergenic
No off target data available for this crispr