ID: 1098024902

View in Genome Browser
Species Human (GRCh38)
Location 12:66191085-66191107
Sequence ACTCAAAAGCAGACAGAGGA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 496
Summary {0: 1, 1: 0, 2: 6, 3: 46, 4: 443}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1098024900_1098024902 -1 Left 1098024900 12:66191063-66191085 CCATTGCTTGTGTTTGGCAGAGA 0: 1
1: 2
2: 6
3: 81
4: 711
Right 1098024902 12:66191085-66191107 ACTCAAAAGCAGACAGAGGATGG 0: 1
1: 0
2: 6
3: 46
4: 443
1098024898_1098024902 5 Left 1098024898 12:66191057-66191079 CCAGCACCATTGCTTGTGTTTGG 0: 1
1: 0
2: 0
3: 13
4: 260
Right 1098024902 12:66191085-66191107 ACTCAAAAGCAGACAGAGGATGG 0: 1
1: 0
2: 6
3: 46
4: 443

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1098024902 Original CRISPR ACTCAAAAGCAGACAGAGGA TGG Intronic
900877475 1:5354026-5354048 ACTCAAAAAGAGAAAGAGGGAGG - Intergenic
901342537 1:8508271-8508293 AGTCAAAAACAGAGAGAGGAAGG + Intronic
902301249 1:15504422-15504444 TCTACAAAGCAGACAGAGCAGGG + Intronic
904276534 1:29388384-29388406 ACTGAGGAGCAGACAGAGAAGGG + Intergenic
904475150 1:30760084-30760106 ACTCAGAATCAGACAGATCAGGG - Intergenic
905206334 1:36344687-36344709 AGTCACAAGTAGACAAAGGAGGG - Intronic
905999880 1:42415320-42415342 ACTCAAAAGCAACCACGGGATGG + Exonic
906577417 1:46903422-46903444 TCTCAAAAGCTAACATAGGAAGG - Intergenic
906815295 1:48872716-48872738 ATTCAAAATCAGACAGACAAAGG + Intronic
907220757 1:52905367-52905389 TCTCTGAAGCAGACAGAAGAGGG - Intronic
909292798 1:73905259-73905281 ACTGAAGAGGAGAAAGAGGAAGG + Intergenic
911095794 1:94053971-94053993 AGCCAAAAGCAGGCAGGGGATGG - Intronic
913027176 1:114855103-114855125 ACCCAAAAGAAAACAGCGGAGGG - Intronic
913053463 1:115136834-115136856 ACTCAAAGTGAGACAGAGGATGG + Intergenic
914666235 1:149835206-149835228 TCTCAAAAAAAGAAAGAGGAAGG - Intergenic
914669532 1:149858592-149858614 TCTCAAAAAAAGAAAGAGGAAGG + Intronic
914778329 1:150759239-150759261 AATCAAAAGCACACAGCCGAAGG - Intronic
914985399 1:152451976-152451998 TCTTAAAAGCAGCCAGAGGGAGG - Intergenic
918338172 1:183542518-183542540 ACTATAAAGCAGGTAGAGGAAGG + Intronic
919798534 1:201336738-201336760 ACTCAAAACCAGACAGACAAGGG - Intergenic
920677161 1:208046190-208046212 GCACAAAAGCAGAGAGAGGGTGG - Intronic
921071596 1:211663437-211663459 ACTGAAAAGCAGACAGATCCTGG - Exonic
921166637 1:212512870-212512892 ACTCAAAGGCAGAGAGAAGAGGG + Intergenic
921539578 1:216397520-216397542 ACAGTAAAGCAGACAGAAGAAGG + Intronic
921725214 1:218515773-218515795 ACTTAAAAGCAGATATAGGGAGG + Intergenic
922408335 1:225342375-225342397 AATCAAAATCAGAAAGTGGAAGG + Intronic
923152354 1:231244811-231244833 AATGAAAAGAAGACTGAGGATGG + Intronic
923281957 1:232451947-232451969 TCTCAAAAGCATACACTGGAAGG + Intronic
923501857 1:234571621-234571643 ACACACAAGCAGACACAGGCAGG + Intergenic
923545369 1:234919534-234919556 ACAGAAAAGCAGACAGAGTTGGG + Intergenic
924505537 1:244680103-244680125 AGTCAAAAGAAGGCAGAGGAAGG - Intronic
924675742 1:246176020-246176042 ATTCAAAAGCAGAAAGATAATGG + Intronic
1063362473 10:5469535-5469557 AGTCAGAAGCAAACACAGGAAGG + Intergenic
1063962643 10:11319590-11319612 AAACAAAAGCAGACACAGCAGGG + Intronic
1063987873 10:11526305-11526327 ACACACAAGCAGACAGATGGAGG - Intronic
1064464945 10:15569548-15569570 AGTAAGAAGCAGACAGAGGATGG - Intronic
1064814669 10:19245971-19245993 ACTTAAATGCAGTCAGTGGAAGG + Intronic
1065225011 10:23534616-23534638 ACTCAGAAGTAAACAGATGATGG - Intergenic
1066610296 10:37238819-37238841 ACTCAATATCAGATAAAGGAAGG - Intronic
1067196652 10:44125825-44125847 ACTCAATGGCAGTCAGTGGAGGG - Intergenic
1067857253 10:49805386-49805408 ACTAAAAAGTAGGCAGAGGCTGG - Intergenic
1068172300 10:53410647-53410669 ACCTAAAATCAGACAGAAGAGGG - Intergenic
1068826900 10:61451078-61451100 CCTCAAAATCAGACAGATAATGG - Intronic
1068901857 10:62278530-62278552 CCTATGAAGCAGACAGAGGAAGG - Intergenic
1069041557 10:63700872-63700894 GCTCAAGAGAACACAGAGGAGGG - Intergenic
1069663881 10:70142367-70142389 ACTCAAAAGCCAACAGAGGCTGG - Intronic
1069717724 10:70531600-70531622 ACTCACGGGCAGCCAGAGGAAGG + Intronic
1069960183 10:72074932-72074954 GCCCAGGAGCAGACAGAGGAAGG + Intronic
1070037194 10:72737918-72737940 ACTTAAAAGCAGAAAGAATACGG - Intronic
1072095203 10:92171548-92171570 ACTCAAAAGGAAACAAAGGAAGG + Intronic
1073065567 10:100757176-100757198 ACCTAAAAGCAGACATAGGTAGG - Intronic
1074009038 10:109457536-109457558 ACTACAAAGCACGCAGAGGATGG - Intergenic
1075243845 10:120802402-120802424 ACTCAGAACCAAACAGAGAAGGG + Intergenic
1075935470 10:126337365-126337387 ACTTCAAAGCAGGAAGAGGAAGG - Intronic
1076276842 10:129207351-129207373 AATCAAAACCAGACAAAAGAAGG + Intergenic
1078017083 11:7624180-7624202 ACTCAGAAGCAGACACACGGTGG + Intronic
1078163513 11:8862878-8862900 ACTCAAATGTAGACAGAGCTGGG + Intronic
1078377992 11:10812276-10812298 ATTCATAAGCACAGAGAGGATGG - Intronic
1078405027 11:11063018-11063040 ACTCTAAAGCATACATAGAAGGG - Intergenic
1078540495 11:12209531-12209553 ACTCAAACTCCGACAGAGAATGG - Exonic
1078700550 11:13677511-13677533 ACTCAAAACTAGACACTGGAAGG + Intronic
1078727816 11:13947537-13947559 ACTCAAAAGCTGAAAGATGCAGG + Intergenic
1079012469 11:16840618-16840640 ACTGAAAAGTAGACAGAAGGGGG + Intronic
1079915843 11:26367498-26367520 GCTCAGAAGAAGACAGATGAGGG - Intronic
1080219202 11:29880652-29880674 AATCAAAAGCTGTCAAAGGAAGG - Intergenic
1080523328 11:33087838-33087860 ACTGAAAAGAAGACTGTGGATGG - Intronic
1080998952 11:37643574-37643596 AGGCAAAGGCAGTCAGAGGAAGG - Intergenic
1081093226 11:38899069-38899091 ACTCAAAAACACACACAGAAAGG + Intergenic
1081192176 11:40117482-40117504 ACTCAAAACCAGTAAGAGTAGGG - Intronic
1081624669 11:44643999-44644021 ACTCAAAAGAAGGCAGAAAAAGG + Intergenic
1082778747 11:57269756-57269778 CCTGAAAGGCAGACAGAGGCTGG - Intergenic
1084026666 11:66454787-66454809 AGGGAAGAGCAGACAGAGGAGGG - Intronic
1085228378 11:74943120-74943142 ACCCCATAGCAGATAGAGGATGG - Intronic
1085601393 11:77859172-77859194 ACTCAAAAGAAGAAATAGAATGG - Intronic
1086167950 11:83801306-83801328 AGTCAAAAGGGGATAGAGGAGGG - Intronic
1086455713 11:86956497-86956519 ACTGGAAAGCAGAGAGAGGGTGG - Intergenic
1087710764 11:101547397-101547419 ACTCTAAAGCACAAATAGGATGG + Intronic
1087736980 11:101845360-101845382 TCTGAAAAGCAGAATGAGGAAGG - Intronic
1087859283 11:103133556-103133578 ATTCAAAAGCAGGAAGTGGAGGG + Exonic
1089104234 11:115988906-115988928 AATCAGAAGCAAACAGAGAAGGG - Intergenic
1089315853 11:117590789-117590811 CCTCAAATGCAGACTGAGAATGG + Intronic
1089478779 11:118789036-118789058 AATCAAAAGCCAACAGAGTAGGG - Intronic
1090208245 11:124897325-124897347 ACACAAGAGAAGACAGATGAGGG - Intronic
1091776336 12:3187367-3187389 GCACAAAGGCAGGCAGAGGAAGG - Intronic
1091950021 12:4584998-4585020 ACTCACAAGACGGCAGAGGAGGG + Intronic
1092726888 12:11495795-11495817 ACTCAAAAACAGATAAGGGAGGG - Intronic
1094422772 12:30289274-30289296 TCTGAAAAGAATACAGAGGAAGG - Intergenic
1094700100 12:32861773-32861795 TCTTAAAAGCAGCCAGAGGTGGG + Intronic
1095095924 12:38149160-38149182 AGACAAAGACAGACAGAGGAAGG - Intergenic
1095260159 12:40088744-40088766 ACACAAAAGAAGAGACAGGAAGG + Intronic
1095323618 12:40860633-40860655 ACTCAAAAACAGCCAAAGGGAGG + Intronic
1095662307 12:44751636-44751658 ACTCCAAAGTAAACACAGGAGGG - Intronic
1096240698 12:49958565-49958587 ACACCAAACCAGACAGAGGCAGG + Exonic
1096944198 12:55386026-55386048 TCTCAAAAACAAAAAGAGGAAGG - Intergenic
1097413092 12:59279836-59279858 ACTCAAAAGCAAAGAGAGCTTGG - Intergenic
1098024902 12:66191085-66191107 ACTCAAAAGCAGACAGAGGATGG + Intronic
1099232219 12:80040057-80040079 AAAAAAAAGCAGACAGAGAAGGG - Intergenic
1100908235 12:99326497-99326519 ATTCAAAAACAGAGAGAAGAAGG - Intronic
1101077077 12:101141590-101141612 TCTGAGAAGTAGACAGAGGATGG + Intergenic
1101437110 12:104673119-104673141 ACAAAAAAGAAGACAGAAGAGGG - Intronic
1102778902 12:115546556-115546578 ACTTAAAAGCAGAAAGATGTAGG + Intergenic
1102812762 12:115838622-115838644 CCTTAAAAGAAGACAGAGAAAGG + Intergenic
1103184363 12:118943638-118943660 GCTCAAAAGCAGCCACAGGCTGG + Intergenic
1103680663 12:122690966-122690988 AATAACAAGCAGAAAGAGGAAGG - Intergenic
1103783597 12:123415753-123415775 CCTTCAAAGCAGACTGAGGAGGG - Exonic
1103913529 12:124364524-124364546 TCTCAGTAGCAGACAGAGGAAGG - Intronic
1104872149 12:132007524-132007546 ACCCAAAAGCCAAGAGAGGAAGG - Intronic
1105061081 12:133151673-133151695 ACTCTAAAGTTGACAGAGGCAGG - Intronic
1105895116 13:24710760-24710782 ACACAAAAGCAGACAGACTTGGG - Intronic
1106399810 13:29418855-29418877 ATTCAAAAGCTGAGAGAGAATGG - Intronic
1106510779 13:30410602-30410624 ACTCAAAGAAAGAGAGAGGAAGG + Intergenic
1106895741 13:34300426-34300448 CCTCAAAGGCAGAAAGAGAAAGG + Intergenic
1106920249 13:34555698-34555720 ATTCAAAAGCAGACCCAGGAAGG + Intergenic
1107021740 13:35759308-35759330 ACTCAGAGACAGGCAGAGGATGG - Intergenic
1107193018 13:37612741-37612763 ACTACAAAGCGGAGAGAGGAAGG + Intergenic
1107379382 13:39839713-39839735 ACTCAAAAGTAGGCACTGGATGG - Intergenic
1107392132 13:39976838-39976860 ACACAAATGCAGACAGATGATGG - Intergenic
1107613211 13:42137745-42137767 ACTAAAGAGCTCACAGAGGATGG + Intronic
1107977885 13:45707115-45707137 TCTCAAGAGCAGTCAAAGGAAGG + Intronic
1108031511 13:46235237-46235259 ACACAACAGAAGACAGAGGGAGG - Intronic
1108195177 13:47986325-47986347 TCTCAAAAGAAGACACAGGCTGG - Intronic
1108494226 13:51008135-51008157 ACTGAAAAGCAGAAGGAGAAAGG - Intergenic
1109262921 13:60164428-60164450 ACCCAAAATCAGACAGAGCTAGG + Intergenic
1109985120 13:69970777-69970799 AAACAGAAGCAGGCAGAGGAAGG - Intronic
1110480145 13:75964596-75964618 ACTCAAAAGCACACAGAGCCAGG - Intergenic
1111243923 13:85509770-85509792 ACGCAATAGCAGACAGTGGAAGG + Intergenic
1111700245 13:91677880-91677902 AGTCAAAAGCAGAAAGAATAGGG - Intronic
1111994995 13:95157204-95157226 TCCCAACAGCAGACAGAGCATGG + Intronic
1112547171 13:100382232-100382254 GCTGAAAAGGGGACAGAGGAGGG + Intronic
1112614084 13:100985590-100985612 ACTCAAAGGTAGGCAGAGGAGGG + Intergenic
1112821561 13:103343550-103343572 ACTCAAAAACAGCAAAAGGAGGG - Intergenic
1113554065 13:111216894-111216916 TCTGAAAGGCAGAAAGAGGAAGG - Intronic
1113760934 13:112846094-112846116 CCTCAAAAGCAGCCAGAAAAGGG - Intronic
1113803251 13:113097056-113097078 ACTCCAGAGCCCACAGAGGAGGG + Exonic
1114047465 14:18889096-18889118 ACTAAAAAGCAGACAGATCCTGG - Intergenic
1114116748 14:19630312-19630334 ACTAAAAAGCAGACAGATCCTGG + Intergenic
1114434756 14:22696521-22696543 ACTTAAAAGCAGCCAGAGTGGGG + Intergenic
1114547285 14:23512359-23512381 AATCAAAAGCAGGCAGGGAAGGG + Intergenic
1114832182 14:26157724-26157746 TCTTAAGAGCAGAGAGAGGATGG - Intergenic
1115762926 14:36593759-36593781 ACACAAACACACACAGAGGAAGG - Intergenic
1116481838 14:45400461-45400483 AGGAAAAAGCAGGCAGAGGATGG + Intergenic
1117109063 14:52429802-52429824 CCTGAAAAGGATACAGAGGATGG + Intergenic
1118617376 14:67583692-67583714 AGTCAAAATCTGACAGTGGATGG - Intronic
1118987190 14:70766659-70766681 ACTCCAAACCAGACACAGAAAGG + Intronic
1119754819 14:77108772-77108794 ACTCAAAAGAAGAGGGAGGAGGG - Intronic
1120100793 14:80443404-80443426 ACTCAAAAGAAGACATAGAATGG + Intergenic
1120115117 14:80607315-80607337 ACACAAAAAAAGAGAGAGGAAGG + Intronic
1121468010 14:94128359-94128381 ACTCAGAAGGAGCCAGAAGAGGG + Intronic
1121497836 14:94409182-94409204 ACTCAATAACAGACAGAGAGAGG + Intergenic
1121878400 14:97476533-97476555 ACTAAAAAGCAGAAAGAAGAAGG - Intergenic
1124157812 15:27243374-27243396 ACTCAAATGTAGGCAGGGGATGG + Intronic
1124511577 15:30331800-30331822 ACTCATAAGGAGAAAGAGAAAGG + Intergenic
1124552718 15:30696415-30696437 ACTCAGAAGCAGAGAGCTGAGGG - Intronic
1124678524 15:31709255-31709277 ACTCAGAAGCAGAGAGCTGAGGG + Intronic
1124731337 15:32198957-32198979 ACTCATAAGGAGAAAGAGAAAGG - Intergenic
1125254745 15:37750607-37750629 ACTCAAAAGAAGACATACAAGGG + Intergenic
1126392541 15:48175271-48175293 ACTCAGAAGCAGAGAGTAGAAGG + Intronic
1126455012 15:48851605-48851627 ATTCAAAATTAGACAGAGGTTGG - Intronic
1127213086 15:56795521-56795543 ACACAGACGCACACAGAGGAAGG - Intronic
1128658955 15:69483888-69483910 AATCAAAAGCAGATGGAGGGCGG - Intergenic
1128787054 15:70405379-70405401 TCTGAATAGCAGAGAGAGGAAGG + Intergenic
1130159445 15:81384123-81384145 CCTCACAAGCAGAGAGAGGAAGG - Intergenic
1130622436 15:85477514-85477536 ACTCAAACCCAGACACAGCAAGG - Intronic
1130768783 15:86903167-86903189 ACTCAACAGCAGAAAGGAGAAGG - Intronic
1131351534 15:91705244-91705266 AACTCAAAGCAGACAGAGGAAGG + Intergenic
1131726819 15:95235339-95235361 GCTCAGAAGAAGACAGATGAGGG - Intergenic
1132060489 15:98688323-98688345 AGTGAAAGGCAGAGAGAGGAGGG - Intronic
1133901297 16:9977576-9977598 ACTCCAAAGCTGAGAGTGGAAGG + Intronic
1133926935 16:10200862-10200884 ACTGAGGAGCAGCCAGAGGAGGG + Intergenic
1135551230 16:23399702-23399724 ACACAGAGGCAGACAGAGGCTGG + Intronic
1135834702 16:25814638-25814660 ACTAAAAAACAGACATAGGCCGG - Intronic
1135854749 16:25997769-25997791 TCTCAAAATCAGCCAGAGCATGG - Intronic
1136886733 16:33934775-33934797 AATCAAAAACAGCCAGGGGAAGG + Intergenic
1137430614 16:48415343-48415365 ACTGGAAGGCAGATAGAGGATGG + Intronic
1137667078 16:50257261-50257283 ACTCAGAAGCAGCAAGTGGAAGG + Intronic
1137672415 16:50286757-50286779 ACTGAAATTCAGAGAGAGGATGG + Intronic
1137708644 16:50551502-50551524 ACTCCCAAGGAGACAGAGGCCGG - Intronic
1138078244 16:54063921-54063943 CCTTAAAAGCAGTCAGAAGAAGG - Intronic
1138496774 16:57413682-57413704 ACTCAACTGGAGACAGAGGTGGG - Intronic
1139671295 16:68493678-68493700 ACTCCAAATCTGTCAGAGGAGGG - Intergenic
1140717162 16:77737163-77737185 AGTAAAAAGCAAACAGAGCATGG - Intronic
1140852473 16:78947990-78948012 AGTCAAAGGCAGAGGGAGGAAGG + Intronic
1141448864 16:84083069-84083091 ACTCAACAGCAGAGAGCTGACGG + Intronic
1141595044 16:85092237-85092259 ACTAAAAAGCCAACAGAGGCAGG - Exonic
1141941584 16:87279415-87279437 ACGCAGAAGCACACAGATGATGG + Intronic
1143422037 17:6800991-6801013 ACTCAACAGCTGACAGCAGATGG + Intronic
1143685615 17:8513208-8513230 CCTCATAAACAGACATAGGAAGG + Intronic
1143714615 17:8758035-8758057 GCTCAAAAGATGAGAGAGGAAGG - Intronic
1144735763 17:17554479-17554501 GCTTAAAAGCAGCCAGAGCAGGG - Intronic
1145946747 17:28781834-28781856 ACTCAGAAGCAGAGAGATAATGG + Intronic
1146231183 17:31111490-31111512 GCTTAAAAGCAGCCAGAAGAGGG + Intronic
1146539749 17:33684115-33684137 AGTCAAAAACAGAAAGAGTATGG - Intronic
1146651726 17:34611248-34611270 ACTCAAGAGCAGGCAGGGGTGGG + Intronic
1146912947 17:36659790-36659812 AGTCAAAGGCAGACGGAAGAGGG + Intergenic
1148772404 17:50075094-50075116 AGACAAAGGCAGACAGAGCAGGG + Intronic
1149167390 17:53768849-53768871 ACTCAAATGCAAACAAAAGATGG - Intergenic
1151580879 17:74977838-74977860 AATCAAAAAAAGAGAGAGGAGGG + Intergenic
1152689189 17:81710239-81710261 GCTCCAAAGCAGAAAGAGCAGGG - Intergenic
1153401928 18:4691152-4691174 ACTCAGAAGAAGACATAGAATGG + Intergenic
1153459050 18:5313548-5313570 TCCCAAATGCACACAGAGGATGG - Intergenic
1153525092 18:5987196-5987218 AGTCAAAAGAAGACAAAAGAAGG - Intronic
1154962076 18:21319236-21319258 ATTCAAAATCATACAGAGAAGGG + Intronic
1155344941 18:24848658-24848680 ACTCAAAAGCCCCAAGAGGATGG - Intergenic
1155723030 18:29042975-29042997 TCTTAAAAGTAGCCAGAGGAAGG + Intergenic
1155784145 18:29876534-29876556 TCTGAACAGCAGAAAGAGGATGG + Intergenic
1156117421 18:33802776-33802798 TCTCAAAAGAAGACAGAGGAGGG + Intergenic
1156408142 18:36802344-36802366 AGTCAAAAGCAGGCAGAAGCTGG - Intronic
1156787600 18:40934320-40934342 AATGAAAAGCAGACATTGGATGG - Intergenic
1156931149 18:42645154-42645176 ACTCAAAGGCAGATAGGAGAGGG - Intergenic
1157666998 18:49495755-49495777 ACTCAAATATAGACAGAAGAAGG - Intergenic
1158144319 18:54294194-54294216 AATGAAAAGCAGACACAGCAGGG - Exonic
1158789159 18:60754762-60754784 ACTCAAAGGCAGACAGAAGAGGG - Intergenic
1159587451 18:70294193-70294215 AGTCAAAAGCAGTCAGATAAAGG - Intronic
1159960113 18:74548641-74548663 ACTCAGTAACAGACAGAGGTTGG + Intronic
1160018536 18:75162898-75162920 CCTCACAACCAGACAAAGGAAGG + Intergenic
1160070663 18:75625120-75625142 ACACAAAGACAGACAGAAGATGG + Intergenic
1160197508 18:76768383-76768405 TCTCCAAAGAAGACAGAGGATGG - Intergenic
1161054032 19:2181002-2181024 ACTGACAAGGAGACAGAGGAAGG - Intronic
1163268173 19:16233891-16233913 CCTCAAAAGCCCACAGAGGGAGG + Intronic
1165032112 19:33005478-33005500 ACTACAAAGAAGTCAGAGGAAGG - Intronic
1166104363 19:40590108-40590130 ACTCAAAAGCAGGCTAGGGATGG + Intronic
1166601764 19:44101928-44101950 ACCCAAAAGGTGAAAGAGGAAGG - Intronic
925518296 2:4709572-4709594 ACTCAGAAGCAGAGAGTAGAGGG + Intergenic
927607757 2:24503364-24503386 ACTGTTAAGAAGACAGAGGAAGG - Intronic
927624078 2:24694685-24694707 ACTCAAAAACAGAATGAAGAAGG - Intronic
927815942 2:26217555-26217577 ATCTGAAAGCAGACAGAGGAAGG + Intronic
928308510 2:30191057-30191079 GCTCCAAAGCCGAAAGAGGAGGG - Intergenic
928425372 2:31173410-31173432 ACTCCATAGCAGACTCAGGAAGG - Intronic
928522810 2:32106782-32106804 ATTTTAAATCAGACAGAGGAAGG - Intronic
930220009 2:48736558-48736580 ACTCAAAAGAAAAAAGAAGAGGG - Intronic
930333880 2:50020865-50020887 ACTCAAAAGTAGAAAGAGAAAGG - Intronic
930862512 2:56089638-56089660 TCTGAAAATAAGACAGAGGAAGG - Intergenic
931235975 2:60412973-60412995 TTTTAAAAGCAGACAGAGGTAGG + Intergenic
931433977 2:62231549-62231571 ACCCAAAGGCAGTCAGAGGAGGG - Intergenic
934719395 2:96562790-96562812 ACTCAAAAGGCAGCAGAGGAAGG + Intergenic
935390362 2:102545702-102545724 ACTCAATTGAAGACAGAAGATGG + Intergenic
936081327 2:109434562-109434584 ACTCAGAAGCAGGAAGAGGGTGG - Intronic
937253518 2:120539252-120539274 AATGAAAAGCTGATAGAGGAAGG + Intergenic
937939744 2:127275807-127275829 GCTGAAAAGCAGACAGATGCAGG + Intronic
938059055 2:128238110-128238132 ACTCAAAGGCAGGCTGAGGAGGG - Intronic
938162958 2:129002917-129002939 TCTCACAAGCGGAAAGAGGATGG - Intergenic
938265590 2:129925889-129925911 ACTCAAGAGCAAGAAGAGGATGG + Intergenic
938707070 2:133941389-133941411 ACTCAAAATCAGATAGAGAATGG + Intergenic
938951551 2:136259242-136259264 AGTCAAATGCAGCCAGAGGGTGG - Intergenic
939067682 2:137504325-137504347 TCTCAAAAATACACAGAGGAAGG - Intronic
939285917 2:140129083-140129105 ACTCAAAAGCTAACAGATGCTGG - Intergenic
942073068 2:172332679-172332701 ACACCAAAGCAGGCAGAGGCTGG - Intergenic
942166581 2:173246619-173246641 ATTCAAAAGCAGAATTAGGAAGG + Intronic
942764592 2:179439708-179439730 ACTCACAAATAGGCAGAGGAAGG - Intergenic
943117689 2:183693386-183693408 ACTCAAAAGCCTACAGAGGCTGG - Intergenic
943202843 2:184851370-184851392 ACTCAGAAGCAGAAAGAGAATGG - Intronic
944081598 2:195794589-195794611 TCTCAAAAGCATACATATGAAGG + Intronic
944619388 2:201498451-201498473 AGAACAAAGCAGACAGAGGAAGG - Intronic
944627549 2:201587586-201587608 TCTTAAAGGCAGCCAGAGGAGGG - Intronic
945122200 2:206468618-206468640 GCTCAGAAGAAGACAGAAGATGG - Intronic
946476484 2:220011285-220011307 ACTCACAATCAGAAAGGGGAGGG - Intergenic
946961776 2:224993061-224993083 ACTGAAAATCAGGCAGTGGAAGG + Intronic
947073505 2:226317390-226317412 ACACAAAAGCAAGCAGAGTAGGG + Intergenic
948997097 2:241587040-241587062 ACTTGAAAGCAGCCAGAGGTGGG + Intronic
1169110736 20:3031766-3031788 ACTCAAAAACACACAGAGTAAGG - Intronic
1169280353 20:4262054-4262076 ACTCAAAAACAGGCAGAGACTGG + Intergenic
1169534784 20:6526042-6526064 AGTCATAAGCAGATAGAGCAAGG - Intergenic
1169760657 20:9089385-9089407 ACTTAAAAGCACAAAGAAGAAGG + Intronic
1171079038 20:22159109-22159131 TCCCAAAAGCAGACAGAGGATGG + Intergenic
1173058747 20:39641705-39641727 ATTCAAACGCAGACATAGCAAGG - Intergenic
1173093148 20:39995331-39995353 ACTCAATTGCACACAGATGAAGG - Intergenic
1173301798 20:41810094-41810116 ACTGAAAAGTAGAAAGAAGAAGG + Intergenic
1173617802 20:44414260-44414282 GCTCTAAAGCTGACAGAGGAGGG + Intronic
1175516823 20:59575459-59575481 AATCAAAAGAACACAGAAGAGGG - Intergenic
1176256402 20:64155293-64155315 GCTCATTAGCAGACAGAGCAGGG - Intronic
1176870080 21:14076905-14076927 AGACAAAGACAGACAGAGGAAGG + Intergenic
1177713311 21:24807734-24807756 ACTCAGAACCACACAGAGAAAGG + Intergenic
1177940850 21:27409862-27409884 AGGATAAAGCAGACAGAGGAAGG - Intergenic
1178465541 21:32844126-32844148 AGGCAAAAGCAGACTGGGGATGG - Intergenic
1178682105 21:34680951-34680973 ACTGGAAAACAGACAGAGGTTGG - Intronic
1178758763 21:35379865-35379887 ACTAAAAAGCAGACAGAAACGGG + Intronic
1178855187 21:36244872-36244894 AGACAAAAGTAGACAAAGGAAGG - Intronic
1180030025 21:45200547-45200569 ACTCAAAGGCACGCACAGGAAGG + Intronic
1180044138 21:45295163-45295185 TCTCAGGAGCAGACAGAGGTGGG + Intergenic
1180465999 22:15611767-15611789 ACTAAAAAGCAGACAGATCCTGG - Intergenic
1181440632 22:22933653-22933675 ACTGAAGGGCAGAGAGAGGACGG + Intergenic
1181821041 22:25475914-25475936 ACACAAAAGGAAACAGAGCATGG + Intergenic
1182722431 22:32414320-32414342 CCTGATAAGCAGACAGTGGAGGG - Exonic
1184379433 22:44135868-44135890 ACACAGAAACAGACAGAGGGAGG - Intronic
1184641405 22:45873163-45873185 TCTTAAAAGCAGCCAGAGGGGGG + Intergenic
1185051833 22:48558037-48558059 AATCTAAAGGAGACAGGGGAGGG - Intronic
1185403753 22:50633182-50633204 AATCAAAAGCTGCCAGTGGAGGG - Intergenic
949873442 3:8608353-8608375 ATTCAGAGGCAGACAGAGGGAGG - Intergenic
950019491 3:9777076-9777098 ACTCAGGAGCAGACAGGGGCTGG + Intronic
950350594 3:12347376-12347398 CCATAAAAGCAGACAAAGGAAGG - Intronic
953166413 3:40469099-40469121 TCTCAAAAACAAACAGAGGCTGG - Intergenic
953290186 3:41652636-41652658 AGTGAAAAGCAGAAAGAGGTGGG + Intronic
954374784 3:50188562-50188584 CCTCAAGAGCACACAGAGAAGGG + Exonic
956319259 3:67977839-67977861 AGTCAAAAGAGCACAGAGGAGGG + Intergenic
956731725 3:72202621-72202643 ACACAAAAGCAGACATATTATGG - Intergenic
956889158 3:73593450-73593472 ACTCTAACACGGACAGAGGATGG + Intronic
957423076 3:79997676-79997698 ACTGAAAAGCAGAAAAAGCAAGG - Intergenic
958758094 3:98274425-98274447 ATTCATAGGCAGACAGGGGAAGG + Intergenic
958795310 3:98700842-98700864 AGTCTGAAGCAGACTGAGGAAGG + Intergenic
958812609 3:98879144-98879166 ACACAAAAGTAGAAAGAAGAGGG + Intronic
958884722 3:99712960-99712982 ACTCAAAAGTAGAGAAAGGAAGG + Intronic
959917065 3:111827949-111827971 ACTATAAAGCTGACAAAGGAGGG + Intronic
960145049 3:114192003-114192025 GCTCAATGGCAGAGAGAGGAGGG + Intronic
960360503 3:116705489-116705511 ATACAAAAGAAAACAGAGGAGGG + Intronic
960727263 3:120683061-120683083 ACTCAAATGCCAACAGATGAGGG + Intergenic
961522804 3:127477069-127477091 AATCAAAGGCAGAGAGAGCATGG + Intergenic
962313040 3:134339360-134339382 ACTCAGCAGCAGGCAGAGGCCGG - Intergenic
963114829 3:141718548-141718570 TCTTAAAAGCAGCCAGAGGCTGG - Intergenic
964408980 3:156378863-156378885 ACCCAAAAACAGAGGGAGGAGGG + Intronic
964663552 3:159148280-159148302 AAACAAAAACAGACATAGGAAGG - Intronic
965193881 3:165568688-165568710 ACTCAGAAACAGAAAGTGGAAGG + Intergenic
965431969 3:168599962-168599984 AAAAAAAAGCAGACAGGGGATGG + Intergenic
967194697 3:187016299-187016321 GCTAAAAAGGAGACAGAGAAGGG + Intronic
967692523 3:192493465-192493487 ACTCAAAGGAAGACATAAGAAGG + Intronic
968039931 3:195580300-195580322 TATCAAAAGCAGAAAGATGATGG + Intronic
968839276 4:2989964-2989986 AGGCCAAAGCAGAGAGAGGAAGG - Intronic
969472737 4:7399248-7399270 CCTCAAATGCAGACAGAGGGTGG - Intronic
970179052 4:13369477-13369499 ACACACAAGCAGACAAAGAAGGG + Intronic
970520400 4:16878101-16878123 AATCAAAAGCAGGTAGGGGAAGG + Intronic
972577164 4:40362649-40362671 ACACAAAAGAAGACAGAAAAGGG + Intergenic
972613504 4:40676640-40676662 ACTTAACAGCAGACGGAAGATGG - Intergenic
973875838 4:55217555-55217577 ACTCAGAAGCAAAAACAGGAAGG - Intergenic
975765466 4:77663205-77663227 AGTCAGAAGCAGACAGCGGGTGG - Intergenic
975940777 4:79643025-79643047 ACTCAGAAGAGGACAGAGGATGG - Intergenic
976668484 4:87626040-87626062 ACTGAGAAGCAGTGAGAGGATGG - Intergenic
976848986 4:89523515-89523537 ACTGAAATGCAGAAAGATGAAGG + Intergenic
978045075 4:104115378-104115400 ACTCAGTAGCAGGCAGAGGTTGG - Intergenic
979515563 4:121605853-121605875 ACACATAAGCAGAGAGTGGAGGG - Intergenic
980661167 4:135860408-135860430 ACTCACAGGCAGACAGGTGAGGG - Intergenic
982591112 4:157312392-157312414 ACTCTAAAGAAGACAGCTGAGGG + Intronic
983403862 4:167300173-167300195 TCTTGAAAGCAGCCAGAGGAGGG + Intergenic
984517863 4:180763665-180763687 AGACAAAAGCAGATAGAGAAGGG - Intergenic
985028590 4:185764984-185765006 ACTCACAACCAGACAAAGGAAGG - Intronic
985186487 4:187322263-187322285 ATTTAATAGCAGACAGAGGAAGG + Intergenic
985262983 4:188132004-188132026 ACTCAGAAGCAGAAAGTAGAAGG - Intergenic
986028154 5:3870377-3870399 AGTCAAAAGGAGAAAGAAGAAGG - Intergenic
986046914 5:4047299-4047321 ACTAAAAAGAAGACAAAGGAAGG + Intergenic
986143449 5:5053117-5053139 AAAGAAAAACAGACAGAGGAAGG + Intergenic
986661360 5:10062956-10062978 ACTCAGAGGCAGACAGAGGAGGG - Intergenic
987080614 5:14422057-14422079 GCTCAAAAGGAGAGAGTGGACGG - Intronic
988439502 5:31216326-31216348 ACACAAAAGCAGGCAGTGGCTGG - Intronic
988630106 5:32920284-32920306 TCTCAAAAGAATACAAAGGATGG - Intergenic
990396763 5:55390031-55390053 ACTCAAAGTCAGACAGGGCAAGG - Intronic
992192135 5:74303597-74303619 ACTCAAAAAGAGACACAGGCAGG - Intergenic
992197830 5:74357259-74357281 CCTCAGAAGCAGAGTGAGGAGGG - Intergenic
994007532 5:94856915-94856937 CCTTAAAAGCAGAGAGAGGAAGG + Intronic
994846527 5:104995258-104995280 ATTCAAAAACTGACAGAGGCTGG - Intergenic
995541282 5:113188553-113188575 ACACAAAAGCAGAAAGGGGAAGG + Intronic
995826227 5:116302689-116302711 ACTCAGAAGTACATAGAGGAAGG - Intronic
995985903 5:118173213-118173235 ATTTAAAAGCAAACAGAGGCTGG - Intergenic
996324979 5:122262614-122262636 ACTAAAAAGAAGTGAGAGGAAGG - Intergenic
997136940 5:131336954-131336976 ACTGACGAGCTGACAGAGGAAGG - Intronic
997218518 5:132135798-132135820 ATTCAAAAGCAGGCAGAAAAGGG + Intergenic
997417718 5:133741767-133741789 ACTCAAAAGCTAACACAGAATGG + Intergenic
997708170 5:135978260-135978282 ACACAAAAGCAGACTAAGGCAGG - Intergenic
998481880 5:142469741-142469763 ACACAAAAGCAGAGTGAGAAAGG - Intergenic
998785553 5:145704890-145704912 ATTAAAAAGCACACACAGGAAGG + Intronic
998921779 5:147076769-147076791 ACTGAAGAGGAGACAGAGCATGG - Intronic
999242232 5:150134565-150134587 ACTCAGGCGCAGAGAGAGGATGG - Intronic
999323024 5:150626319-150626341 TCTCCTAAGGAGACAGAGGAAGG - Intronic
999393623 5:151212491-151212513 TGTCAAAAGCAGACAGAGTCAGG + Intronic
999501655 5:152152552-152152574 ACTGAAACACAGAGAGAGGAAGG - Intergenic
999935280 5:156479513-156479535 ACTCAAATGCCTACAGAGGTTGG - Intronic
1000505997 5:162118905-162118927 ACTCAGAGGAAGACAGAGGAAGG + Intronic
1001216879 5:169864459-169864481 ACTGAAAAACACAGAGAGGAAGG + Exonic
1002449982 5:179313298-179313320 ACTCACACCGAGACAGAGGAGGG + Intronic
1002450008 5:179313462-179313484 ACTCACACCGAGACAGAGGAGGG + Intronic
1002450033 5:179313630-179313652 ACTCACACCGAGACAGAGGAGGG + Intronic
1002450045 5:179313716-179313738 ACTCACACCGAGACAGAGGAGGG + Intronic
1002450058 5:179313802-179313824 ACTCACACCGAGACAGAGGAGGG + Intronic
1002450072 5:179313888-179313910 ACTCACATCGAGACAGAGGAGGG + Intronic
1002450085 5:179313974-179313996 ACTCACACCGAGACAGAGGAGGG + Intronic
1003945531 6:11072090-11072112 ACTAGAAAGTAGACAGAGAAAGG + Intergenic
1004153926 6:13150002-13150024 CCTCAAAAGCAGAGAGAGGCAGG - Intronic
1004870173 6:19896399-19896421 GCTAGAAAGCAGACAAAGGAAGG - Intergenic
1004983158 6:21049062-21049084 AGTCAGAAGCAGACAGAAAAAGG + Intronic
1006428845 6:33982848-33982870 ACTCAGCAGCATGCAGAGGATGG + Intergenic
1006635440 6:35458203-35458225 ACTGGACAGCAGACAGAGCAGGG - Intronic
1007993344 6:46280493-46280515 ACACAAAAGCACACACAGCAAGG + Intronic
1008200921 6:48589149-48589171 ACTCAGAAGGACAAAGAGGAAGG + Intergenic
1008374317 6:50773889-50773911 GCACAAAAGCAGAAAAAGGAAGG - Intergenic
1008817373 6:55584539-55584561 TCTCAAAAACAGAGTGAGGAGGG + Intergenic
1009322438 6:62308827-62308849 ACATAAAAGCAGACAGTGGCAGG - Intergenic
1010017442 6:71121687-71121709 ACTCCAATGCAGACAGAGCTGGG - Intergenic
1010495930 6:76533483-76533505 ACGGAAAAGCAGCCAGAGGCAGG - Intergenic
1010517960 6:76797643-76797665 TCTCAAAAGAAGACATATGAAGG - Intergenic
1012202485 6:96423919-96423941 AGACGAAAGCAGACAGAGGGGGG - Intergenic
1012316922 6:97791872-97791894 ATTCGTAAGCAGACAGGGGAGGG - Intergenic
1013589714 6:111609799-111609821 GCTGAAAAGCAGCCTGAGGATGG + Intergenic
1013887497 6:114987987-114988009 GATAAAAAGCAGGCAGAGGAAGG + Intergenic
1015327826 6:131943926-131943948 GCACAAAAGCATACAGAGTAGGG - Intergenic
1015755363 6:136600645-136600667 ACCCCAAAGATGACAGAGGAAGG + Intronic
1016261665 6:142178651-142178673 ACTCTAAAGAAGGCAGAGAAGGG + Intronic
1016592595 6:145763021-145763043 ACCTAAAAGCAGTCAGAGGGGGG + Intergenic
1017473424 6:154763157-154763179 AATGAAAAGCAGAATGAGGAGGG - Intronic
1017590501 6:155974074-155974096 ACACAAAATCAGGAAGAGGAAGG + Intergenic
1018485414 6:164236610-164236632 ACAAAAAAGCAAAAAGAGGAAGG + Intergenic
1018931228 6:168241691-168241713 CCTCAAAGGCGGCCAGAGGAGGG + Intergenic
1019871954 7:3772188-3772210 ACACAAAAGCAGACAAATGCAGG - Intronic
1020745382 7:12072786-12072808 TCTCAACAGCAGAAAAAGGATGG + Intergenic
1020926995 7:14341272-14341294 ACGTTAAAGCAAACAGAGGAAGG - Intronic
1021900372 7:25279298-25279320 ACAAAAAGGCAGGCAGAGGAAGG + Intergenic
1022336021 7:29423007-29423029 AGTCAAAAGCAGCCTGAAGAAGG - Intronic
1022495280 7:30849284-30849306 GCTCAAAGGAATACAGAGGAGGG - Intronic
1023076387 7:36486495-36486517 ACTCAAAGGCAGGCAGAGGAAGG - Intergenic
1024355920 7:48413225-48413247 AGACAGAAGCAGAAAGAGGAGGG - Intronic
1024561318 7:50647848-50647870 ACTCAAAAGAGGAGTGAGGAAGG + Intronic
1024584788 7:50832697-50832719 ACTCAGAAGCAGACAGGGCATGG + Intergenic
1025160953 7:56660342-56660364 ACCCAAAAGCAGTCAGAAGTTGG + Intergenic
1025639311 7:63352594-63352616 ACTCAGAAGCAGAGAGTGGGAGG - Intergenic
1025643388 7:63395498-63395520 ACTCAGAAGCAGAGAGTGGGAGG + Intergenic
1027538147 7:79432955-79432977 TCTCAAGAGGAGACAGAAGAAGG + Intronic
1027844617 7:83356833-83356855 CCTCAAATGCAGAAAGAAGAAGG + Intergenic
1028157364 7:87446719-87446741 ACTCAACGGCAGAGGGAGGATGG + Intronic
1028710493 7:93902278-93902300 ATTAAAAAGCAGGCAGAAGAAGG - Intronic
1029601438 7:101565799-101565821 ACTCAGAAGGAGGCAGAGGCTGG - Intergenic
1030023405 7:105298224-105298246 ACTCAAAAGCATACAGACTCTGG - Intronic
1030337689 7:108343574-108343596 ACTCAAAAGAAGAAATAGAATGG + Intronic
1030502832 7:110381930-110381952 AGGCAAAGGAAGACAGAGGAAGG + Intergenic
1030757313 7:113302946-113302968 ACTCAAAAACAGACGTAAGATGG + Intergenic
1032266518 7:130373815-130373837 AGTCAACAGCAGGCAGGGGAAGG + Intergenic
1033227128 7:139571180-139571202 ATTCAACAGCAAACAGAGGTTGG + Exonic
1033734778 7:144211059-144211081 ACTAAAAAACAGACTCAGGATGG - Intergenic
1034221432 7:149449439-149449461 AGGGAAAAGCAGACAGAGAAAGG + Intronic
1035956662 8:4088087-4088109 CCACAAAAGGAGAAAGAGGAAGG + Intronic
1036949916 8:13131532-13131554 ACTCAAAACAAGACTGGGGATGG + Intronic
1036980933 8:13469113-13469135 AATAAAAAGCAGACACAGGCTGG - Intronic
1037349534 8:17936018-17936040 ACTCAAAAGCAGAGTTAGGGTGG - Intronic
1038254961 8:25942584-25942606 ACTCTAAAGCCGCCTGAGGAGGG - Intronic
1041040704 8:53843333-53843355 ACTCCAAAGCAGCAAGAGGAGGG + Intronic
1041266257 8:56068151-56068173 ACACAAAAGTAGAGAGAGAATGG - Exonic
1041346020 8:56898744-56898766 ACTCAAAGTCAGGCAGAGAAGGG - Intergenic
1043430031 8:80185648-80185670 ACTCAAAGGCAGCCAGGAGAAGG - Intronic
1043950162 8:86299780-86299802 ACTCAAAGGCAGAGAGAAGAAGG - Intronic
1045238437 8:100376812-100376834 ACTCAAAATCAAAAAGAAGAGGG + Intronic
1045770175 8:105727872-105727894 GTTCAACAGCAGACAAAGGAAGG + Intronic
1046397475 8:113658946-113658968 ACTCAAAAGCAGACATGAGCAGG + Intergenic
1046595988 8:116261729-116261751 ACTGCAAAGGAGACTGAGGAAGG + Intergenic
1047132369 8:122035843-122035865 ACACAAAATCAGACAGGGAAAGG - Intergenic
1047153497 8:122292003-122292025 ACTCAAAACCAGATGGGGGAAGG - Intergenic
1048416422 8:134232239-134232261 ACTAAAAAGTGGAGAGAGGAAGG + Intergenic
1048445261 8:134488517-134488539 ACTCCAAAGCAGAGAGTGGGTGG - Intronic
1050538467 9:6649984-6650006 AGCCAAAAGCAGATTGAGGAGGG + Intergenic
1050582132 9:7070033-7070055 AATCAAAAGCAGGCAGAACAGGG + Intronic
1051390672 9:16559882-16559904 CTTCAAAAGCAGACAGATGTAGG + Intronic
1054970767 9:71083450-71083472 AATAAAATGCAGACAGAGGCAGG - Intronic
1055114209 9:72589661-72589683 TCTCAAAATCAGAAAAAGGATGG - Intronic
1056041870 9:82676598-82676620 ACTCAGAAGCAGAGATGGGAGGG - Intergenic
1056686104 9:88761373-88761395 AACTAAAAGCAAACAGAGGAAGG + Intergenic
1056880154 9:90383832-90383854 ACTGAAAAGCACAGAGATGAAGG + Intergenic
1057846686 9:98531367-98531389 ACTCCAGAGCAGAGAGAAGATGG - Intronic
1058201431 9:102046721-102046743 TCTCAAAAGAAGACATAAGATGG - Intergenic
1059894967 9:118853193-118853215 AGTCAAAAGCAGACAGAAACTGG + Intergenic
1059916075 9:119102370-119102392 ACTCAAAAGCAGACAGCAAAAGG - Intergenic
1061306706 9:129736564-129736586 ACTCACAAGCCGACAGAACAGGG + Intergenic
1061812205 9:133168839-133168861 ACTACAAAGCATACAGATGAAGG + Intergenic
1061835364 9:133325244-133325266 ACAAGAAAGCAGAGAGAGGATGG + Intergenic
1062025730 9:134339298-134339320 GCTCACACGCAGACAGAGGAGGG - Intronic
1062652447 9:137585039-137585061 ACTCACAAGCAGTATGAGGAAGG + Intronic
1185659161 X:1713147-1713169 ACTCAAAGACAGACAGAGGAGGG + Intergenic
1185721862 X:2388674-2388696 ACACAGACACAGACAGAGGAAGG + Intronic
1185972113 X:4676663-4676685 ACAAAAAAGCAGTCATAGGATGG - Intergenic
1186123484 X:6387472-6387494 ACAAAAAGGCAGAGAGAGGAAGG - Intergenic
1186607546 X:11107809-11107831 AGTCAGAAGCAGACACTGGAAGG - Intergenic
1186797314 X:13059394-13059416 AATCAAAAGCAGACAGTGATTGG - Intergenic
1187013928 X:15307701-15307723 AGTCAAAAGCACCCCGAGGAGGG + Intronic
1187566094 X:20451126-20451148 AATGAAAAGCAGAGAGATGATGG - Intergenic
1187967584 X:24627734-24627756 AGGCAAAAGAAGACAGAGGCAGG + Intronic
1188259817 X:28009071-28009093 ACTGAATAACAGACAGAGGTTGG - Intergenic
1188651191 X:32633472-32633494 GCTCAGAAGAAGACAGATGAGGG - Intronic
1188835141 X:34946175-34946197 ACTCAAGAGGAGACACAGGTTGG - Intergenic
1189169864 X:38898505-38898527 AGTCAAAGGCAGAAAGAGGAAGG + Intergenic
1189367202 X:40397937-40397959 AATCAGAAGCAGACAGAAGAGGG - Intergenic
1189531046 X:41883496-41883518 ACTCAAAAGCTGAAAGAAAAGGG + Intronic
1189570462 X:42290558-42290580 ACTCAAAAGTAGACAAAAGTAGG - Intergenic
1189826431 X:44923136-44923158 CCTCAAAAGCAGTCAAAGGCAGG - Intronic
1189954866 X:46267444-46267466 ACTCAAATCCATACAGAGAATGG - Intergenic
1190394925 X:49972350-49972372 ACACAAAAACAGAGGGAGGAAGG - Intronic
1190842190 X:54155536-54155558 ATTGAAAAGCAAACAGGGGAAGG + Intronic
1194404524 X:93478202-93478224 CCTCAAAAAAAGACAGAGTAAGG + Intergenic
1194940415 X:100002658-100002680 TCACAGAAGCAGACAGTGGAAGG + Intergenic
1196756298 X:119160345-119160367 ACTCAAAGGCAGGCAGGGGGTGG - Intergenic
1196890202 X:120284006-120284028 AACCAAAAGAAGACAGAGGTGGG - Intronic
1197316916 X:124978098-124978120 ACTCAAAAGCAGATCGAATATGG - Intergenic
1198230311 X:134682850-134682872 AGTCAAGAGCAGATAGAGGCCGG - Intronic
1198410446 X:136361900-136361922 ACTTAAAGGCATACAGAGAAAGG - Intronic
1199178729 X:144825815-144825837 ATTGAAAAGCAGAAAGAAGATGG - Intergenic
1200015903 X:153163695-153163717 AGACAAAAGCAGGCAGAAGAAGG - Intergenic
1200776064 Y:7171359-7171381 ACTAAAAAGAGGACAGAGGAAGG - Intergenic
1201298505 Y:12486102-12486124 TTTAAAAAGCAGACAGAGAAAGG - Intergenic
1201605204 Y:15776497-15776519 ACAAAAAGGCAGAGAGAGGAAGG - Intergenic
1202115245 Y:21465551-21465573 ACTAAGAAGGAGAAAGAGGATGG + Intergenic
1202170264 Y:22036025-22036047 TCTGAAAGGCAGAAAGAGGAAGG + Intergenic
1202221101 Y:22550348-22550370 TCTGAAAGGCAGAAAGAGGAAGG - Intergenic
1202322011 Y:23645314-23645336 TCTGAAAGGCAGAAAGAGGAAGG + Intergenic
1202548756 Y:26024742-26024764 TCTGAAAGGCAGAAAGAGGAAGG - Intergenic