ID: 1098024952

View in Genome Browser
Species Human (GRCh38)
Location 12:66191474-66191496
Sequence ATGAATACACAAAGGGACAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 597
Summary {0: 1, 1: 2, 2: 9, 3: 64, 4: 521}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1098024952_1098024957 -6 Left 1098024952 12:66191474-66191496 CCATTGTCCCTTTGTGTATTCAT 0: 1
1: 2
2: 9
3: 64
4: 521
Right 1098024957 12:66191491-66191513 ATTCATTCTCTCACAGGGAAAGG 0: 1
1: 0
2: 4
3: 15
4: 246
1098024952_1098024958 -5 Left 1098024952 12:66191474-66191496 CCATTGTCCCTTTGTGTATTCAT 0: 1
1: 2
2: 9
3: 64
4: 521
Right 1098024958 12:66191492-66191514 TTCATTCTCTCACAGGGAAAGGG 0: 1
1: 0
2: 0
3: 30
4: 335

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1098024952 Original CRISPR ATGAATACACAAAGGGACAA TGG (reversed) Intronic
900901006 1:5515818-5515840 GTGAAGACACAAAGGAACAGAGG - Intergenic
901355334 1:8642289-8642311 ATGAAAAGACAAAGGCACAGAGG + Intronic
901419310 1:9139707-9139729 TTGGATACACCAAGGGACACGGG + Intergenic
902794479 1:18792285-18792307 CTGAATATACAAATGGACAATGG + Intergenic
903375536 1:22863439-22863461 CTGGATTCACAAAGGGACAGGGG + Intronic
903934550 1:26886204-26886226 ATGAGTGCACAAAGGAAAAAAGG - Intronic
904346518 1:29875543-29875565 CTGAATATACAAATGGACAATGG + Intergenic
905117604 1:35655854-35655876 ATGAATATACAAAGGGATATGGG + Intergenic
905499174 1:38422549-38422571 AGGAATATACAAATGAACAATGG - Intergenic
908550906 1:65207736-65207758 TTGAATACACATGGGCACAAAGG - Intronic
909151517 1:72011810-72011832 AACACTACACAAAGGCACAAAGG + Intronic
909483429 1:76149668-76149690 AAAAATACACAATGGAACAATGG - Intronic
910041694 1:82859956-82859978 ATGAACTAACAAAGGAACAAAGG + Intergenic
910372861 1:86536664-86536686 ATTAATATACTAATGGACAAAGG - Intergenic
910567019 1:88655289-88655311 ATGAAGAAACCAAGGCACAAAGG + Intergenic
911096997 1:94062756-94062778 GAGAAGACACAGAGGGACAAAGG + Intronic
911531693 1:99051307-99051329 ATGAATACCCAAAGGAAAATAGG - Intergenic
911632390 1:100197886-100197908 AAGATGACACAAAGGGAGAAAGG + Intronic
911734098 1:101318381-101318403 ATGAAGACCCAAAGAAACAAGGG - Intergenic
912321633 1:108719363-108719385 CTGAACCCAGAAAGGGACAAGGG - Intronic
913109436 1:115643910-115643932 ATTAAAACACAATGTGACAAGGG - Intronic
914090966 1:144497882-144497904 ATGAATTCTCCAAGGGCCAAAGG + Intergenic
914307634 1:146436327-146436349 ATGAATTCTCCAAGGGCCAAAGG - Intergenic
914594474 1:149136811-149136833 ATGAATTCTCCAAGGGCCAAAGG + Intergenic
915275642 1:154786199-154786221 ATGAATACATAAAGGGTTTAAGG + Intronic
915772310 1:158440274-158440296 AAGAATACACAATGGGGAAAGGG + Intergenic
915921742 1:159980968-159980990 CTGCATACACTAAGGGACCAGGG + Intergenic
916062832 1:161112936-161112958 ATATATACACAAAAAGACAAAGG + Intronic
916313099 1:163418477-163418499 ATGAATACAGTAAGGAAAAATGG - Intergenic
916601736 1:166299709-166299731 ATGAATATTCAAAGGAATAAGGG + Intergenic
916701794 1:167303449-167303471 ATGAACACAAAAAGAGAAAAAGG - Intronic
916711022 1:167408696-167408718 ATGATTACAAACAGGCACAAGGG + Intronic
916790757 1:168122982-168123004 ATGAATAAATATAGGAACAATGG + Intronic
917078768 1:171235311-171235333 CTGAATATACAAAGGGCCACAGG - Intergenic
917636305 1:176940156-176940178 CTGAATATACAAATGGACAATGG + Intronic
917923024 1:179766524-179766546 ATGAAGACCCAAAGATACAAGGG - Intronic
918366169 1:183810141-183810163 ATGAATACTCAAAGGGACAGAGG + Intronic
918520342 1:185407952-185407974 AGGAGTACAAAAATGGACAAGGG - Intergenic
918657235 1:187043308-187043330 CTGAATATATAAATGGACAATGG + Intergenic
918726803 1:187936397-187936419 AAAAATACAGAAAGGCACAAAGG + Intergenic
918867153 1:189916741-189916763 ATGGGTACACAAAGGGGCAGAGG - Intergenic
919605799 1:199681909-199681931 TTAAAAACAAAAAGGGACAAAGG + Intergenic
919761465 1:201100647-201100669 CTGACTAGACAGAGGGACAATGG + Intronic
920186566 1:204162977-204162999 ATGAAGGCTCACAGGGACAAAGG + Intronic
920542429 1:206789379-206789401 ATGGATTCACAAAGGCATAAGGG - Intergenic
921469010 1:215526214-215526236 ATGAATAAACTATTGGACAATGG + Intergenic
921757087 1:218870578-218870600 AAGAATACACAATGGGGAAAGGG - Intergenic
921875178 1:220187619-220187641 ATCAACACCCAAAAGGACAAGGG + Intronic
922369836 1:224898273-224898295 CTGAATAGACAAATGGACAATGG - Intronic
923716940 1:236433231-236433253 ATGCATACAAAAATGTACAAAGG - Intronic
924102290 1:240617296-240617318 ATGGATACACACAGAAACAAAGG - Intergenic
924272033 1:242343919-242343941 CTGAATAAACAAATGGACAATGG + Intronic
924872475 1:248063863-248063885 ATGACTACACAAGGGGGCTAAGG - Intronic
1062921745 10:1285458-1285480 ATGAATGCACAAATGGGCACCGG + Intronic
1063010465 10:2017299-2017321 ATGCATACACACAGTGACAGAGG - Intergenic
1063789559 10:9426142-9426164 ACTAATACACAAAGTGACACAGG + Intergenic
1064049368 10:12046974-12046996 ATAAATGCTCAAAGGGAAAAAGG + Intergenic
1065147635 10:22786822-22786844 ATGAATGAATAAAGGAACAAAGG - Intergenic
1066712636 10:38252211-38252233 CTGAATAAACAAATGGACAATGG - Intergenic
1066785529 10:39000033-39000055 GAGAATATACAAAGGGACATTGG - Intergenic
1067185246 10:44021642-44021664 ATGAATTTAGAAAGGGACAGAGG - Intergenic
1067900920 10:50240693-50240715 ATGAACACAGAGAGGCACAAAGG - Intronic
1069119239 10:64548160-64548182 ATGAAAATACCAAGGGAGAAGGG - Intergenic
1069144727 10:64876600-64876622 CTGAATATACAAATGGGCAATGG + Intergenic
1070502169 10:77082367-77082389 ATGAAGACACATAGGTACTAGGG - Intronic
1070688913 10:78510467-78510489 ATGAAGACACAAAGAGATGAGGG + Intergenic
1071381726 10:85071152-85071174 AAGAATACACAATGGAAAAAAGG + Intergenic
1072279838 10:93855835-93855857 ATGCATAAACAAAGCAACAAAGG + Intergenic
1073185474 10:101612949-101612971 AAGACCACACAAAGGGAGAAGGG + Intronic
1073227880 10:101939206-101939228 ATGAAAAATCAAAGGCACAAAGG + Intronic
1073592467 10:104769992-104770014 ATGAATACCCCTAGTGACAAAGG - Intronic
1074390616 10:113054588-113054610 AAAAATACAGAAAGGTACAAAGG + Intronic
1074658816 10:115627082-115627104 GTGAATACACAAAGTGACACCGG - Intronic
1074717958 10:116237134-116237156 ATGTATACACAAAGAAACTATGG - Intronic
1075000379 10:118792565-118792587 CTGAATATACAAATGGACAGTGG + Intergenic
1076079063 10:127561583-127561605 ATGAATATACAAACGGGCAATGG + Intergenic
1077936899 11:6797687-6797709 TTGTGTACACAAAGGGACTATGG - Intergenic
1077957417 11:7035723-7035745 AGGAGGACACAAAGGGAGAAGGG - Intronic
1078960617 11:16264029-16264051 ATGATTACACACAGAGACAAAGG - Intronic
1079424727 11:20329451-20329473 ATAAAGACCCAAAGGTACAAAGG + Intergenic
1079578758 11:22035619-22035641 ATGAATAAAGGAAGAGACAAAGG - Intergenic
1080722403 11:34862686-34862708 ATGAACACACAATGGGCCAAAGG + Intronic
1080945121 11:36964139-36964161 AAGAAGACACAAAAGGAGAATGG + Intergenic
1080955412 11:37088374-37088396 TTTAATATACAAAGGAACAATGG + Intergenic
1081078180 11:38702516-38702538 TTAAATATACAAATGGACAATGG + Intergenic
1081121859 11:39276548-39276570 ATGAATACACAAAGACAAAGAGG - Intergenic
1081766602 11:45615657-45615679 ATGAAGACACACAGGGGCAGAGG - Intergenic
1082204134 11:49411032-49411054 ATGAAGATACAAAGGGATCATGG + Intergenic
1082645727 11:55721863-55721885 AAGAATACATAATGGGAAAAAGG - Intergenic
1082881594 11:58043387-58043409 ATGAATAGACAAATAGACAAAGG - Intronic
1083177499 11:60960401-60960423 GTGAATACCCAAAGAGACGAGGG + Intergenic
1085801441 11:79593677-79593699 AGGAGTACAGAAAGTGACAATGG - Intergenic
1086515133 11:87603071-87603093 CTGAATATACAAATAGACAATGG - Intergenic
1087317445 11:96619573-96619595 ATTAATACAGAAAGAGACCAGGG - Intergenic
1088132733 11:106513755-106513777 ATGAACACACAATGGGGAAAAGG + Intergenic
1088779996 11:113124730-113124752 ATGAACACACACAGGAAAAATGG - Intronic
1089082829 11:115791565-115791587 AAGAATACAAAAAGGAATAAAGG + Intergenic
1089955885 11:122570547-122570569 AAGAACATACAAAGGCACAAAGG - Intergenic
1090730618 11:129570500-129570522 ATGAAGATGCAAAGGTACAAGGG - Intergenic
1090883345 11:130854029-130854051 ATGAATAAACAAAGGAGCAAAGG - Intergenic
1091178560 11:133582653-133582675 ATGTAAACAAAAAAGGACAAGGG + Intergenic
1091452338 12:580933-580955 ATGAATACACACAGACACACAGG - Intronic
1092611003 12:10173324-10173346 AAGAATACACAAAGGAAGAATGG + Intronic
1092611982 12:10182131-10182153 ATGACTATACAAAGGAAGAAGGG - Intronic
1093210111 12:16297833-16297855 ATGAAGACCCAAAGATACAAAGG - Intergenic
1093512823 12:19949174-19949196 CTGAATATACAAATGGACAATGG + Intergenic
1093750002 12:22787498-22787520 ATGAGAAAACCAAGGGACAAAGG - Intergenic
1095121727 12:38426833-38426855 ACGAATATACAAAAGGACAATGG - Intergenic
1095328588 12:40929038-40929060 ACAAATACACAAGGAGACAATGG - Intronic
1095535273 12:43238557-43238579 CTGAATACACAAACAGATAATGG - Intergenic
1095724389 12:45435891-45435913 CTGAATATACAAATGGACAATGG + Intronic
1097715626 12:62962890-62962912 ATAAAAAGACAAAAGGACAAAGG + Intergenic
1098024952 12:66191474-66191496 ATGAATACACAAAGGGACAATGG - Intronic
1098755558 12:74358610-74358632 AAAAATACACAAAGATACAAAGG + Intergenic
1099126144 12:78760771-78760793 ATAAATACACAAGGGTAAAAAGG - Intergenic
1099135672 12:78896804-78896826 ATGAATACAAAAAGAGAAAAAGG + Intronic
1100267803 12:92994736-92994758 ATATATATACAAAGGGATAAAGG - Intergenic
1101887204 12:108675746-108675768 CAGAATACACAAATGGAAAAAGG + Intronic
1102592782 12:113969626-113969648 ATGAATACAGGAAGGGTTAAGGG + Intergenic
1103633481 12:122282722-122282744 AGCAAGACACAGAGGGACAAAGG + Intronic
1104072200 12:125355585-125355607 CTGAATATACAAATGGACAACGG - Intronic
1104177238 12:126344714-126344736 ATGAATAAATAAAGGAAGAAAGG + Intergenic
1104356623 12:128092456-128092478 CTGAATATAAAAATGGACAATGG + Intergenic
1104604184 12:130175935-130175957 ATGGATACCCAAAGAGAAAAGGG - Intergenic
1106359943 13:29021800-29021822 TTGAATAAACAAAGACACAAGGG + Intronic
1106365697 13:29077912-29077934 ATCAATACAAAAAGGGAAAATGG + Intronic
1106621913 13:31378414-31378436 AAAAATGCACAAAGGTACAAAGG + Intergenic
1106871715 13:34029087-34029109 CTGAATATACAGATGGACAATGG + Intergenic
1106939082 13:34756603-34756625 ATAAATACACAAAGCAAAAATGG + Intergenic
1107309957 13:39066122-39066144 ATGAATACACAGTGGGGAAAAGG - Intergenic
1107778636 13:43875481-43875503 CTGAATATGCAAATGGACAATGG + Intronic
1108011398 13:46016598-46016620 AAGAAAACACAAGGGGACTATGG + Intronic
1108463904 13:50695273-50695295 GAAAATACACAAATGGACAATGG + Intronic
1108597967 13:51965894-51965916 ATAAATACAAAAAGAGCCAAGGG + Intronic
1109053932 13:57521640-57521662 ATTAAAACACAAAAAGACAATGG + Intergenic
1109438036 13:62332174-62332196 CTGGATACACAAAGGGACAGTGG - Intergenic
1109514290 13:63421410-63421432 ATGACTAAAAAAAGAGACAAGGG + Intergenic
1109638531 13:65154869-65154891 GTCAATTCACAAAGAGACAAAGG - Intergenic
1109684462 13:65797717-65797739 CTGATTATACAAATGGACAATGG + Intergenic
1110380019 13:74839627-74839649 ATGATTACACAAAGAGCCAGTGG + Intergenic
1111033068 13:82632776-82632798 ATGAATAAGAAAAGGGAAAAAGG - Intergenic
1111043083 13:82777007-82777029 ATGATTACACAGAAGGAAAATGG - Intergenic
1112705381 13:102061954-102061976 ATGAATACCCAAAGCAAGAAAGG + Intronic
1112947926 13:104955197-104955219 ATGAGGACATAAAGTGACAATGG + Intergenic
1112989460 13:105494586-105494608 CATAATACACAAAGGGACACAGG - Intergenic
1114272494 14:21110395-21110417 ATGAAGACACGCAGGGATAATGG + Intergenic
1114644091 14:24244083-24244105 AGGAATAAATAAAGGGAAAAAGG - Intergenic
1115155191 14:30331079-30331101 CTGAATATACAAATGGACAGTGG + Intergenic
1115379490 14:32719180-32719202 GTGAATACATAAAGGTATAATGG + Intronic
1115417226 14:33149978-33150000 ATGAAAACACACATGGACACAGG - Intronic
1116369397 14:44110163-44110185 ATGAATCCACAAAGCCACAGGGG + Intergenic
1117243940 14:53864658-53864680 TTGAAGACTCAAAGGGAGAAGGG - Intergenic
1117515700 14:56499200-56499222 ATGAAGACCCAAAGAAACAAGGG + Intronic
1117654916 14:57945231-57945253 ATGCATCCACAAACAGACAATGG + Intronic
1117994261 14:61463943-61463965 ATGAATGGACAAAGAAACAACGG - Intronic
1118395258 14:65330754-65330776 ATGAAAATTCAAAGGGAGAATGG + Intergenic
1118622891 14:67630436-67630458 ATGAACAAAGAAAGGGGCAAAGG + Intronic
1118680822 14:68239790-68239812 ATGTATACTTAAAGGGACAATGG - Intronic
1124157857 15:27243698-27243720 ATGAATATGCAAATAGACAATGG - Intronic
1126553235 15:49955630-49955652 ATGAATAGACAAACAGATAAGGG + Intronic
1127620589 15:60729999-60730021 ATAAATGTAAAAAGGGACAAGGG - Intronic
1127653066 15:61028249-61028271 ATAAATACACAAACGGGTAAAGG + Intronic
1127839277 15:62816720-62816742 ATGAATAAGCAAAGGGTTAAAGG - Intronic
1128869777 15:71145619-71145641 CTGAATACAGAAAGGAAGAAAGG + Intronic
1129864747 15:78897767-78897789 AGGAATACACAAATATACAATGG - Exonic
1130378005 15:83347450-83347472 ATGGACACAGGAAGGGACAATGG - Intergenic
1130402872 15:83573752-83573774 ATGAATAAATAAATGAACAAAGG - Intronic
1130563732 15:84978276-84978298 ATGAATACATAATGGAAAAATGG - Intergenic
1131293664 15:91128930-91128952 ATGAAGACCCAAAGACACAAGGG - Intronic
1131970770 15:97890556-97890578 CTGAATATACAAACAGACAATGG - Intergenic
1133062758 16:3185474-3185496 AGGCATACACAAAGGGAAGATGG + Intergenic
1133512586 16:6474106-6474128 CTGCATACACAAATGGACACTGG - Intronic
1134370215 16:13616602-13616624 ATGTTTACACAAAGAGAGAAAGG + Intergenic
1134811767 16:17173575-17173597 CTCAATGCACACAGGGACAAAGG + Intronic
1134896006 16:17887260-17887282 ATGAAGACCCAAAGAGTCAAGGG - Intergenic
1135003438 16:18797627-18797649 ATGAATACAGAAAAGGAAACTGG - Intronic
1135289824 16:21225752-21225774 ATGAAGACACAAGGAGAAAATGG + Intergenic
1135525767 16:23212664-23212686 AACAATACACTGAGGGACAAGGG - Exonic
1136009505 16:27354083-27354105 ATGACTACACATAGCCACAAAGG + Intronic
1136607465 16:31346087-31346109 CTGAATATACAAAGGGATAGTGG + Intergenic
1137061790 16:35797406-35797428 ATGAGTACACAAAGGCACACGGG - Intergenic
1137253382 16:46756551-46756573 ATAAATACACAAATCAACAAAGG - Intronic
1138171496 16:54854115-54854137 ATGAAAACAGCAAGAGACAATGG - Intergenic
1138537938 16:57669679-57669701 ATGAATGCGCAAATGGAGAATGG - Intronic
1140051886 16:71488828-71488850 ATAAAAACACTATGGGACAATGG + Intronic
1140277584 16:73524443-73524465 ATGAAAACAGAAAGGCAGAAGGG + Intergenic
1140549886 16:75854497-75854519 ATGAATACACAAAACGTCTAAGG + Intergenic
1140587491 16:76310129-76310151 CTGAATACACAAATGGCAAATGG - Intronic
1140637934 16:76938596-76938618 AGGAACACACAAATGGACAATGG + Intergenic
1141346031 16:83246932-83246954 ATGGATACGCAAAGGCACCAAGG - Intronic
1143127048 17:4648982-4649004 CTGACTATACAAAAGGACAATGG - Intergenic
1144655522 17:17032904-17032926 GTGCATACACACAGGGACACAGG - Intergenic
1146817806 17:35957729-35957751 AAGAATACACAAATGGATTAAGG - Intergenic
1147032544 17:37651510-37651532 TGGAAGAGACAAAGGGACAAGGG + Intergenic
1150949147 17:69782829-69782851 ATGAAAACAAAAATAGACAATGG + Intergenic
1152113896 17:78372993-78373015 AGGAATGCACACAGGGCCAAAGG - Intergenic
1152435040 17:80271350-80271372 CTGAGTACTCAAAGGGAAAAAGG + Intronic
1152473806 17:80504454-80504476 ATGGATGCACAGAGGGAAAAAGG + Intergenic
1153611130 18:6886304-6886326 AAGAAAATACAGAGGGACAAAGG + Intronic
1153815332 18:8785812-8785834 AAGAAAACAAAAATGGACAAGGG - Intronic
1154053379 18:10985443-10985465 AAGAATACACAATGGGGAAAGGG - Intronic
1155196103 18:23476292-23476314 ATTAAAACACAGAGGGATAATGG - Intronic
1155582119 18:27321230-27321252 ATGAATACAGTAATGGACAATGG - Intergenic
1155582123 18:27321279-27321301 TTAAATACAGAAATGGACAATGG - Intergenic
1155615217 18:27714348-27714370 CTGAATATACAAATGAACAATGG + Intergenic
1155864344 18:30945797-30945819 CTGAATCCACAAAGGGATAGTGG + Intergenic
1156701804 18:39834955-39834977 ATGAAGACACAAAGACACAATGG - Intergenic
1157139117 18:45088106-45088128 CTGAATATACAAATGGACAATGG + Intergenic
1157476834 18:48029146-48029168 TTAAAAACACAAAGGGAAAATGG - Exonic
1158161408 18:54488648-54488670 TTGAATATACAGATGGACAATGG - Intergenic
1158487272 18:57878687-57878709 ATGAAGACACAGAGGAACAATGG + Intergenic
1158543631 18:58378169-58378191 ATGATTACCCAAAGGGAACAAGG + Intronic
1158552689 18:58449912-58449934 ACGAATCCACAAAGTGAAAAAGG + Intergenic
1158789128 18:60754447-60754469 CTGAATATACAAATGGACAAGGG + Intergenic
1158824830 18:61205980-61206002 ATCAAGACACAATGGAACAATGG - Intergenic
1159017361 18:63112209-63112231 CTGAATATACAAATGGGCAATGG + Intergenic
1159637737 18:70825914-70825936 CTGAATACGCAAATGGATAATGG - Intergenic
1159638185 18:70831426-70831448 CTGAATACACAAATGGACAATGG + Intergenic
1159753254 18:72328986-72329008 ATGAATTCATAAAAGGAAAATGG + Intergenic
1160394333 18:78560405-78560427 AGGAATACACCAATGAACAAAGG - Intergenic
1160465832 18:79075052-79075074 AAGAATAAACAAAGTCACAAGGG - Intronic
1160611965 18:80095867-80095889 GTGAATATACAAATGAACAATGG + Exonic
1161174998 19:2836542-2836564 ATCCATTCACAAAAGGACAAAGG + Intergenic
1161524859 19:4747917-4747939 ATGAAAACACAGAGAGACAGAGG - Intergenic
1166497871 19:43317228-43317250 ATGAATGCACACACGAACAAAGG + Intergenic
1168464861 19:56594503-56594525 AGGAAAACAGAAAAGGACAAGGG - Intergenic
925175959 2:1784071-1784093 ATGAAAATACAAGCGGACAATGG + Intergenic
925451571 2:3973651-3973673 CTGGATATACAAAGAGACAATGG - Intergenic
925512079 2:4638829-4638851 AAGAACACACAAAGGAACCAGGG - Intergenic
925604988 2:5650457-5650479 ATGAATTCTCCAAGGGCCAAAGG - Intergenic
926221127 2:10936162-10936184 GTGAATGCACAAAGAAACAAGGG + Intergenic
926428009 2:12757347-12757369 ATAAATACACAAAGGAAGGAAGG - Intergenic
926429023 2:12767163-12767185 GTTATTACACAGAGGGACAAGGG - Intergenic
927209761 2:20631861-20631883 CTGAATACACAAAGGGACAATGG + Intronic
928109838 2:28497698-28497720 GAGAATATACAAATGGACAACGG - Intronic
929011747 2:37451854-37451876 CTGAATATACAAAGGGACAATGG - Intergenic
930927414 2:56835432-56835454 ATATCTACATAAAGGGACAATGG + Intergenic
931495339 2:62800136-62800158 ATCACTACAAAAAAGGACAAGGG - Intronic
932092075 2:68815171-68815193 ATGTCTACACACAGGGACCAAGG + Intronic
932865351 2:75335675-75335697 CTGAATATACAAATGGACAATGG - Intergenic
932971587 2:76549776-76549798 CTGAATATACAAACGAACAATGG - Intergenic
933178002 2:79197546-79197568 TTGAATATACAAATGGACAATGG - Intronic
933855965 2:86414853-86414875 AAGACAACACAAAGGTACAAAGG + Intergenic
933995513 2:87665763-87665785 ATGAATAGACATATTGACAATGG - Intergenic
935199683 2:100845417-100845439 CTGAATGTACAAATGGACAATGG - Intronic
935782981 2:106524270-106524292 ATGAATATACAAAGGGACAATGG - Intergenic
936298342 2:111285152-111285174 ATGAATAGACATATTGACAATGG + Intergenic
936547876 2:113408083-113408105 ATGAATAAAAAAAAGGAAAAGGG - Intergenic
936626971 2:114158800-114158822 AGATATACACACAGGGACAAAGG - Intergenic
937139228 2:119584633-119584655 ATGAATAGAGAAATGGGCAAAGG + Intronic
937590852 2:123611507-123611529 ATGAAAACACAAAGATACAGAGG - Intergenic
937804777 2:126126570-126126592 CTGAATACACACAGGAAAAAAGG - Intergenic
937813198 2:126221587-126221609 CTGAATATACAGATGGACAATGG + Intergenic
938058926 2:128237295-128237317 ATGAATATACAAACAGACAATGG + Intronic
938785914 2:134629558-134629580 ATTAAAACAGAAAGGTACAAGGG - Intronic
938977843 2:136496166-136496188 CTGAATATACAAATGGACAGTGG - Intergenic
939012193 2:136859882-136859904 ACTGATACACAAAGGGAAAAGGG - Intronic
939410116 2:141814163-141814185 AAGAGTACAAAACGGGACAAAGG + Intronic
940065476 2:149622874-149622896 ATGATGACAGAAAGGGAGAAAGG - Intergenic
940334848 2:152515247-152515269 ATGAATACACAAATATAAAACGG - Intronic
940587759 2:155675773-155675795 ATGAATACACATAAACACAAAGG + Intergenic
941273203 2:163456721-163456743 ATAAATTCACAAAGGGAACAGGG + Intergenic
941755741 2:169183925-169183947 CTGAAAACACAAAGGCAGAATGG - Intronic
941949813 2:171143111-171143133 ATGAATGCACGAATGGACAAAGG + Intronic
941981612 2:171464451-171464473 TTGAAGACACAGAGGGAGAAAGG - Intronic
942185601 2:173422041-173422063 ATGAAGAAACCAAGGCACAAAGG - Intergenic
942539704 2:177002874-177002896 ATGAATACATAAGGAGACGATGG + Intergenic
942600470 2:177635600-177635622 ATGGATACAAAACGGTACAAAGG + Intronic
942909244 2:181221971-181221993 AAGAATACACAATGGGGAAATGG - Intergenic
943663071 2:190579580-190579602 ATCAATACACAAAATGACCAAGG + Intergenic
944709628 2:202324097-202324119 ATGAAAAGACAGAGGGGCAAAGG + Intergenic
945246357 2:207720759-207720781 AGAAATACACAAAGGGAGAAAGG + Intronic
945451603 2:210001479-210001501 ATGAAGACCCAAAGGTACAGGGG + Intergenic
945567281 2:211416451-211416473 CTGAATATACAAAGGGACAATGG + Intronic
947577385 2:231286838-231286860 AAGAATACCTAAAGGGAAAAAGG + Intronic
948327634 2:237138924-237138946 ATGAATACATAAAAGACCAAGGG + Intergenic
1169548945 20:6681486-6681508 ATGAATAAGCAAAGAGAGAAAGG - Intergenic
1169725417 20:8724029-8724051 ATGGACACATAAAGGGACATGGG + Intronic
1170758255 20:19224178-19224200 ATGAATACACAAACCTACACAGG - Intronic
1170819410 20:19743658-19743680 CTGAATATATAAAGGGACAATGG + Intergenic
1171723354 20:28589616-28589638 CTGAATAGAAAAATGGACAAGGG - Intergenic
1171754702 20:29093468-29093490 CTGAATAGAAAAATGGACAAGGG + Intergenic
1171859988 20:30390330-30390352 CTGAATAGAAAAATGGACAAGGG + Intronic
1172473111 20:35215594-35215616 ATGAATGAACAAAGGCACCAAGG + Intergenic
1173791382 20:45829905-45829927 TTGAATAAACAAAAGAACAAAGG - Intronic
1173794606 20:45850534-45850556 CTGAATATACAAACAGACAATGG - Intronic
1173991540 20:47307472-47307494 ATAAATAAATAAAGGGACACCGG + Intronic
1174211942 20:48886608-48886630 ATCAGTTCCCAAAGGGACAAAGG + Intergenic
1174612296 20:51808124-51808146 ATGAATAAACAGAGGTCCAAAGG - Intergenic
1174673355 20:52329677-52329699 ATGAACAAACAAAGGAAAAAAGG - Intergenic
1175291789 20:57880894-57880916 ATGAATAAACAAATGGCCAGGGG - Intergenic
1175452552 20:59082103-59082125 AAGAATACATAAACGGACAAAGG + Intergenic
1175504788 20:59473953-59473975 CTGAATATACAAATGGACCATGG - Intergenic
1176429285 21:6566347-6566369 AGGAATACAAAGAGAGACAAAGG - Intergenic
1176524285 21:7853688-7853710 CTAAATATACAAATGGACAATGG - Intergenic
1177650889 21:23961010-23961032 CTGAATATACAAAGGGACAATGG - Intergenic
1177798978 21:25808574-25808596 ATGAATACACAAAGGGGATGAGG - Intergenic
1177849477 21:26329537-26329559 ATGAGGACACACAGGGAAAAGGG - Intergenic
1178135948 21:29627506-29627528 ATGGAGAGAAAAAGGGACAATGG - Intronic
1178368927 21:32010979-32011001 CTGAATACATAAATGGACGACGG - Intronic
1178658305 21:34483701-34483723 CTAAATATACAAATGGACAATGG - Intergenic
1178839497 21:36127489-36127511 TGGTAAACACAAAGGGACAATGG + Intergenic
1179010414 21:37552028-37552050 CTGAACATACAAATGGACAATGG + Intergenic
1179033763 21:37742383-37742405 TTGAATACAGAAATGGACAGTGG - Intronic
1179423724 21:41255999-41256021 AAGAATAAAAAAAGGGAAAAGGG - Intronic
1179650809 21:42807359-42807381 CTGAATATACAAATGAACAATGG - Intergenic
1179704677 21:43173809-43173831 AGGAATACAAAGAGAGACAAAGG - Intergenic
1180296907 22:10948273-10948295 CTGAATAGAAAAATGGACAAGGG - Intergenic
1181548741 22:23622428-23622450 AAGCATACACTAAGGGTCAATGG + Intronic
1181729801 22:24836754-24836776 CTGAATTCAAAAATGGACAAAGG - Intronic
1181737496 22:24893241-24893263 CTGAAGACACAAAGGGAGCAAGG - Intronic
1182559872 22:31151293-31151315 ATGAACACTTAAAGGGACAAAGG - Intergenic
1182594192 22:31405521-31405543 ATGAATAAACTGAGGGAAAAAGG - Intronic
1184492268 22:44816444-44816466 ATTAAGAGACAAAGGGACACAGG - Intronic
1184623959 22:45707708-45707730 AGGAATTCAGAAAGGAACAAAGG + Intronic
949740439 3:7227209-7227231 ATGAAAACACAAATGGTCAATGG - Intronic
951588044 3:24235266-24235288 AAGGAAACACAAGGGGACAAAGG - Intronic
951811358 3:26703752-26703774 CTGAATATACAAACGGACAGTGG - Intronic
951895790 3:27608612-27608634 ATGAAGACCCAAAGGTACAGGGG + Intergenic
952644765 3:35641473-35641495 ATACATACACAAAGGATCAAAGG - Intronic
952685181 3:36139408-36139430 TTGAATATAGAAAGGGAAAATGG + Intergenic
953097340 3:39791531-39791553 ATGAATAGACAAAGAGAAGAAGG - Intergenic
953097503 3:39792979-39793001 CTGAATTTACAAATGGACAATGG - Intergenic
953439213 3:42903859-42903881 TTGAATATACAAATGGGCAATGG + Intronic
953488271 3:43323936-43323958 ATGACTACACAGAGGCACAAAGG + Intronic
953514419 3:43576020-43576042 ATGAATAAATAAAGAGTCAATGG + Intronic
954272898 3:49523452-49523474 ATGAAAACACTAAGGGGCATGGG - Intronic
954355348 3:50080291-50080313 GGGAACACACACAGGGACAAGGG - Intronic
954961156 3:54566188-54566210 ATGAGAACATAAAGGGACTATGG - Intronic
955895011 3:63689558-63689580 CTGAATATACAAATGAACAATGG - Intergenic
956237061 3:67084078-67084100 CTGAAAATACAAATGGACAATGG - Intergenic
956536341 3:70281021-70281043 ATGAAGACCCAAAGATACAAAGG - Intergenic
957127583 3:76181901-76181923 ACAAATACACAAGGGGAAAATGG - Intronic
957129035 3:76199564-76199586 ATGAATGTACAAATGGATAATGG + Intronic
957484927 3:80848086-80848108 ATGAAGACAGAAAGAGAGAAAGG - Intergenic
957701409 3:83719732-83719754 ATCAATACAGAAAGGTAAAAAGG + Intergenic
957855703 3:85874409-85874431 ATGCATACACAAAGGTAGATTGG - Intronic
958001241 3:87751694-87751716 ATGGATAGAAAAATGGACAATGG + Intergenic
959538977 3:107519209-107519231 GTGAAAACAAAAAGGGAAAAGGG + Intergenic
959852866 3:111110977-111110999 ATGAATACAGAAATGCAGAAGGG - Intronic
960022663 3:112972790-112972812 GTAAATTCACAAAGGAACAAGGG - Intronic
960460026 3:117922256-117922278 CTGAATACTCAAAGGGAGGAGGG - Intergenic
960553276 3:119000705-119000727 TTGAAGACTCAAAGGGAGAAGGG + Intronic
960622399 3:119649336-119649358 ATGAATAAACAAATGGAGAATGG - Intronic
961061949 3:123836083-123836105 ATGAAGACCCAAAGATACAAAGG - Intronic
961426924 3:126855727-126855749 ATGCCTACAGAAATGGACAAAGG - Intronic
962842035 3:139242698-139242720 AAGGACACACAAATGGACAATGG - Intronic
962993676 3:140603852-140603874 ATGAATACACAGAAGTAGAATGG + Intergenic
963065708 3:141262064-141262086 ATGAGTACACAGAGGAACATGGG + Intronic
963198193 3:142557629-142557651 ATGAAATCATAGAGGGACAAAGG + Intronic
963412258 3:144945043-144945065 ATGAAAAAAAAAAGGGAAAAAGG - Intergenic
963470946 3:145740885-145740907 AGGCACACACAAAAGGACAAGGG + Intergenic
965144138 3:164876981-164877003 ATGAAGACCCAAAGATACAAGGG - Intergenic
965370173 3:167852334-167852356 CTGAGTACACAAAGGGAAATAGG + Intergenic
965482491 3:169236432-169236454 ATGAATACATAAATGAATAAGGG + Intronic
965540867 3:169870291-169870313 ATGAATATGCAAAGAGAAAAAGG - Intergenic
966117966 3:176487491-176487513 AAAAATACAAATAGGGACAAAGG + Intergenic
967657543 3:192069734-192069756 ATAAATACAAAAGGGGAAAAAGG + Intergenic
967704040 3:192629681-192629703 ATGAATACAAAAAAGTACAAAGG + Intronic
967714974 3:192752426-192752448 ATGAAGACATAAAGGGCCATAGG - Intronic
967786322 3:193500894-193500916 ATGAACACACAATGAGACGATGG - Intronic
967802500 3:193678778-193678800 ATGAATACACAAGCACACAAAGG - Intronic
969133259 4:5008249-5008271 AGGAATACACAAATACACAAAGG + Intergenic
969837104 4:9850884-9850906 ATGAATGCACAAATGGACACTGG + Intronic
969921407 4:10543751-10543773 ATGAAAACAGAAAGGAAGAATGG - Intronic
969995673 4:11309982-11310004 ATGAAGACAGAAAGAGACCAAGG - Intergenic
970595025 4:17592219-17592241 ATGACTACAAAAAGGCAGAAGGG - Intronic
971042954 4:22775566-22775588 ATGAATCCAGAAAAAGACAACGG - Intergenic
971084359 4:23254095-23254117 AAAAATGCACAAAGGGACATAGG - Intergenic
971272455 4:25163343-25163365 CTGACTATACAAATGGACAATGG + Intronic
971299485 4:25430001-25430023 CTGAGTATACAAATGGACAATGG - Intergenic
971583387 4:28372747-28372769 ATGGGTACACAAAGGCATAAAGG + Intronic
972694125 4:41427978-41428000 CTGAATACACAGAGGTAAAAAGG - Intronic
972904808 4:43731901-43731923 ATGGATACACAAAAGTAAAAAGG + Intergenic
973068180 4:45823206-45823228 ATGAGTACACAAAGGCATACAGG + Intergenic
973117703 4:46481847-46481869 ATGAATGCACTTAGGGACACAGG - Intergenic
973308628 4:48682052-48682074 ATGAAAACACAAAGGTAACAGGG + Intronic
973587917 4:52410837-52410859 GTGAATATATAAATGGACAATGG - Intergenic
974007944 4:56578201-56578223 ATGAATAAATAAAAGTACAAAGG + Intronic
974111158 4:57527347-57527369 AAGAATACACAATGGGAAAGGGG + Intergenic
974631103 4:64490117-64490139 ATGAATATGAAGAGGGACAATGG - Intergenic
974784065 4:66594676-66594698 ATGGAGACAAAAAGAGACAAAGG + Intergenic
975182631 4:71364395-71364417 ATGAATGCACCAAAGCACAATGG - Intronic
975333710 4:73150785-73150807 ATAAATAAACAAAGATACAAAGG + Intronic
975755548 4:77568103-77568125 CTGGTAACACAAAGGGACAATGG + Intronic
976087120 4:81418031-81418053 ATGAAGACCCAAAGGTACAGGGG - Intergenic
976378572 4:84373853-84373875 ATGAATACACAAGGCCCCAAGGG + Intergenic
976660460 4:87535263-87535285 AGGAATACATAAGTGGACAAGGG + Intergenic
977216554 4:94291903-94291925 TTGCATACACAATGGGATAATGG + Intergenic
981889557 4:149718779-149718801 AGGAAAACACAAAGAGACCATGG - Intergenic
982247911 4:153372775-153372797 ATGAATACATAAAGCAACATGGG - Intronic
982916206 4:161212685-161212707 ATAAATACATAAAAGGAAAAAGG - Intergenic
982998626 4:162383197-162383219 ATGAATACACAAAGGTAGGGAGG + Intergenic
984449405 4:179879964-179879986 ATGAATATAAAAAGTGACATTGG - Intergenic
986076551 5:4343885-4343907 ATGAACACACAGAGGGAAGAAGG + Intergenic
986461354 5:7975691-7975713 TTGAATACACCAAGGGACAATGG + Intergenic
986779418 5:11050575-11050597 CTGAATATGCAAATGGACAATGG + Intronic
987561552 5:19530123-19530145 ATAAATACACAAATGCTCAAGGG + Intronic
987691667 5:21274847-21274869 CTGAATACACTAACAGACAATGG - Intergenic
988303213 5:29461213-29461235 ATGCATATACAAAGGGAGAGGGG - Intergenic
988352519 5:30129881-30129903 AAGAAAACACAATGGGAAAAAGG - Intergenic
988684076 5:33511330-33511352 ATGAATACACAAATAGACAATGG + Intergenic
989378227 5:40787764-40787786 AGTAATAGAGAAAGGGACAAAGG + Intronic
989459626 5:41682578-41682600 ATGAATAAACAAATGATCAATGG + Intergenic
990311714 5:54546342-54546364 ATGAAGACATAAATGGAAAATGG - Intronic
990335696 5:54770114-54770136 ATAAATACACAAATAGACATGGG + Intergenic
990542992 5:56793269-56793291 ATGAATACATAGAGAAACAAGGG - Intergenic
991491767 5:67190767-67190789 ATGAATACCTAGAGGGAAAAGGG - Intronic
991502460 5:67290419-67290441 CTGAATAGAGAAAGGGAAAAGGG + Intergenic
991628545 5:68630501-68630523 ATGAATAAACAAAGGAAAAATGG + Intergenic
991748710 5:69775290-69775312 CTGAATACACTAACAGACAATGG + Intergenic
991800288 5:70355102-70355124 CTGAATACACTAACAGACAATGG + Intergenic
991828312 5:70654939-70654961 CTGAATACACTAACAGACAATGG - Intergenic
991892646 5:71354542-71354564 CTGAATACACTAACAGACAATGG + Intergenic
992106989 5:73457586-73457608 ATCAGTAAACAAATGGACAAAGG + Intergenic
993029384 5:82687530-82687552 ATGAAGACAAAAAAGAACAAAGG + Intergenic
994114391 5:96045906-96045928 ATGGAGACAGAAAGTGACAAGGG + Intergenic
994750300 5:103728937-103728959 ATGAATACCAAAAGGGAGCAAGG - Intergenic
995008417 5:107229622-107229644 ATGAAGACCCAAAGATACAAGGG - Intergenic
995180327 5:109224741-109224763 AGGAACACACAAAGGGAGAGAGG - Intergenic
996307702 5:122068816-122068838 ATGAATAAATAAATGGAGAATGG + Intronic
996561327 5:124832694-124832716 ATGACTAAACAAAGGAAAAAGGG + Intergenic
996647199 5:125830256-125830278 ATGAAAATAGAAAGGGACAAGGG - Intergenic
996670892 5:126115572-126115594 CTGAATATACAAATGGACAGTGG - Intergenic
998063370 5:139136683-139136705 ATGAAGACATAGAGGCACAAGGG + Intronic
999854450 5:155578973-155578995 ATGAATAAACAAATGGTGAATGG + Intergenic
999879103 5:155841237-155841259 ATGAAGACCCAAAGGTACAGGGG + Intergenic
1000479795 5:161758020-161758042 TTAAATACACCAAAGGACAATGG - Intergenic
1002360887 5:178669907-178669929 CGGAATAGACTAAGGGACAAAGG + Intergenic
1003232420 6:4266605-4266627 AGGAAAACAGAAAAGGACAAGGG + Intergenic
1003478466 6:6507669-6507691 GTGAAAACACAAAAGGAAAAAGG - Intergenic
1004332419 6:14734069-14734091 CTGAATATACAAATGGACAACGG + Intergenic
1004831161 6:19477864-19477886 ATGAATACCCAAAGGTACAGAGG - Intergenic
1005127613 6:22466283-22466305 AAGGATAAACAAAGGAACAAGGG - Intergenic
1005583878 6:27257743-27257765 TTGAATATACAAATGGATAATGG - Intergenic
1006743521 6:36325592-36325614 ATGGAAGCACAAAGGGATAAGGG - Intronic
1007103921 6:39270313-39270335 ATGAAGACCCAAAGATACAAAGG - Intergenic
1008193692 6:48492002-48492024 CTGAAAACACAAAGAAACAAGGG - Intergenic
1008419276 6:51278305-51278327 ATGAATAAACAAAAGCATAAAGG - Intergenic
1008613053 6:53201870-53201892 ATGAAGGCACAAAGATACAAGGG - Intergenic
1008876481 6:56335238-56335260 CTAAATATACAAATGGACAATGG + Intronic
1010155028 6:72782644-72782666 TAGGAGACACAAAGGGACAAGGG - Intronic
1010522571 6:76857600-76857622 ATGAATACTCAAAGGGTGAGAGG - Intergenic
1010632282 6:78212444-78212466 AAGAATACACAATGGTAAAAGGG - Intergenic
1010664461 6:78612185-78612207 ATGTGTAAACAATGGGACAATGG + Intergenic
1010931849 6:81813249-81813271 GAGCATACACAAAGGCACAAAGG + Intergenic
1011447870 6:87462209-87462231 CTGAATATACAAATGGACAAAGG - Intronic
1012176561 6:96093842-96093864 ATGAATAAATTAAGGGACAGAGG + Intronic
1012363366 6:98409943-98409965 ATGAAGACACAATGGGAAGATGG - Intergenic
1012453479 6:99378905-99378927 ATGAATACATAAATGGACAGAGG + Intronic
1012648179 6:101716217-101716239 ATTAATAGTCAAAGGGAAAAGGG + Intronic
1012846067 6:104390735-104390757 AAAAATACACAATGGGAAAAAGG + Intergenic
1013245252 6:108280513-108280535 AAGAATAAACAAGGAGACAAGGG - Intergenic
1013462636 6:110389963-110389985 CTGAATGTACAAATGGACAATGG - Intergenic
1013483785 6:110575888-110575910 ATGAAGACTCAAAGATACAAGGG + Intergenic
1013491651 6:110652747-110652769 ATGAAGACACAGAGAGAGAAAGG + Intronic
1013905899 6:115219136-115219158 ATGAATAGATAAAGGGAATATGG + Intergenic
1013936415 6:115600848-115600870 ATGAAAACAGAAAGAAACAAAGG + Intergenic
1014297345 6:119636201-119636223 ATGCATACTCAAAGGGACACTGG - Intergenic
1014625066 6:123714878-123714900 ATGAAGACACAAAGACACAGGGG - Intergenic
1014767264 6:125421307-125421329 CTGAATATATAAATGGACAATGG - Intergenic
1014932925 6:127355250-127355272 AAGAAGACACAATGGGAAAAGGG + Intergenic
1015201662 6:130588986-130589008 ATAAATTCACAAAAGAACAAAGG + Intergenic
1016573153 6:145537288-145537310 TTGAATATACAAATTGACAATGG - Intronic
1016964986 6:149710499-149710521 CTGAATATACAGATGGACAATGG - Intronic
1017991481 6:159492988-159493010 ATGAATAAAGGAAAGGACAAGGG + Intergenic
1018082741 6:160272347-160272369 CTGAATATACACATGGACAATGG - Intronic
1019840921 7:3442756-3442778 AAGAACACACAAAAGGAAAAAGG - Intronic
1020258746 7:6518292-6518314 AAGAAAACAAAAATGGACAAAGG + Intronic
1020506821 7:9000955-9000977 AAAAATACACAAATGGAGAAAGG + Intergenic
1020830721 7:13091508-13091530 CTGAAGACACAAATAGACAATGG - Intergenic
1021045996 7:15924134-15924156 AAGAATACACAATGAGAAAAGGG + Intergenic
1021463023 7:20910474-20910496 ATGAATAGAATAATGGACAAAGG + Intergenic
1022112700 7:27241130-27241152 AAGAATACAGAAAGAGAAAAAGG + Intergenic
1023617494 7:42034791-42034813 ATGAATGAACAAAGGAGCAAAGG - Intronic
1023765457 7:43506611-43506633 ACAAATACACAAAGTGACAGTGG - Intronic
1023971584 7:44995207-44995229 CTGAATATACAAATAGACAATGG + Intergenic
1024347904 7:48331792-48331814 ATGAATACACAAACCTACACAGG - Intronic
1024820301 7:53321764-53321786 ATGAAGGCACAAAGGCACAGGGG + Intergenic
1024961484 7:54981381-54981403 CTGAGTACACAAATGGACAATGG + Intergenic
1024995305 7:55269656-55269678 CTGAGTACACAAATGGACAATGG + Intergenic
1025021093 7:55480782-55480804 TTGAACACACAAATGGACATAGG - Intronic
1025962897 7:66239352-66239374 GGAAATACGCAAAGGGACAATGG - Intronic
1026149208 7:67773755-67773777 AGAAAGAGACAAAGGGACAAAGG - Intergenic
1027550223 7:79583716-79583738 AAGACTACACAATGGGAGAATGG - Intergenic
1027703736 7:81502244-81502266 ATGAAAACATAAAGGCATAATGG - Intergenic
1027893891 7:84015579-84015601 AATAATACACTAAGGGATAAAGG - Intronic
1028386500 7:90259877-90259899 ATGAATACATAAAGTGAGAGTGG - Intronic
1028527944 7:91805933-91805955 ATGAAAAGAGAAAGGGAAAAAGG - Intronic
1028781899 7:94746754-94746776 CTGAATATACAAATGGACAATGG + Intergenic
1029343912 7:99965122-99965144 ATGAATACCCAAAGCGACATTGG + Intergenic
1031079533 7:117244833-117244855 AAGAATACACAATGGGGAAAAGG + Intergenic
1032112625 7:129089665-129089687 ATGAAAATACAAACAGACAATGG + Intergenic
1032375183 7:131407721-131407743 CAGCATACACAAAGGCACAAAGG - Intronic
1033031851 7:137834454-137834476 ATGAATTCACAAATGGTGAATGG - Intronic
1033363455 7:140654143-140654165 CTGAATACGCAAAGGGACAATGG - Intronic
1033719184 7:144039011-144039033 TTCAATACAGAAAGGCACAAGGG + Intergenic
1034672263 7:152867682-152867704 CTGAATACACAAATGGACAATGG - Intergenic
1035245676 7:157560820-157560842 ATGAAAACACGAAGGGCCAGTGG - Intronic
1036727101 8:11230167-11230189 ATGAATAAACAAATGAACACAGG + Intergenic
1036935949 8:13003010-13003032 ATAAATACACATAGTGAGAATGG - Intronic
1038338584 8:26664818-26664840 ATGAAAGGACAAAGGGTCAAGGG - Intergenic
1038463840 8:27741692-27741714 ACAAATACACCAAGAGACAAAGG + Intronic
1038694642 8:29795519-29795541 ATAAATGAACAAAGGGATAAAGG + Intergenic
1039283940 8:36018956-36018978 ATCAAAACACAAAGATACAATGG + Intergenic
1039351371 8:36767256-36767278 ATGAATGAATAAAGGAACAACGG + Intergenic
1039781372 8:40789442-40789464 CTGAATATGCAAATGGACAATGG + Intronic
1040117538 8:43640803-43640825 TAGAATTCACAAAGGGACATTGG + Intergenic
1040680526 8:49803040-49803062 ATGAAGACCCAAAGACACAAGGG + Intergenic
1040960995 8:53032646-53032668 TTGAAGATACAAATGGACAATGG - Intergenic
1042209462 8:66365130-66365152 CTGAATACAGAGAGGAACAAAGG - Intergenic
1042470717 8:69184518-69184540 AAAAATACAGAAAGGGGCAAAGG + Intergenic
1042568163 8:70133559-70133581 CTGAATACTAAAAGGGAAAATGG + Intronic
1042884230 8:73530405-73530427 AAGAACACACAAAGGAACAAAGG + Intronic
1043210270 8:77505233-77505255 GTGGATAAAGAAAGGGACAAAGG - Intergenic
1043230171 8:77790137-77790159 ATGAATGCACACAGAGACTAAGG + Intergenic
1043429974 8:80185240-80185262 CTGAATATACAAATGGACATTGG + Intronic
1043578785 8:81688126-81688148 ATGAAGACCCAAAGGTATAAGGG - Intergenic
1044240671 8:89884869-89884891 CTGAATATGCAAATGGACAATGG + Intergenic
1044547379 8:93474814-93474836 ATGAATACACAAAAGGTGCAAGG - Intergenic
1044605892 8:94047102-94047124 CTGAATATGCAAATGGACAATGG + Intergenic
1044821636 8:96159542-96159564 CTTAATACACAAAGGTACATGGG - Intronic
1045213354 8:100122031-100122053 CTGAATATACAAATGGACAGTGG + Intronic
1045481924 8:102599860-102599882 ATGACCACACAAAGGTGCAAGGG + Intergenic
1045586489 8:103543728-103543750 AAGAATACACAATGGGCAAAGGG + Intronic
1046124462 8:109886811-109886833 ATGAATATACAAAGACATAAAGG + Intergenic
1046124559 8:109888285-109888307 ATGAAAAAACAAAGACACAAAGG - Intergenic
1046269121 8:111870286-111870308 AGGAAAACACAAGTGGACAAAGG - Intergenic
1046759887 8:118010043-118010065 ATGAAGACACTGATGGACAAAGG - Intronic
1047022635 8:120792307-120792329 ATGCATACAGAGAGGGATAATGG + Intronic
1048357001 8:133661765-133661787 ATGAAGACAGAGAGGGACAGGGG - Intergenic
1048894256 8:138975278-138975300 CTGAATACACAGATGGACAATGG - Intergenic
1048912120 8:139145473-139145495 AAAAATACACAAAGGGGAAAGGG - Intergenic
1050301132 9:4260010-4260032 ATGGAAACACAGAGGGAGAAAGG + Intronic
1050410402 9:5358375-5358397 AGAAATACACAAGGTGACAAAGG + Intronic
1051014454 9:12458720-12458742 CTGAATATACAAATAGACAATGG + Intergenic
1051393570 9:16593294-16593316 ATAAATACAAACAGGGAGAAAGG + Intronic
1051749368 9:20325405-20325427 ATGAAGACAAGAAGGGAAAAGGG + Intergenic
1051880176 9:21832014-21832036 ATGAGGACACTAAGTGACAAAGG - Intronic
1052284305 9:26767635-26767657 ATGAGTACAAAAAGTCACAATGG + Intergenic
1052946786 9:34174989-34175011 ATGAATACACAAACACAAAAAGG - Intergenic
1053228980 9:36389310-36389332 TTGAAAACACAAAGGGAGTATGG + Intronic
1053348126 9:37393103-37393125 ATAAATACACAGAGGGACTTGGG - Intergenic
1053612277 9:39726788-39726810 ACGAATACAAAACTGGACAAAGG + Intergenic
1053726747 9:41010739-41010761 CTGAATAGAAAAATGGACAAGGG + Intergenic
1053870311 9:42484781-42484803 ACGAATACAAAACTGGACAAAGG + Intergenic
1054085978 9:60744367-60744389 ACGAATACAAAACTGGACAAAGG - Intergenic
1054241240 9:62615604-62615626 ACGAATACAAAACTGGACAAAGG - Intergenic
1054555369 9:66650128-66650150 ACGAATACAAAACTGGACAAAGG - Intergenic
1055778161 9:79789003-79789025 ATAAATATACAAATGAACAATGG - Intergenic
1055858585 9:80722252-80722274 ATGAATGAACAAAAGAACAAAGG - Intergenic
1056061880 9:82891718-82891740 AGGAATACAGAAAGAGAGAAAGG - Intergenic
1056408618 9:86301993-86302015 TTAAATTCACAAAGGAACAATGG + Intronic
1056602016 9:88053874-88053896 CTGAGTACACAAACAGACAATGG + Intergenic
1057905447 9:98979522-98979544 ATGAATACCCAAAAGAAAAATGG - Intronic
1058637682 9:107052347-107052369 ATGAAGAAACAGAGGCACAATGG + Intergenic
1059175996 9:112170663-112170685 CTGAATATACAAATGGACAATGG + Intronic
1059767740 9:117399920-117399942 ATGAATACAGAAGTGGACAGTGG + Intronic
1060078544 9:120618428-120618450 ATGAATACATAAAGGTACACTGG + Intronic
1060341957 9:122785468-122785490 ATGTATACAGAAGGAGACAAGGG - Intergenic
1060900382 9:127252040-127252062 ATGACTAGACAAAGGAAAAAGGG - Intronic
1061608246 9:131727981-131728003 ATGATTACAGAAAGTGAAAAGGG + Intronic
1061790952 9:133058572-133058594 AGGAATATATGAAGGGACAAAGG - Intergenic
1062276723 9:135734870-135734892 ATGACTGCACAAAGGGCCGATGG - Intronic
1186156949 X:6735492-6735514 GTAAATACACAAAGAGAGAAAGG - Intergenic
1187296206 X:18003308-18003330 AAGAATACACAGACGGAAAATGG - Intergenic
1188220955 X:27541156-27541178 ATGAAGACCCAAAGGCACAGGGG + Intergenic
1188295408 X:28441198-28441220 TTGAATATACAAAGGAACAAGGG - Intergenic
1188327624 X:28824914-28824936 ATGAATACACAAATACAGAAAGG - Intronic
1188535906 X:31196452-31196474 ATTAATACACAAAAAGCCAAAGG + Intronic
1189692480 X:43631836-43631858 ATGAAGACACAAAGATACAGGGG + Intergenic
1190473506 X:50806073-50806095 ATGAATGAACAAAGGGGCAATGG + Intronic
1190483504 X:50901015-50901037 ATGAACAAACAAATGCACAAAGG + Intergenic
1190492611 X:50997981-50998003 AGGCATACACACAGGGAGAATGG + Intergenic
1190550151 X:51571379-51571401 ATGAAGACCCAAAGACACAAAGG - Intergenic
1192288346 X:69763135-69763157 ATGAATTCATAAAAGGACATAGG - Intronic
1192988182 X:76422998-76423020 TTGAATGTACAAATGGACAATGG - Intergenic
1194001688 X:88437616-88437638 CTGAATACATAAATGGACAATGG + Intergenic
1194153494 X:90356733-90356755 ATGAATACACACACAGACAAGGG + Intergenic
1194460731 X:94164581-94164603 ATGAATACACAATGGTGAAAAGG - Intergenic
1194491832 X:94560603-94560625 AAGAATACACAAAGGGAATGGGG + Intergenic
1195092766 X:101478341-101478363 AGCAATACACAAATGGAAAATGG + Intronic
1195829442 X:109039896-109039918 AGGCAGAAACAAAGGGACAAAGG - Intergenic
1196713619 X:118789552-118789574 ATGAATACAACAAGGAAAAATGG - Intronic
1197041454 X:121940655-121940677 AAGAATACACAATGGGGAAAGGG - Intergenic
1198268871 X:135035310-135035332 AGGATTCCATAAAGGGACAAAGG + Intergenic
1198585249 X:138113537-138113559 ATGAATACACAAATGAAAGAAGG + Intergenic
1198692060 X:139295166-139295188 ATGAATTCACCTAGGGAGAATGG + Intergenic
1199009021 X:142737327-142737349 ATGTAGACACAAAGGGACAGAGG + Intergenic
1199279147 X:145979081-145979103 TTGAGTACACAAAGGTACCATGG - Intergenic
1199733814 X:150665230-150665252 ATGAAAACACAAAGTGCCTAGGG - Intronic
1199861811 X:151807732-151807754 ATGAATGCAGGAAGGGGCAAAGG + Intergenic
1200499830 Y:3933529-3933551 ATGAATACACACACAGACAACGG + Intergenic
1200849637 Y:7869726-7869748 ATGAATACACAGAGAGAAAAAGG + Intergenic
1201160086 Y:11159443-11159465 ATGAATCAACGAAGGGACCAGGG - Intergenic
1201315650 Y:12643070-12643092 CTGAATATACAAATGGACATTGG + Intergenic
1201525284 Y:14926289-14926311 ATGAATAAACGAAGAGAAAAAGG + Intergenic