ID: 1098026556

View in Genome Browser
Species Human (GRCh38)
Location 12:66209503-66209525
Sequence TCTACCTTGAATAATATATT TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 290
Summary {0: 1, 1: 0, 2: 0, 3: 22, 4: 267}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1098026556 Original CRISPR TCTACCTTGAATAATATATT TGG (reversed) Exonic
901332266 1:8419614-8419636 TCTACCTTAAATACTACATAAGG - Intronic
905600762 1:39248523-39248545 GCTACTTTGAATATTATAATTGG + Intronic
906898449 1:49806378-49806400 TCTACCTTCAACAAAATACTAGG - Intronic
908922417 1:69211592-69211614 TTTACCTTGCAAAGTATATTGGG + Intergenic
909220137 1:72947967-72947989 TCTACCTTGAATTTTGTTTTAGG - Intergenic
909519855 1:76555097-76555119 ACTCCCTTGAATAATATATGAGG + Intronic
910596422 1:88985510-88985532 ACAACCTTGAACAATATACTTGG - Intronic
911343744 1:96672290-96672312 TTACCCTAGAATAATATATTCGG - Intergenic
911853196 1:102844129-102844151 TTACCCTTGAATAATATATCAGG + Intergenic
911986743 1:104636329-104636351 TCTAAGTTGTAGAATATATTTGG + Intergenic
912038747 1:105356688-105356710 TCTAACTTGGATAATATTTTAGG - Intergenic
916403912 1:164477937-164477959 GCTACATTGAATAAAATCTTGGG + Intergenic
917746064 1:178008555-178008577 TCTATCTTGAATCATTTTTTAGG + Intergenic
918067315 1:181110060-181110082 TCTACCTTGAATATGAGAATAGG + Intergenic
918162955 1:181918514-181918536 TCTACCTTGTATTATAGTTTAGG + Intergenic
918249510 1:182689328-182689350 TCAATCTTAAATAATTTATTAGG + Intergenic
918810647 1:189115303-189115325 TCTATATTGAAAGATATATTGGG + Intergenic
918957333 1:191225987-191226009 TATACCTGGAATAATATAGAAGG - Intergenic
918995004 1:191746764-191746786 TTTAGCTTTAATAAGATATTTGG + Intergenic
919320737 1:196033888-196033910 TCTAACTTGGATAATTCATTCGG + Intergenic
921532456 1:216301498-216301520 TCTCCCTCGAATACTATTTTCGG - Intronic
921707014 1:218333888-218333910 ACTACTTAGAATAATATAGTAGG + Exonic
923140440 1:231157979-231158001 CCAGCCTTTAATAATATATTAGG + Intergenic
924657947 1:245990466-245990488 TCGACCTTGAATAAAATTTCTGG + Intronic
1062767672 10:77965-77987 TCTATCTTGAATTATTTTTTAGG - Intergenic
1063735656 10:8751098-8751120 TTCACCTTAAATAATATAGTAGG + Intergenic
1064588096 10:16860257-16860279 TCTATCCTGAAGAATATATTTGG - Intronic
1065607468 10:27433395-27433417 TCCACCTAGAATTATATATCTGG + Intergenic
1068177430 10:53479007-53479029 TCTAATTTGATTAATATACTAGG + Intergenic
1068681359 10:59823560-59823582 TTTAACTTTAATAATATTTTGGG - Intronic
1069423683 10:68270876-68270898 TCTACCTTTACTCATATACTGGG + Intergenic
1070059205 10:72966304-72966326 TCACCCTAGAATAATATATCTGG - Intergenic
1070420888 10:76236087-76236109 GTGACCTTGAACAATATATTTGG - Intronic
1070460244 10:76660016-76660038 TTTACCTTTAATACAATATTTGG - Intergenic
1071756985 10:88553838-88553860 TCTACCTTGAAGTATATTATAGG - Intronic
1071915611 10:90291667-90291689 TTTGTTTTGAATAATATATTTGG - Intergenic
1072423003 10:95305112-95305134 TCTTCCTTGAAAATTATCTTGGG - Intergenic
1073377186 10:103045968-103045990 TGTACATTTAATAATATAGTGGG + Intronic
1073842290 10:107511548-107511570 TCTACTGAAAATAATATATTCGG + Intergenic
1073967263 10:109004846-109004868 TTTACCAAGAATAAAATATTAGG + Intergenic
1075504004 10:123006111-123006133 TGAGCCTTGAATAATAAATTGGG - Intronic
1076748867 10:132530646-132530668 TCTTCCTTGGATAACATATTTGG + Intergenic
1077756366 11:5033108-5033130 TCAACCATGATTAATATTTTGGG - Intergenic
1077800977 11:5536812-5536834 TTTACTGTGAATAATCTATTTGG + Intronic
1078996577 11:16706838-16706860 TTTGCCTAGAATAATTTATTAGG - Intronic
1079616078 11:22495030-22495052 TATACATTGAACAATATTTTGGG - Intergenic
1080380862 11:31771144-31771166 TCTACCTGGAATCTTCTATTGGG + Intronic
1081242072 11:40719082-40719104 TCTAGCATGAATCATTTATTTGG + Intronic
1081974332 11:47222164-47222186 TTTACAGTGAATAAGATATTGGG - Intronic
1082672241 11:56048052-56048074 TATAATTAGAATAATATATTTGG - Intergenic
1083080628 11:60088929-60088951 TCTAGTTTAATTAATATATTGGG + Intronic
1084766841 11:71316033-71316055 TCTTCCTTAAATATAATATTTGG + Intergenic
1086023906 11:82267102-82267124 TCTATATTGAGTAATGTATTGGG - Intergenic
1087227439 11:95617304-95617326 GCTACAATGAAAAATATATTGGG + Intergenic
1087339375 11:96883150-96883172 TCTATCTTGGTTAATATTTTGGG + Intergenic
1087420695 11:97922098-97922120 TCTAAGCTAAATAATATATTAGG + Intergenic
1087588491 11:100153625-100153647 TCTTCCTTGAAAAATAAAATGGG + Intronic
1087887763 11:103499550-103499572 TTTACCTAGAATAGTATATCCGG + Intergenic
1088036494 11:105323129-105323151 TCTATCTTAAATAAGATAATGGG + Intergenic
1088417933 11:109610111-109610133 TCTACATCTAAAAATATATTAGG + Intergenic
1089993155 11:122880774-122880796 AATACCTTGTATAATATACTGGG + Intergenic
1090855127 11:130604258-130604280 TCTACCTTGGATGACAAATTTGG - Intergenic
1091056176 11:132421021-132421043 TGGACCTTGAATGATTTATTGGG - Intronic
1097474599 12:60037829-60037851 GCTAATTTGAATAATTTATTGGG - Intergenic
1097922758 12:65094296-65094318 TGTACTTTGAAAAATATATCGGG + Intronic
1098026556 12:66209503-66209525 TCTACCTTGAATAATATATTTGG - Exonic
1098562405 12:71889474-71889496 GCTACATGGCATAATATATTTGG - Intronic
1100477077 12:94944598-94944620 TTTACATTGAATTATATATCTGG + Intronic
1104525201 12:129514302-129514324 TCTCCCTTGAATAAACTAGTTGG + Intronic
1106631099 13:31474282-31474304 TCAACCTTGAAAAATAAATAGGG + Intergenic
1106826978 13:33533484-33533506 TCTACTTTGAATGATTTATCAGG - Intergenic
1107107632 13:36663092-36663114 TCTAGTTTGCAAAATATATTCGG - Intergenic
1107297680 13:38929582-38929604 TCTACTTTGAATAATCTCCTTGG - Intergenic
1107364742 13:39658118-39658140 TCTACTTTGAAGAATATTTTTGG + Intronic
1108438944 13:50429198-50429220 TTTCCCTTTAATAATATTTTGGG + Intronic
1108954977 13:56141906-56141928 TCTTCCTTGAAAAATATAGCAGG + Intergenic
1109612013 13:64778313-64778335 TCTGCATTGAAGAACATATTAGG + Intergenic
1110201892 13:72861039-72861061 ACTACATAGAATACTATATTGGG + Intronic
1110379227 13:74830824-74830846 TATTTCTTAAATAATATATTTGG - Intergenic
1110556681 13:76868026-76868048 TTTTCATTGAAGAATATATTTGG - Intergenic
1111326778 13:86708121-86708143 TCTTGCTTGTATAATTTATTAGG + Intergenic
1111370228 13:87307557-87307579 TTTGCCTAGAATAATTTATTAGG - Intergenic
1112347162 13:98599763-98599785 TCCACATTGAATTTTATATTTGG - Intergenic
1112450592 13:99504979-99505001 TTTACCTAGAATTTTATATTTGG - Intronic
1114779521 14:25522475-25522497 TCTACCTTGATTAAAATAAAAGG + Intergenic
1115355719 14:32444583-32444605 TCTCCATTTAATGATATATTTGG - Intronic
1117113425 14:52483784-52483806 TGTACCTTCAAAAATACATTTGG + Intronic
1117925361 14:60773420-60773442 TGTTCATGGAATAATATATTTGG + Intronic
1118831632 14:69438899-69438921 TCTACATTAAATAAAATATAGGG + Intronic
1125788667 15:42345619-42345641 TATAACTTAAAAAATATATTGGG - Intronic
1126514098 15:49515539-49515561 ACTACACTGCATAATATATTTGG - Intronic
1127220455 15:56874864-56874886 TCCACCTCAAATAATATAGTAGG - Intronic
1131890158 15:96963960-96963982 TCTACCATGAATAATGTCTTAGG - Intergenic
1133150095 16:3821585-3821607 TCTACCTAAAAAAAAATATTAGG - Intronic
1133624857 16:7561858-7561880 TAAATCTTGCATAATATATTAGG + Intronic
1138864845 16:60804559-60804581 TTACCCTAGAATAATATATTTGG + Intergenic
1140204988 16:72926457-72926479 TCCACTTTGAAAAACATATTCGG + Intronic
1140374682 16:74435406-74435428 TCATTCTTGAATGATATATTTGG + Intergenic
1140654952 16:77130989-77131011 TTTGCCTTGAGTAATATTTTTGG + Intergenic
1144321490 17:14125819-14125841 TTGCCCTTGACTAATATATTAGG - Intronic
1146287647 17:31584992-31585014 TATGCCTTGAAGAATACATTTGG - Intergenic
1152989923 18:353808-353830 TCTACCTTGAACACCATTTTAGG + Intronic
1153332515 18:3888362-3888384 TGTACTTTGAGTAATATAATTGG - Intronic
1155259231 18:24025293-24025315 TGTATCTTCAATAATTTATTTGG + Intronic
1155368085 18:25069123-25069145 TCTACATTAATCAATATATTTGG + Intronic
1155565942 18:27134237-27134259 TCTACATTGAAGCATATTTTTGG - Intronic
1155772062 18:29713697-29713719 CCTACCCAAAATAATATATTTGG + Intergenic
1155774294 18:29738659-29738681 TCTACCTCTAATGTTATATTTGG + Intergenic
1157143276 18:45134413-45134435 TTTACCTTCATTAATATATAGGG - Intergenic
1158057209 18:53295896-53295918 TCTACCTCCAAAAATATATATGG + Intronic
1159430059 18:68339910-68339932 TCTTCCTTGAATTTTCTATTTGG - Intergenic
1159711030 18:71760694-71760716 TAAACCTTGAATAACATCTTGGG - Intronic
1159792100 18:72794494-72794516 TCTACCTTAAAAAACACATTAGG + Intronic
1160199525 18:76784645-76784667 TCTAAATAGAATAATAAATTGGG + Intergenic
1160302845 18:77701758-77701780 TGTATCTTAAATAATTTATTTGG - Intergenic
1164122573 19:22280751-22280773 TCTACATTGATTAGTATACTTGG - Intergenic
925765173 2:7226464-7226486 GCTACCTTGATTAATGTATAGGG + Intergenic
926654016 2:15379500-15379522 TGTACCTGTGATAATATATTTGG + Intronic
927160363 2:20252759-20252781 TCTACTTAGAAAAATGTATTAGG + Intronic
927773379 2:25883076-25883098 AGTACCTGGAATAATATATATGG + Intergenic
929381063 2:41354581-41354603 TCTAAATTAAATAATATGTTTGG + Intergenic
930938604 2:56985644-56985666 TCTTCCCATAATAATATATTTGG + Intergenic
930974896 2:57445848-57445870 GCTACCTTAAAGAATATACTAGG - Intergenic
933107755 2:78354367-78354389 TGCACCTTGATTAATACATTTGG - Intergenic
934583697 2:95469301-95469323 TCTACGGTCAATAATATATTTGG - Intergenic
934595755 2:95607413-95607435 TCTACGGTCAATAATATATTTGG + Intergenic
934787022 2:97018077-97018099 TCCACAGTCAATAATATATTTGG - Intronic
936687368 2:114843389-114843411 TCTTCTTTGCATAATATCTTTGG + Intronic
936844905 2:116819348-116819370 TCTAACTTTAATAATGTGTTTGG - Intergenic
938737103 2:134196048-134196070 TACACCTTGAATAATATGTTGGG - Intronic
941678795 2:168372955-168372977 TCACCCTATAATAATATATTTGG + Intergenic
941782856 2:169463679-169463701 TCTAAGTTGTATAATCTATTTGG + Intergenic
941800131 2:169650796-169650818 TCTACACTGAAAAATATTTTAGG + Intronic
941941282 2:171040930-171040952 TCCAACTTCAATAATATATGAGG + Intronic
943429717 2:187784104-187784126 TCCATATTGAAGAATATATTAGG + Intergenic
943471672 2:188301991-188302013 ACCAACTTGAATAAAATATTTGG + Intronic
945083312 2:206107531-206107553 ATTATCTTTAATAATATATTTGG - Intergenic
945372809 2:209041117-209041139 TCTATATTGAATAAAAAATTAGG - Intergenic
945403313 2:209415216-209415238 TCTACTTTGGCTTATATATTAGG - Intergenic
945436331 2:209822527-209822549 TTTCCCTTGAATATTATAATGGG - Intronic
947047212 2:226001455-226001477 TCTTTCTTCAATAATAAATTAGG + Intergenic
1169633060 20:7655295-7655317 TCAACTTTGAATAGTCTATTGGG - Intergenic
1174981319 20:55398673-55398695 TCTACCTTCAAAATTATACTTGG + Intergenic
1177542343 21:22511041-22511063 TGTCCTTTAAATAATATATTTGG + Intergenic
949762778 3:7489695-7489717 TATACATTGATTAATTTATTAGG + Intronic
950251066 3:11465795-11465817 TCTTCCTTCCCTAATATATTTGG + Intronic
951482373 3:23174869-23174891 TCTTCTTTGAATGATTTATTGGG - Intergenic
951493058 3:23294069-23294091 TTTACCTTGAATAATTTACTAGG + Intronic
952209492 3:31215172-31215194 CTTACTTTGAATAACATATTTGG - Intergenic
952559805 3:34578194-34578216 TCTACCTTGAGATATATATTTGG - Intergenic
952748968 3:36808930-36808952 TCTTCCTTGAATATTTTATTTGG - Intergenic
953672243 3:44973023-44973045 TTTACCTTGTTTAAAATATTGGG + Intronic
956407545 3:68943937-68943959 CCTACCCTGAACAATAGATTGGG + Intergenic
962122490 3:132576826-132576848 TCTACCTTGATTTAGATATTAGG - Intronic
963229183 3:142892480-142892502 TCTGCCAAGAATAAGATATTAGG + Intergenic
965088968 3:164138666-164138688 TCAAACTTGAGAAATATATTTGG + Intergenic
965723748 3:171690710-171690732 TCTACCTTTTAAAATCTATTAGG + Intronic
966045665 3:175545520-175545542 TCCCCCTTGAATAATATTGTTGG + Intronic
966056284 3:175694607-175694629 TCTACTTTGAATTCTATAATGGG + Intronic
966145024 3:176801333-176801355 TCTACCTTGGAAAAAATCTTAGG - Intergenic
966333645 3:178843042-178843064 TCTACATATAAGAATATATTAGG - Exonic
967767818 3:193301142-193301164 TACACCCTGAATAATAAATTAGG + Intronic
971595369 4:28520814-28520836 TCTGCCTTGAATAATAATCTAGG + Intergenic
971699590 4:29953166-29953188 TCTATCTTTGATAAAATATTAGG + Intergenic
972938952 4:44173176-44173198 TTTACCTTGAATTATCTATCAGG - Intergenic
974395438 4:61328723-61328745 TTTTTCTAGAATAATATATTAGG + Intronic
974463988 4:62229916-62229938 TCTAGTTTCTATAATATATTAGG + Intergenic
974475953 4:62380562-62380584 TCTACCCTAATTTATATATTAGG - Intergenic
974893883 4:67914802-67914824 TTTACCATGAAAAAAATATTAGG - Intronic
975347562 4:73310528-73310550 TCTAAGTTGTATAATATTTTGGG - Intergenic
976129362 4:81868269-81868291 TCTAACTTGTATCATAGATTGGG - Intronic
976883243 4:89955891-89955913 TCTATGTTGAAAAGTATATTTGG - Intergenic
979292898 4:118997560-118997582 TCTAGCTTTACTAATAAATTTGG - Intronic
979680236 4:123451451-123451473 TATGCCTTAAATAATAAATTAGG + Intergenic
980124606 4:128761737-128761759 CCTACCTTGACTTATATATCTGG - Intergenic
980269913 4:130570735-130570757 TCTTCATTGCACAATATATTAGG + Intergenic
980502434 4:133673673-133673695 TATACCATAAACAATATATTGGG - Intergenic
980772989 4:137402755-137402777 TCTACCTGGAAAGATATATTAGG + Intergenic
980802584 4:137770823-137770845 TATACTTTGAATAACAGATTAGG - Intergenic
981571543 4:146156843-146156865 TAAACCTTGAATAATATCATGGG + Intergenic
981706827 4:147668783-147668805 TCTTCCTTAAAAAATATTTTTGG + Intronic
982471530 4:155797002-155797024 TTTTAATTGAATAATATATTTGG - Intronic
982747782 4:159122778-159122800 TAAACCTTGAATAATATTATGGG + Intronic
983192571 4:164770276-164770298 TGTACCTGGAACAATGTATTTGG - Intergenic
983343498 4:166497353-166497375 TCTGCCTTCATTCATATATTTGG + Intergenic
984470306 4:180161997-180162019 TCTATCTTGAGGTATATATTGGG + Intergenic
984731381 4:183070939-183070961 ACTACCTTGAAAAATATCTCTGG + Intergenic
987341406 5:16942677-16942699 TATAGCTTGAATTATAGATTTGG - Intergenic
988159964 5:27506345-27506367 TTAACCTTAAATATTATATTTGG + Intergenic
988252933 5:28783525-28783547 TATACCTTGAATAGTTAATTTGG - Intergenic
990323506 5:54651965-54651987 TCTACCTTGAGGAAAATATATGG + Intergenic
990582412 5:57178059-57178081 TCTACCTTGATTTATAAAATCGG + Intronic
990890653 5:60646292-60646314 TCTACCTTTGCTTATATATTTGG + Intronic
991321631 5:65380267-65380289 ACTACCTTTAAAAATATACTGGG + Intronic
992393771 5:76353284-76353306 AAGACCTTGTATAATATATTTGG - Intronic
993281825 5:85934819-85934841 GCTATCTTGAATATTCTATTAGG + Intergenic
993301083 5:86211011-86211033 TCAACCTTAAATAATATATATGG - Intergenic
993682073 5:90891506-90891528 TCTAACATGAAAAATATATTTGG + Intronic
994404798 5:99331506-99331528 TCTATCTTCAATAATAACTTTGG - Intergenic
994585505 5:101704029-101704051 TTTAACTTGAATAATATTATAGG + Intergenic
995242103 5:109897049-109897071 TCTATTTTGATTATTATATTGGG + Intergenic
996154274 5:120078721-120078743 TCTAACATGATTGATATATTAGG - Intergenic
996879552 5:128280157-128280179 TCTACCAAGTATAATATATTTGG + Intronic
997109159 5:131055665-131055687 TCAACCTAGAATACTATATCTGG + Intergenic
997324218 5:133006298-133006320 TCTACCTTAATTAATATACCTGG + Intronic
999014579 5:148087243-148087265 TCTACCTTCAATGCTAGATTTGG + Intronic
1000651739 5:163826454-163826476 TCTATCTAGAATAATAAATAAGG - Intergenic
1000717490 5:164664254-164664276 TCTTATTTGAATAATAGATTGGG + Intergenic
1003734717 6:8865743-8865765 TGTACCTTTAATTAAATATTGGG + Intergenic
1003742955 6:8964190-8964212 TGTACCTAGAACAATATTTTGGG + Intergenic
1008972736 6:57388701-57388723 TTTGGCTTGAATAATTTATTAGG + Intronic
1008980040 6:57472633-57472655 TCTGAATGGAATAATATATTAGG - Intronic
1009161643 6:60290256-60290278 TTTGGCTTGAATAATTTATTAGG + Intergenic
1009190926 6:60628880-60628902 TATAACTTGAATATTATAATAGG + Intergenic
1009443804 6:63715466-63715488 TCTACCTTTACTGATATATCTGG + Exonic
1009644802 6:66385886-66385908 TGTTCCTTGAATATTTTATTCGG + Intergenic
1009658671 6:66580531-66580553 TCTGCATTCAATAATCTATTAGG + Intergenic
1010407798 6:75524974-75524996 TCTACCTCGAGAAATGTATTTGG + Intergenic
1010516429 6:76777424-76777446 TTTCCCTTGAAGTATATATTTGG - Intergenic
1011585588 6:88921717-88921739 TCCACCCTTAATAATATTTTTGG + Intronic
1011593685 6:88995844-88995866 TCTACTTTGACTGATATATAGGG + Intergenic
1011623124 6:89261341-89261363 GCAACCTAGTATAATATATTTGG + Intronic
1012082267 6:94775485-94775507 TCTATTTTGAATATTTTATTTGG + Intergenic
1012704537 6:102504528-102504550 TCTAAGATTAATAATATATTAGG - Intergenic
1012744575 6:103068719-103068741 ACTACCTTGAATTATAATTTTGG - Intergenic
1013918543 6:115370882-115370904 TCTACTTTGAAATAAATATTTGG - Intergenic
1014862811 6:126491070-126491092 TTCACCTTGAAAAATGTATTTGG + Intergenic
1015723394 6:136270884-136270906 TTTAACTTAAATAATATCTTGGG - Intronic
1016415030 6:143823062-143823084 TCTATCTTTAAAAATATTTTTGG - Intronic
1018966293 6:168492095-168492117 TCTTCCATGAATAAAAAATTGGG - Intronic
1020582522 7:10022064-10022086 TGTACCTTGAAATATGTATTGGG + Intergenic
1021058877 7:16084879-16084901 TCTACTTTGAATAATTTTTTAGG - Intergenic
1021419705 7:20432058-20432080 TGTCCCATGAATATTATATTTGG - Intergenic
1021420200 7:20438380-20438402 TCTACATTGAATACCATATGAGG + Intergenic
1021485464 7:21163511-21163533 TCAACCTTGATAAATTTATTAGG + Intergenic
1021712187 7:23426828-23426850 TCAACCTTGAATGAAATAGTGGG - Intronic
1021996884 7:26187645-26187667 TCTACCTTGGATTAAATATTGGG + Intergenic
1022052628 7:26692777-26692799 TCTACCTTTAAAAATTTATATGG - Intronic
1022801876 7:33784535-33784557 CCTCCCATGAATAATATTTTGGG + Intergenic
1025222904 7:57131613-57131635 ACTATCTTGAAGAAAATATTTGG + Intronic
1025742407 7:64208207-64208229 ACTATCTTGAAGAAAATATTCGG - Intronic
1026415690 7:70178470-70178492 TGTATCTTTAATAATATATAAGG - Intronic
1028023850 7:85811394-85811416 TCTACTTACAATGATATATTTGG - Intergenic
1031243345 7:119273658-119273680 TCTTTCTTGAATGATATTTTAGG + Intergenic
1031754407 7:125619332-125619354 TCTCTCTTCAATAATATATTTGG + Intergenic
1035949606 8:4005642-4005664 TCTCCCATGGATACTATATTTGG + Intronic
1038603355 8:28971685-28971707 TGTAATATGAATAATATATTAGG + Intronic
1039026690 8:33266496-33266518 ATTACCTAGAAGAATATATTTGG + Intergenic
1039127984 8:34225780-34225802 TCTACATAGAATAAAATATAAGG + Intergenic
1040474067 8:47761701-47761723 TCTACTTTTAAAAAGATATTTGG + Intergenic
1041400156 8:57434184-57434206 TATACCTTGGAAAATATTTTAGG + Intergenic
1042746596 8:72114625-72114647 AGTATCTTGAATAATATCTTAGG - Intronic
1043527213 8:81110725-81110747 GCTGCCTTGAAAAATATAGTGGG + Intronic
1045168297 8:99631953-99631975 TTTAGCTAGAATAATTTATTGGG - Intronic
1046029867 8:108770532-108770554 GCTACCATGAATAATTTATGTGG - Intronic
1046179822 8:110630090-110630112 TCTACCTTATATACTATCTTTGG + Intergenic
1046285665 8:112090365-112090387 TTTACATTCAATAACATATTAGG + Intergenic
1046348658 8:112973945-112973967 TCTACTTTGAAAAATAAATGAGG + Intronic
1047577701 8:126175961-126175983 TCTACCTTGAATAAATTCATTGG + Intergenic
1051181138 9:14413032-14413054 TCTAACTGGAAGAATATATGCGG + Intergenic
1052063513 9:23988864-23988886 TCACCCTAGAATAGTATATTTGG + Intergenic
1052633365 9:31069889-31069911 TTTACCTGGTATAATATTTTGGG - Intergenic
1052709911 9:32041316-32041338 TCTGCCTTGAATGTTTTATTGGG + Intergenic
1053394218 9:37758084-37758106 TCTACAGTGAATAATATTTATGG + Intronic
1055890410 9:81117784-81117806 TTTACATTGAATAAAAGATTAGG - Intergenic
1056059251 9:82866162-82866184 TCTACGATGAATTATATGTTAGG + Intergenic
1056270925 9:84947463-84947485 TCTGCCTGGAATGCTATATTGGG - Intronic
1056778020 9:89528034-89528056 TATACCTTCAATAGTATATACGG + Intergenic
1058188700 9:101887187-101887209 TCTACCTTAAATCATATGGTTGG + Intergenic
1058249434 9:102672743-102672765 TCTACCTTGTATCATTTCTTAGG + Intergenic
1058617684 9:106851151-106851173 TCTACCATGAGTATAATATTAGG - Intergenic
1058770701 9:108228372-108228394 TTTTCCTTGTATACTATATTGGG + Intergenic
1186634401 X:11386900-11386922 TCCACCTTAAAAAATATATATGG - Intronic
1189066952 X:37820171-37820193 TCAACCTAGAATACTATACTTGG + Intronic
1189595443 X:42560020-42560042 TCTACCTTAAAAAACATATTCGG - Intergenic
1190961807 X:55257759-55257781 TATACCCTAAATAAAATATTAGG + Intronic
1191130984 X:57010545-57010567 TCACCCTAGAATAATATATCTGG - Intergenic
1192736389 X:73853111-73853133 TCTGGTTTGAATGATATATTTGG - Intergenic
1193063913 X:77236742-77236764 CCTACCTTTAATAGTATATCTGG + Intergenic
1193505652 X:82339779-82339801 TCTTCCTTGAATGAAATAGTTGG - Intergenic
1193887168 X:86996698-86996720 TCAGCCTAGAATAATATATCAGG - Intergenic
1193946979 X:87750404-87750426 ATTTCCTTGCATAATATATTTGG - Intergenic
1194386894 X:93266273-93266295 TCTCCCTTTGATAATAGATTGGG - Intergenic
1194389335 X:93296563-93296585 TTAACCTAGAATAATATATCTGG + Intergenic
1194500441 X:94675420-94675442 TCACCCTTGAATAGTATATTTGG - Intergenic
1197457619 X:126697333-126697355 AGCACCTTGAATAATATATCAGG - Intergenic
1198313850 X:135447014-135447036 TCTAAGTTGTATAGTATATTTGG - Intergenic
1198390122 X:136165876-136165898 TCTTTCTGGAATAATATATGTGG + Intronic
1199329298 X:146540430-146540452 TCTACCTTTACTAATTTATAAGG + Intergenic
1199870977 X:151898593-151898615 TCTCCCTTGATTAATATACCAGG - Intergenic