ID: 1098030272

View in Genome Browser
Species Human (GRCh38)
Location 12:66246520-66246542
Sequence TTGGCTCCACACAACTCTCA CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 145
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 134}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1098030272_1098030279 14 Left 1098030272 12:66246520-66246542 CCGTGAGAGTTGTGTGGAGCCAA 0: 1
1: 0
2: 0
3: 10
4: 134
Right 1098030279 12:66246557-66246579 GCTATGACATATATCGTGCAGGG 0: 1
1: 0
2: 0
3: 2
4: 33
1098030272_1098030280 26 Left 1098030272 12:66246520-66246542 CCGTGAGAGTTGTGTGGAGCCAA 0: 1
1: 0
2: 0
3: 10
4: 134
Right 1098030280 12:66246569-66246591 ATCGTGCAGGGACAGAGAATTGG 0: 1
1: 0
2: 0
3: 15
4: 133
1098030272_1098030276 -10 Left 1098030272 12:66246520-66246542 CCGTGAGAGTTGTGTGGAGCCAA 0: 1
1: 0
2: 0
3: 10
4: 134
Right 1098030276 12:66246533-66246555 GTGGAGCCAAGGGCTCAGGAAGG 0: 1
1: 0
2: 4
3: 32
4: 376
1098030272_1098030278 13 Left 1098030272 12:66246520-66246542 CCGTGAGAGTTGTGTGGAGCCAA 0: 1
1: 0
2: 0
3: 10
4: 134
Right 1098030278 12:66246556-66246578 AGCTATGACATATATCGTGCAGG 0: 1
1: 0
2: 0
3: 3
4: 38

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1098030272 Original CRISPR TTGGCTCCACACAACTCTCA CGG (reversed) Intronic
900571616 1:3361426-3361448 TGTGCTACACACAACTTTCAGGG - Intronic
901102006 1:6726273-6726295 CTGGCTCCTCATAACTCTCAGGG + Intergenic
902149836 1:14434350-14434372 ATGGCTCCGCACAACTCTGCTGG - Intergenic
902401240 1:16158387-16158409 TGGCTTCCACACAACTCACATGG - Intergenic
902983733 1:20142944-20142966 TTGGCTGTACACACTTCTCAAGG - Intronic
903161463 1:21491991-21492013 TTGTCTCCTCCCCACTCTCAAGG - Intergenic
905794282 1:40806933-40806955 TTGGCTCCACAGCACTCTCCTGG - Intronic
905974779 1:42166206-42166228 TTGGCTACACACACCCATCAGGG - Intergenic
907220362 1:52903064-52903086 CTGGCTTCTCCCAACTCTCAGGG - Intronic
908395813 1:63724817-63724839 TTGACTGCACACAAATCCCAGGG - Intergenic
909362820 1:74784097-74784119 TTGGCTCTACACAAATATAAGGG + Intergenic
918585647 1:186185205-186185227 TAGTCTCCACACCACTATCATGG + Intronic
920690511 1:208143007-208143029 CTGGCTCCCCACATCTCACAGGG - Intronic
1063932101 10:11039073-11039095 TTGCATCCACACCACTCTCATGG + Intronic
1064026984 10:11856754-11856776 TTGGCCCCACACATGGCTCATGG + Intronic
1064236447 10:13580584-13580606 TTGCCTCAACTCAACTCTAAAGG - Intergenic
1064489829 10:15842730-15842752 GTGGCACCACACATCTCTCTGGG + Intronic
1064556224 10:16549736-16549758 TTTGCTCCAGTAAACTCTCATGG - Intergenic
1066433990 10:35379812-35379834 TTTCCTCCCAACAACTCTCAGGG - Intronic
1066590132 10:36985653-36985675 CTTGTTCCACACATCTCTCAAGG + Intergenic
1067277334 10:44847302-44847324 TTGGCATCACACAACTCTGAGGG - Intergenic
1067580937 10:47445083-47445105 GTGTCCCCACACAAATCTCATGG + Intergenic
1070946481 10:80396002-80396024 CTGGCTCCACACAGCTCTCTAGG + Intergenic
1072270211 10:93768866-93768888 TTGGTTCCACACTAATCTGAGGG - Intronic
1073819980 10:107250983-107251005 CTGGCTCTGCACAACTGTCAAGG - Intergenic
1075583419 10:123639588-123639610 TTGGGTCCACGCAAAACTCAGGG + Intergenic
1076756838 10:132577030-132577052 TGGGCTCCAGAAAACTCTGAGGG + Intronic
1077777593 11:5288538-5288560 TTGTCTCCACACACCAGTCATGG + Intronic
1079489713 11:20973882-20973904 CTGGCTCCTCAAAACTCTAATGG + Intronic
1080982287 11:37423290-37423312 TTGGCTGCTCCCAAATCTCAAGG + Intergenic
1087662853 11:101008083-101008105 ATGACTCCATACAACTCACATGG + Intergenic
1090950835 11:131471851-131471873 CTGACTCCACAGAACACTCAGGG - Intronic
1092650686 12:10631590-10631612 TTGTCTCCATACCACACTCATGG - Intronic
1098030272 12:66246520-66246542 TTGGCTCCACACAACTCTCACGG - Intronic
1101897329 12:108766621-108766643 TTGGCTCCCCAGAGCCCTCAGGG + Intergenic
1106232525 13:27831962-27831984 TTGGCTCAAAATAACCCTCATGG + Intergenic
1106483626 13:30154876-30154898 TTCTCCCCACACAACTCTGAAGG + Intergenic
1109252015 13:60031376-60031398 TTGTCCCCACCCAAATCTCATGG - Intronic
1110645325 13:77877148-77877170 TTTGCTACATACAACTCTGAAGG + Intergenic
1110753662 13:79145861-79145883 TTGGCTGCATACTATTCTCATGG + Intergenic
1111802235 13:92995231-92995253 TTTCCTCCATACAATTCTCATGG + Intergenic
1111948385 13:94689707-94689729 TTTGGGCCACACAATTCTCAGGG - Intergenic
1112215651 13:97429060-97429082 TTTGCTTCAGACAACTCTCCTGG + Intergenic
1112892417 13:104254505-104254527 TAGGCTTCAAAGAACTCTCACGG - Intergenic
1113863031 13:113502657-113502679 CTGTCTCCCCACAACACTCACGG + Intronic
1117061406 14:51967202-51967224 TTATCTCCACACTACTCTAATGG - Exonic
1118085071 14:62405067-62405089 TTTGCTTCCAACAACTCTCATGG - Intergenic
1118395698 14:65334591-65334613 TTGGCTTCAAACAAGGCTCACGG + Intergenic
1118456846 14:65952327-65952349 TTGGCTCCACCACACTTTCAAGG + Intergenic
1118730935 14:68665842-68665864 TTGGCTGCACTGAAATCTCATGG - Intronic
1119714925 14:76852463-76852485 TGGGCTCCACACATCACTCCTGG - Intronic
1125600240 15:40911557-40911579 ATGTCTCCACCCAACTCTCTTGG - Intergenic
1126394537 15:48200114-48200136 TTAGGTCCAAACAAATCTCAAGG + Intronic
1127047353 15:55041186-55041208 TTGGCTCCACACAAATTTTAAGG + Intergenic
1129114314 15:73356804-73356826 TTGACTCCTCACAACCCACAAGG + Intronic
1129208860 15:74054014-74054036 TTGGCTCCAGCCAACTCCCCAGG + Intergenic
1130004439 15:80080999-80081021 TTGTCCCCACTCAAATCTCATGG - Intronic
1130615593 15:85403987-85404009 ATGGCTCCAGGCAACTCTCTGGG - Intronic
1132389004 15:101425125-101425147 TTGTCTCCTCAGCACTCTCACGG - Intronic
1134139559 16:11706315-11706337 TTGGCGCCACTCACCCCTCAGGG + Intronic
1136707582 16:32202174-32202196 CAGGCTCCACACCAGTCTCAAGG - Intergenic
1136760328 16:32727236-32727258 CAGGCTCCACACCAGTCTCAAGG + Intergenic
1136807776 16:33143150-33143172 CAGGCTCCACACCAGTCTCAAGG - Intergenic
1140290262 16:73647324-73647346 GTGTCTCCACCCAAATCTCATGG + Intergenic
1203062482 16_KI270728v1_random:987558-987580 CAGGCTCCACACCAGTCTCAAGG + Intergenic
1145011458 17:19370689-19370711 ATGGCTCCAGACACCTCTCGGGG - Intronic
1150267078 17:63838623-63838645 TGGGCTCCACAGAAATGTCAGGG - Intronic
1152621183 17:81365655-81365677 GTGACTCCACACATCTCTCTGGG - Intergenic
1155536025 18:26819108-26819130 TGGGCTCCACACTAGCCTCAAGG - Intergenic
1155571771 18:27202426-27202448 TTGGCTCCTCACAGGTCTAAGGG + Intergenic
1161984956 19:7647908-7647930 CTGGCTCAGCACAACTCCCAGGG - Intergenic
930608388 2:53515695-53515717 TCTGCTCAACTCAACTCTCATGG + Intergenic
931009785 2:57897112-57897134 CTGTCTCCAAACAACTCTAATGG + Intergenic
932335084 2:70926166-70926188 TTGGCTCTCCACCACTCACAGGG + Intronic
933105408 2:78318469-78318491 TTGGCTCTTCAGCACTCTCATGG - Intergenic
933214514 2:79613863-79613885 TAGTCTCCACACCAATCTCATGG + Intronic
936116271 2:109705634-109705656 GTGGCTCCACACAACGCCCTGGG - Intergenic
938079957 2:128364634-128364656 TTGGCTGCAGACAACCCTCCCGG - Intergenic
940744830 2:157555591-157555613 TTAGCTTCACACACATCTCAGGG + Intronic
1168947170 20:1770763-1770785 TGCCCTCCACACAACTGTCATGG + Intergenic
1173332511 20:42087158-42087180 TTGGGGCCACATAACTCTCGGGG - Intronic
1173340192 20:42146331-42146353 TTGGCTTCACCCCACTTTCAGGG - Intronic
1175133617 20:56807336-56807358 TGGGCTCCACAAAATACTCAGGG - Intergenic
1176371640 21:6065939-6065961 TGGGCCCCACACACCTCTCATGG + Intergenic
1177165120 21:17592570-17592592 TTATCACCACAAAACTCTCAAGG + Intronic
1177459011 21:21385320-21385342 TTGTCTCCATACAACTTTGATGG - Intronic
1179751879 21:43472600-43472622 TGGGCCCCACACACCTCTCATGG - Intergenic
1180608608 22:17080973-17080995 TAGGCTCTGCACACCTCTCAGGG - Intergenic
1181471463 22:23142824-23142846 ATGGCTCCCCACTAGTCTCAGGG + Intronic
1185064477 22:48624117-48624139 TTCGCTCCTCAAAACTGTCAGGG - Intronic
952548742 3:34450921-34450943 TTGGCTCCATGCTACTCCCAGGG + Intergenic
954276407 3:49544645-49544667 TAGGCTCCACAGAACTCTGTTGG + Intergenic
954385898 3:50243610-50243632 TCAGCTCCACACAACAGTCAAGG - Intronic
959940732 3:112078087-112078109 TTGGGTCCACTGAAGTCTCAGGG + Intronic
960630855 3:119729103-119729125 TTTGCTCCACCCAGCTGTCAAGG - Intronic
961557922 3:127709348-127709370 CTGGCTCCACACAGGCCTCATGG + Intronic
964702539 3:159584962-159584984 TTGGCTGCACACATATCTGAGGG - Intronic
964919878 3:161883944-161883966 ATGTCTCCACCCAAATCTCATGG + Intergenic
966632988 3:182099014-182099036 TTTGATCCACACAACTGACAGGG + Intergenic
972902796 4:43705616-43705638 CTGTCCCCACACAAATCTCATGG + Intergenic
973315935 4:48760002-48760024 TTTGATCCTCACAACTCTAAAGG + Intronic
974031326 4:56779316-56779338 TTGCCTTCACACATCTCCCAGGG - Intergenic
975663721 4:76712471-76712493 TTTGTTCCACTCAACTTTCAGGG - Intronic
976256469 4:83105649-83105671 GTGGTTCCTCATAACTCTCATGG - Intronic
976862423 4:89681413-89681435 GTGGCTCCACCCCACTCTCCCGG - Intergenic
980006963 4:127553165-127553187 TTGGCCCCTCCCAAATCTCATGG - Intergenic
980906380 4:138952213-138952235 GTGGCTCCACAAAATTGTCAGGG + Intergenic
982506804 4:156228602-156228624 TGGGCTCTCAACAACTCTCATGG + Intergenic
983541958 4:168920648-168920670 TCTGGTCCACACAACTGTCAAGG + Intronic
985659806 5:1151456-1151478 TGGGCTGCACACAACCCTCCAGG + Intergenic
992934200 5:81684934-81684956 GTGTCCCCACACAAATCTCATGG + Intronic
1006601419 6:35229020-35229042 TTGGCTCCACACAGATATCTTGG + Intronic
1006761483 6:36465997-36466019 TTTGGTCAACACAACTCTGAAGG - Intronic
1009045942 6:58237654-58237676 TTGGCTCCAGATAACTGCCAGGG - Intergenic
1009606203 6:65871065-65871087 TTGGCTCCATATAAAACTCATGG + Intergenic
1010016100 6:71106214-71106236 CTGGCTTCACACACCTCTCATGG - Intergenic
1011692886 6:89886467-89886489 GGGGCTCCACGCCACTCTCAAGG - Intergenic
1012750491 6:103156234-103156256 TTGGCTCACCACAACCCTCCTGG - Intergenic
1014778301 6:125535076-125535098 TTTGTTCCATAAAACTCTCAAGG + Intergenic
1016005040 6:139080461-139080483 TTGTGCCAACACAACTCTCAAGG + Intergenic
1019806206 7:3127854-3127876 TTGGATCCAGTCAACACTCAGGG + Intergenic
1020342184 7:7124138-7124160 TTGGTCCCATACAACTCTTAGGG - Intergenic
1022423028 7:30241979-30242001 TTTGCTGGACAGAACTCTCATGG + Intergenic
1023218040 7:37886448-37886470 TTGGCTCCACCCACCACTTACGG + Intronic
1028857179 7:95605428-95605450 GGGGCTGCACGCAACTCTCATGG + Intergenic
1032163708 7:129529651-129529673 TTGGCTGCACACTGCTCTGAGGG - Intergenic
1033639597 7:143248864-143248886 TTGGCTGCACCCAACTCTTGTGG + Intronic
1035992635 8:4509962-4509984 GTGTCTCCACCCAAATCTCATGG + Intronic
1040954125 8:52962200-52962222 TTGGGTCCACACAGCTTTTATGG + Intergenic
1041392151 8:57356476-57356498 TTAGCTTCCCACAAGTCTCAAGG + Intergenic
1043698494 8:83251981-83252003 CTGGCCCCACAAAACTCTGAGGG - Intergenic
1048529070 8:135231074-135231096 TTTGCTCCACACACATCTCTGGG + Intergenic
1056042721 9:82685071-82685093 CTGGCTCCTCCCAAATCTCATGG + Intergenic
1057977836 9:99625314-99625336 TTTGCTCCACATAACCCTAATGG + Intergenic
1193316434 X:80071152-80071174 TTGGCTCCTCTCAAATCTTATGG + Intergenic
1193858963 X:86640393-86640415 CATGCCCCACACAACTCTCACGG + Intronic
1195323241 X:103737978-103738000 TTGGCTCCTACCAACTCTCAGGG - Intergenic
1195325023 X:103751510-103751532 TTGTCACCACTCAAGTCTCAGGG - Intergenic
1196834705 X:119803457-119803479 TTGTCCCCACCCAAATCTCATGG + Intergenic
1196835860 X:119813234-119813256 TTGTCCCCACCCAAATCTCATGG + Intergenic
1196836795 X:119820995-119821017 TTGTCCCCACCCAAATCTCATGG + Intergenic
1196837897 X:119830244-119830266 TTGTCCCCACCCAAATCTCATGG + Intergenic
1198361770 X:135902634-135902656 TTGGCAGCACTCAGCTCTCATGG + Intronic
1198822450 X:140663009-140663031 TTGACTCTACACAAAGCTCAAGG + Intergenic
1199512178 X:148634784-148634806 GTGGCTCAACTCAGCTCTCATGG + Intronic