ID: 1098031712

View in Genome Browser
Species Human (GRCh38)
Location 12:66261498-66261520
Sequence TTGACCAGGTTCACGTAGAT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1098031710_1098031712 -2 Left 1098031710 12:66261477-66261499 CCTCTCAATGGTAGATTTGCATT No data
Right 1098031712 12:66261498-66261520 TTGACCAGGTTCACGTAGATAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1098031712 Original CRISPR TTGACCAGGTTCACGTAGAT AGG Intergenic
No off target data available for this crispr