ID: 1098033274

View in Genome Browser
Species Human (GRCh38)
Location 12:66276563-66276585
Sequence CAATTCTTTCAGACTTTCCT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1098033271_1098033274 -4 Left 1098033271 12:66276544-66276566 CCTCTTCTTCCTTGTTTTCCAAT 0: 1
1: 0
2: 5
3: 114
4: 1102
Right 1098033274 12:66276563-66276585 CAATTCTTTCAGACTTTCCTTGG No data
1098033270_1098033274 23 Left 1098033270 12:66276517-66276539 CCACTGACTGCTGGAGGATGCGC No data
Right 1098033274 12:66276563-66276585 CAATTCTTTCAGACTTTCCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1098033274 Original CRISPR CAATTCTTTCAGACTTTCCT TGG Intergenic
No off target data available for this crispr