ID: 1098033451

View in Genome Browser
Species Human (GRCh38)
Location 12:66278446-66278468
Sequence AAGGTGCTAATGAACTCTGT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1098033448_1098033451 9 Left 1098033448 12:66278414-66278436 CCTGAGCAATCAGGTGGAGGAGA No data
Right 1098033451 12:66278446-66278468 AAGGTGCTAATGAACTCTGTTGG No data
1098033444_1098033451 24 Left 1098033444 12:66278399-66278421 CCTCTAAGATTCTAGCCTGAGCA No data
Right 1098033451 12:66278446-66278468 AAGGTGCTAATGAACTCTGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1098033451 Original CRISPR AAGGTGCTAATGAACTCTGT TGG Intergenic
No off target data available for this crispr