ID: 1098039499

View in Genome Browser
Species Human (GRCh38)
Location 12:66339807-66339829
Sequence ATCAGGTTACCTAGGGATGG GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 166
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 156}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1098039499_1098039511 30 Left 1098039499 12:66339807-66339829 CCCCCATCCCTAGGTAACCTGAT 0: 1
1: 0
2: 0
3: 9
4: 156
Right 1098039511 12:66339860-66339882 AGACATGTGGTTCTTTGTTCCGG 0: 1
1: 0
2: 1
3: 16
4: 175
1098039499_1098039509 17 Left 1098039499 12:66339807-66339829 CCCCCATCCCTAGGTAACCTGAT 0: 1
1: 0
2: 0
3: 9
4: 156
Right 1098039509 12:66339847-66339869 ACTTGCCTATTGCAGACATGTGG 0: 1
1: 0
2: 2
3: 11
4: 117

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1098039499 Original CRISPR ATCAGGTTACCTAGGGATGG GGG (reversed) Exonic
900802439 1:4745717-4745739 AGCAGGTCACGTGGGGATGGTGG + Intronic
902562496 1:17286481-17286503 ATCAGCTGACCTAGAGAGGGTGG - Intergenic
902617567 1:17632166-17632188 ATCTTGTCACCCAGGGATGGAGG + Intronic
904421664 1:30398282-30398304 CTGAGGTGACCTGGGGATGGAGG + Intergenic
904421695 1:30398389-30398411 GTGAGGTGACCTAGGGGTGGAGG + Intergenic
905630092 1:39513788-39513810 ACCAGGTCATCTAGGGAAGGAGG + Intronic
905667667 1:39772402-39772424 ACCAGGTCATCTAGGGAAGGAGG - Intronic
912902195 1:113663378-113663400 AAGTGGTTGCCTAGGGATGGGGG - Intronic
915018348 1:152757760-152757782 ATCAGGTCTTCTAGGGATGGAGG + Intronic
917988997 1:180352789-180352811 ATCAGCATATCTAGGGATGAAGG + Intronic
918417170 1:184322470-184322492 GTCATGTAACCTGGGGATGGGGG - Intergenic
919134974 1:193496528-193496550 ATCAGGTTGCCTGGGAATGGGGG - Intergenic
1063161466 10:3421768-3421790 ATCAGGACACCTTGGCATGGAGG + Intergenic
1064981390 10:21170890-21170912 TTCAGGTCTCCTAGAGATGGAGG - Intronic
1065797086 10:29317789-29317811 ATTAATTTACCTGGGGATGGTGG + Intronic
1066215611 10:33283958-33283980 ATAAGGTTATCTTGGGATTGAGG - Intronic
1068440198 10:57043930-57043952 CTCAGGTTTCCAAGGGATAGAGG + Intergenic
1069705056 10:70453823-70453845 AATGGGTTGCCTAGGGATGGGGG + Intergenic
1073572080 10:104589194-104589216 ATCAGGGGAGCTAGAGATGGAGG + Intergenic
1073833691 10:107416235-107416257 AAATGGTTACCTAGGGATGTGGG + Intergenic
1074963009 10:118464662-118464684 ATCAGATTAGCTGGGCATGGTGG + Intergenic
1075176407 10:120165947-120165969 ATCCGGGTACTTAGGGCTGGCGG + Intergenic
1077719155 11:4609559-4609581 ATCAGGGTAGCTGGGGGTGGGGG + Intergenic
1077922249 11:6650374-6650396 AGAAGGTTACCTAGGGAAGATGG + Intronic
1081508594 11:43744366-43744388 AGCAGGTTACATAGAAATGGTGG + Intronic
1086310569 11:85531716-85531738 ATCAGGTTACACAGCGGTGGAGG + Intronic
1087185864 11:95194272-95194294 CTCAGGTTACCTAGTAATGGGGG - Intronic
1088569735 11:111211995-111212017 ATTTGGTTTCCTAGGGGTGGGGG - Intergenic
1089118780 11:116117457-116117479 ATTAGGCTACCCAGGGAAGGCGG + Intergenic
1090639854 11:128721016-128721038 CTCAGGTTAGCTGGGGCTGGAGG - Intronic
1096521607 12:52187703-52187725 AACAGGTTCAGTAGGGATGGAGG + Intronic
1096832239 12:54323490-54323512 ATCAGGAAACCAAGGGATAGGGG + Intronic
1098039499 12:66339807-66339829 ATCAGGTTACCTAGGGATGGGGG - Exonic
1100108661 12:91210096-91210118 ACCAGGTTAGCTGGGCATGGTGG + Intergenic
1104122619 12:125813868-125813890 ATCAGAAACCCTAGGGATGGGGG + Intergenic
1106101142 13:26695849-26695871 ACCAGGATTCCTAGGTATGGTGG - Intergenic
1106352990 13:28952614-28952636 ATATGGTTACCTGGGGATAGAGG - Intronic
1106953751 13:34912981-34913003 ACACAGTTACCTAGGGATGGAGG + Intergenic
1114214214 14:20643656-20643678 ATAAGGTTGGCTGGGGATGGTGG - Intergenic
1117010451 14:51465448-51465470 CTATGGTTACCTAGAGATGGCGG - Intergenic
1117350950 14:54881224-54881246 AACAGGTTACCTTTGCATGGAGG + Intronic
1119655272 14:76412963-76412985 ATTAAATTAACTAGGGATGGTGG + Intronic
1126840507 15:52713265-52713287 ATCTGATTAACTTGGGATGGAGG + Intergenic
1134360845 16:13529852-13529874 ATCAGGTTACCTGGAGCTGTGGG - Intergenic
1134398315 16:13885800-13885822 ATCAGGAGATCTAAGGATGGTGG + Intergenic
1136364587 16:29803879-29803901 AACAGGTTAACTCTGGATGGAGG + Intronic
1138235729 16:55380689-55380711 ATCAAATTAGCTAGGCATGGTGG + Intergenic
1139280624 16:65767332-65767354 ATCAGGTTACAAAGGGATGCAGG - Intergenic
1139909016 16:70385360-70385382 ATAAGGTTACCTGGGGTTGAGGG + Intronic
1143079928 17:4374041-4374063 AACAATTTACCTAGGCATGGTGG + Intergenic
1143886969 17:10072148-10072170 ACCAGGATCCCTAGGGCTGGAGG + Intronic
1144054861 17:11531372-11531394 AGCAGGTTAGCTACAGATGGGGG + Intronic
1150500364 17:65644758-65644780 ATCAAGTTAGCTAGGCATGGTGG + Intronic
1151689056 17:75669228-75669250 AATAGGTTAGCTAGGCATGGTGG - Intronic
1153333833 18:3901504-3901526 AGCTGGTTCCCTAGGGATGTTGG + Intronic
1155500396 18:26481801-26481823 ATCAGAATAGCTGGGGATGGGGG - Intronic
1156116852 18:33795967-33795989 AGCAGGTTCCCTAGGGAATGGGG + Intergenic
1156334984 18:36162230-36162252 AAGTGGTTTCCTAGGGATGGAGG - Intronic
1157733732 18:50027999-50028021 TAGAGGTTACCTGGGGATGGAGG + Intronic
1158096572 18:53778786-53778808 ATTAGTTTAGCTAGGGATAGAGG + Intergenic
1159406259 18:68006550-68006572 ATGTGTATACCTAGGGATGGGGG + Intergenic
1164402314 19:27910722-27910744 ACCAGGTTACCAGGGGATGAGGG + Intergenic
1164593866 19:29520885-29520907 ATCAGGTCATCGAGGGGTGGAGG - Intergenic
1165943404 19:39426808-39426830 ATCAGGATCCCCAGGGAAGGAGG + Exonic
1167407459 19:49322479-49322501 ACCAAGTTACCCAGGCATGGTGG + Intronic
925429371 2:3778022-3778044 CTCAGGTAACCTACTGATGGAGG - Intronic
929803021 2:45120538-45120560 ATCACTTTACCTAGGGAAAGGGG + Intergenic
929805663 2:45142823-45142845 AACAGATTACCTGGGTATGGTGG - Intergenic
931028287 2:58139098-58139120 ACCAGGCTAGCTAGGTATGGAGG + Intronic
931800530 2:65753787-65753809 GTCAGGTCACCTAGGGAGGGTGG - Intergenic
936886631 2:117318518-117318540 ATGAGGATATCTTGGGATGGGGG + Intergenic
937116243 2:119406967-119406989 CTCAGTTTACCCAGTGATGGGGG - Intergenic
938889100 2:135684608-135684630 TGCTGGTTACCTGGGGATGGGGG - Intronic
940229204 2:151432158-151432180 AAAAGGTTAGCTAGGCATGGCGG - Intronic
942221501 2:173773458-173773480 ATTAAGTTAGCTAGGCATGGTGG + Intergenic
942754800 2:179328009-179328031 AACAGCTTTCCTAGTGATGGTGG - Intergenic
945482429 2:210359608-210359630 ATCAGGTTATCTAAAGATGAAGG - Intergenic
946345599 2:219107894-219107916 ATCTGGTTTCCTAGTGTTGGTGG - Intronic
946557729 2:220877605-220877627 ATGAGGTCATCTAGAGATGGAGG - Intergenic
949016938 2:241718859-241718881 AGCTGGTTACCAAGGAATGGTGG - Intronic
1169751740 20:9001540-9001562 ATCAGTGTACCTAGAGAAGGAGG - Intergenic
1170241613 20:14173080-14173102 ATCAGGTTATCTAAAGATGAAGG - Intronic
1172202466 20:33136149-33136171 CTCAGGTTGCTGAGGGATGGAGG - Intergenic
1172757669 20:37298404-37298426 TTGAGGTTACCAAGGGCTGGAGG - Intronic
1174477160 20:50803846-50803868 ATCAGAATACTCAGGGATGGGGG - Intronic
1174829260 20:53797761-53797783 ATCAAGGAACCTAGGCATGGGGG - Intergenic
1175575711 20:60058974-60058996 ACCAGGTTACCTTGGGAAGTGGG - Exonic
1176344266 21:5727444-5727466 GTCAGGTTACCTACAAATGGAGG - Intergenic
1176351080 21:5848028-5848050 GTCAGGTTACCTACAAATGGAGG - Intergenic
1176500561 21:7597012-7597034 GTCAGGTTACCTACAAATGGAGG + Intergenic
1176538587 21:8125513-8125535 GTCAGGTTACCTACAAATGGAGG - Intergenic
1178348420 21:31851876-31851898 ATGGGACTACCTAGGGATGGGGG - Intergenic
1178835411 21:36093260-36093282 AAAATGTTACCTAGGCATGGTGG - Intergenic
1182859662 22:33548162-33548184 ACCAGAATACCAAGGGATGGTGG - Intronic
1203243533 22_KI270733v1_random:41868-41890 GTCAGGTTACCTACAAATGGAGG - Intergenic
950606738 3:14088105-14088127 ATTAAGTTAGCTAGGCATGGTGG + Intergenic
951673377 3:25209683-25209705 AGCAGGAGAGCTAGGGATGGAGG - Intronic
953288267 3:41634461-41634483 CTCATGTGACCCAGGGATGGAGG - Intronic
956399743 3:68864936-68864958 CTGTGGTTGCCTAGGGATGGTGG + Intronic
957026027 3:75182868-75182890 ATCAGGTTGCCTAGAGAGTGTGG - Intergenic
959479388 3:106853279-106853301 ATCAGGTCACAGAGCGATGGAGG - Intergenic
960303288 3:116030673-116030695 ATCAGGCTACCTTGGGTAGGTGG + Intronic
962125881 3:132617254-132617276 ATCAGAATCTCTAGGGATGGAGG + Intronic
963040206 3:141064830-141064852 GTCTGGTTTCCTAGTGATGGTGG + Intronic
963673639 3:148281488-148281510 ATTAGCTTAGCTAGGCATGGTGG + Intergenic
968581410 4:1397049-1397071 AAAAGGTGACCTTGGGATGGGGG + Intergenic
976165603 4:82251533-82251555 AAGTGGTTGCCTAGGGATGGGGG + Intergenic
980452367 4:132991258-132991280 ATAAGGTGACATAGGGATTGTGG - Intergenic
981849770 4:149216565-149216587 AGCAGCTCACCTAGAGATGGAGG - Intergenic
982048573 4:151475499-151475521 ATGAGGATATCTGGGGATGGAGG + Intronic
982354134 4:154448229-154448251 ATCAGATTACCTAGGGAGAGAGG - Intronic
982751414 4:159166602-159166624 ATCCAGTTTCCTAGGGATTGTGG + Intronic
984405568 4:179325220-179325242 ACCAGGGTGTCTAGGGATGGAGG + Intergenic
985382811 4:189413503-189413525 ATCAGTTTCCTGAGGGATGGAGG - Intergenic
987955994 5:24740686-24740708 AACAGGTTACCAAGGGCTAGAGG - Intergenic
990047960 5:51457755-51457777 ATCAGGTGACCCTGAGATGGAGG + Intergenic
992079578 5:73222473-73222495 GGCAGATTACCCAGGGATGGCGG + Intergenic
992905780 5:81344525-81344547 ATCAGGTAATTTAGGGATGAGGG + Intronic
996321834 5:122226306-122226328 GACAGGTTACCAAGGGAAGGAGG + Intergenic
997478694 5:134165904-134165926 TTCAGGTTAGCCAGGCATGGTGG + Intronic
998898945 5:146831636-146831658 ATCAGGTTAGCCAGGCGTGGTGG + Intronic
999801582 5:155043284-155043306 TTCAGGTTACCGAGGGCTGTTGG + Intergenic
1000371292 5:160539282-160539304 ATCAGGTTACCTAGAGAAATTGG + Intergenic
1001477718 5:172062718-172062740 ATAAAGTTACCAAGGGTTGGAGG + Intronic
1004218453 6:13724144-13724166 ATCAGGTTTCCTAGAAACGGAGG + Intergenic
1005691617 6:28312021-28312043 TTCAGGTTCCCTAGTGACGGTGG + Intergenic
1006184434 6:32172907-32172929 ATAAGTTTACCTAGGAATAGGGG - Intronic
1007135856 6:39521496-39521518 AGCAGCTCTCCTAGGGATGGGGG - Intronic
1008226656 6:48927167-48927189 ATAAGGTTTCCTAGGTATGCAGG - Intergenic
1010296061 6:74197378-74197400 ATCATGTTACCTAGGTATATAGG + Intergenic
1010341071 6:74753507-74753529 ATGAGGTTACAGAGAGATGGGGG - Intergenic
1010549010 6:77197882-77197904 AGTATGTTACCTATGGATGGGGG + Intergenic
1011519766 6:88192880-88192902 AGCAGGTTACCTAAGCATGCAGG - Intergenic
1013014825 6:106151424-106151446 AATGGGTTACCAAGGGATGGTGG - Intergenic
1016479621 6:144468192-144468214 ATCCTGTGACCTAAGGATGGAGG - Intronic
1018804896 6:167250967-167250989 ATTTGGTTACCTTGGAATGGAGG - Intergenic
1020946886 7:14622376-14622398 ATGAAGTTACCTAGGGAGTGAGG - Intronic
1026658424 7:72277470-72277492 ATCAAGATTCCTAGGGATAGCGG - Intronic
1028756025 7:94435243-94435265 ATCAGATTAGCTGGGCATGGTGG - Intergenic
1030195711 7:106851570-106851592 GTCAGGTTGCCTAAGCATGGTGG + Intergenic
1031039016 7:116819194-116819216 ATAATGTTACCTATGGAGGGAGG - Intronic
1031206346 7:118762984-118763006 CACAGGGTACCGAGGGATGGTGG + Intergenic
1032199226 7:129807691-129807713 ATGAGGTTACCTAGGGACCTAGG - Intergenic
1033200265 7:139362409-139362431 TTCAAGTTACCCAGGGATAGGGG + Intronic
1033673319 7:143513369-143513391 ATCATGTTAGCTGGGCATGGTGG - Intergenic
1034512361 7:151546480-151546502 GTGAGGTCATCTAGGGATGGGGG + Intergenic
1035893613 8:3372761-3372783 AACAGGTTACATAGGTCTGGAGG + Intronic
1036087465 8:5627936-5627958 AAAAGGTTAGCTAGGCATGGCGG - Intergenic
1039059096 8:33559426-33559448 ATATGGCTAGCTAGGGATGGGGG - Intronic
1041710806 8:60892594-60892616 ACCAGGTTGGCTAGGGATAGTGG + Intergenic
1048938398 8:139375990-139376012 GTCAGGGAACCTAGGGGTGGAGG - Intergenic
1052169739 9:25378021-25378043 ATCAGGTTAGCTAGGACTGGTGG - Intergenic
1052623093 9:30939582-30939604 ATCAGGTGAACTAGGGTTGAGGG + Intergenic
1056462933 9:86825631-86825653 ATTAGGAGACCTAGGGATGGTGG - Intergenic
1058060342 9:100489081-100489103 ATGTGGTTACCAGGGGATGGGGG - Intronic
1058068734 9:100579891-100579913 ATAAGGTTACACTGGGATGGTGG + Intronic
1058730474 9:107845237-107845259 AACAAGTTACCTGGGCATGGAGG - Intergenic
1062400641 9:136371224-136371246 CTCAGGGCTCCTAGGGATGGGGG + Intronic
1203769550 EBV:41942-41964 ATCAGGTTAACAAGGGAAGAAGG - Intergenic
1203459861 Un_GL000220v1:24951-24973 GTCAGGTTACCTACAAATGGAGG - Intergenic
1188716637 X:33466550-33466572 ATCATGATAGCTAGGCATGGTGG - Intergenic
1192261348 X:69507305-69507327 AGCGGGTTCCCTAGGGATTGGGG + Intronic
1192781535 X:74298311-74298333 AAAAGGTTACCTGGGCATGGTGG + Intergenic
1193795948 X:85873605-85873627 AGTAGGTTACCTAGGGCTGAAGG + Intronic
1195929029 X:110054761-110054783 ATCAGCTTACCCAGGGCTGTTGG + Intronic
1196079600 X:111617453-111617475 ATCAGGTAAAGAAGGGATGGGGG - Intergenic