ID: 1098039564

View in Genome Browser
Species Human (GRCh38)
Location 12:66340524-66340546
Sequence AGGATATATGTGGATATAAA AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 1699
Summary {0: 1, 1: 3, 2: 51, 3: 472, 4: 1172}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1098039561_1098039564 -4 Left 1098039561 12:66340505-66340527 CCAGAGGGATGGAACCAATAGGA 0: 1
1: 2
2: 50
3: 359
4: 974
Right 1098039564 12:66340524-66340546 AGGATATATGTGGATATAAAAGG 0: 1
1: 3
2: 51
3: 472
4: 1172

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1098039564 Original CRISPR AGGATATATGTGGATATAAA AGG Exonic
900819926 1:4878857-4878879 AGGATAGATGTACATATGAAGGG - Intergenic
901418731 1:9135832-9135854 AGGATAGATGTAAATATAAAGGG + Intergenic
902108614 1:14059145-14059167 AGGATATATGCATATATGAAAGG + Intergenic
902843592 1:19092110-19092132 AAGATAGATGTGGCTACAAAAGG + Intronic
902868692 1:19298757-19298779 AGGATATATGTACATAAGAAAGG - Intergenic
902931079 1:19731944-19731966 AGGAAAACTGGGGATATAAATGG + Intronic
904178851 1:28651482-28651504 AGGACATATGTATATATGAAAGG + Intergenic
904394730 1:30212094-30212116 AGGATAGATGTATATATGAAGGG - Intergenic
904395853 1:30221428-30221450 AGGATAGATGTGTATATGAAAGG + Intergenic
904578114 1:31518860-31518882 AGGATATATATATATATATAAGG - Intergenic
905536087 1:38722935-38722957 AGGATAGATGTATATATGAATGG + Intergenic
905757159 1:40520398-40520420 AGGATAGATGTATATATGAAGGG - Intergenic
905903201 1:41595948-41595970 AGGATAGATGTATACATAAAGGG - Intronic
906050835 1:42870188-42870210 AGGATAGATGTATATATAAAGGG - Intergenic
906397127 1:45476099-45476121 AGGATATATGTATATATGAAAGG - Intronic
906578497 1:46913566-46913588 AGGATAGATGTATACATAAAGGG + Intergenic
906865216 1:49410979-49411001 AGGATATATGTATATATGCAAGG + Intronic
906878128 1:49559899-49559921 AGGATACATGTATATATGAAAGG - Intronic
906908517 1:49921457-49921479 AGGATATATGTATATTTGAAAGG + Intronic
907022733 1:51085284-51085306 AAGATATATGAGAATACAAATGG - Intergenic
907618596 1:55951564-55951586 AGGATAGAGGTATATATAAAGGG - Intergenic
908039040 1:60087352-60087374 AGGATAGATGTATATATGAAAGG - Intergenic
908326387 1:63027947-63027969 AGGATAGATGTATATATAAAGGG - Intergenic
909032495 1:70559159-70559181 AGGATATATGTATATATGAAGGG + Intergenic
909172256 1:72312427-72312449 AGGATATATATATATATATATGG - Intergenic
909190093 1:72540134-72540156 GGGATATATGTATATATGAAAGG + Intergenic
909215272 1:72878619-72878641 AGGATATATGTATATAGGAATGG - Intergenic
909237088 1:73166668-73166690 AGGATAGATGTATATATGAAAGG + Intergenic
909265567 1:73553595-73553617 AGGATATATGTATATATGAAAGG - Intergenic
910030046 1:82708832-82708854 AGCAGAAATATGGATATAAAAGG - Intergenic
910429243 1:87144836-87144858 AGGATACATGTATATATGAAAGG - Intronic
910630570 1:89349142-89349164 AGGATACATGTATATATGAAAGG - Intergenic
910725132 1:90329578-90329600 AGTATAGATGTATATATAAAGGG - Intergenic
910791460 1:91055372-91055394 AGGATAGATGTATATATAAAGGG + Intergenic
910988562 1:93030462-93030484 AATATATAAGTGGATAAAAATGG - Intergenic
911291892 1:96066324-96066346 AGGATATATGTATACATGAAAGG - Intergenic
911343488 1:96668691-96668713 AGGATAGACGTATATATAAAGGG - Intergenic
911642931 1:100308123-100308145 AGGATATATGTATATATGAAAGG + Intergenic
911685821 1:100775855-100775877 AGGATATATGTATACATGAAAGG - Intergenic
911807041 1:102223292-102223314 AGGATATGTGAGTATATGAAGGG - Intergenic
911889634 1:103351721-103351743 AGGAAAGATGTATATATAAAGGG + Intergenic
911970292 1:104426217-104426239 AGGATAAATGTATATATGAAGGG - Intergenic
911978535 1:104534874-104534896 AGGATAGACGTATATATAAAAGG - Intergenic
912077100 1:105888652-105888674 AAGATGTATATGTATATAAAAGG - Intergenic
912109097 1:106318165-106318187 AGGATAGATGTATATATAAAGGG + Intergenic
912222400 1:107693265-107693287 AGGATGTGCATGGATATAAAGGG - Intronic
912248535 1:107987393-107987415 AGGATATATGTACATATGAAAGG + Intergenic
912653438 1:111462991-111463013 AGAATATATGTTTATATATAAGG + Intergenic
913039054 1:115005323-115005345 AGGATAGATGTATATATAAAGGG + Intergenic
913242748 1:116843795-116843817 AGGATAGATGTATATATGAAAGG - Intergenic
913308896 1:117465217-117465239 AGTAAATGTGTGGAAATAAAAGG + Intronic
913549904 1:119907300-119907322 AGGATATATGCATATATGAAAGG - Intergenic
913595817 1:120375388-120375410 AGAATAGATGTACATATAAAAGG - Intergenic
913708633 1:121455539-121455561 AGGATATATGTATATATAAAAGG - Intergenic
914091458 1:144503588-144503610 AGAATAGATGTACATATAAAAGG + Intergenic
914307142 1:146430587-146430609 AGAATAGATGTACATATAAAAGG - Intergenic
914594964 1:149142524-149142546 AGAATAGATGTACATATAAAAGG + Intergenic
915023055 1:152799314-152799336 AGGATATATGTATATATGAAAGG + Intronic
917288527 1:173446958-173446980 AGGATAGATGTATATATGAAGGG - Intergenic
917554742 1:176072235-176072257 AGCAAATATGTGGACATATATGG + Intronic
917764284 1:178200107-178200129 AGGACAGATGTATATATAAAGGG - Intronic
917791193 1:178500017-178500039 AGGATAGATGTATATATAAAGGG - Intergenic
918032446 1:180828232-180828254 AATATAAATATGGATATAAATGG - Intronic
918160803 1:181897560-181897582 AGGATATATGTATATACGAAAGG + Intergenic
918236345 1:182583968-182583990 AGGACATATGTATATATGAAAGG - Intronic
918556862 1:185812162-185812184 AAGATATAAGTGATTATAAAAGG + Intronic
918714828 1:187772767-187772789 AGGATAGATGTATATACAAAAGG + Intergenic
918783132 1:188729765-188729787 AGGATAGGTGTATATATAAAGGG + Intergenic
918796600 1:188905953-188905975 AGAATAAATGTATATATAAAAGG - Intergenic
918847543 1:189637680-189637702 ATGATAGATGTATATATAAAGGG - Intergenic
918887285 1:190211298-190211320 AGGATATATGAATATATTAAAGG - Intronic
918929276 1:190833272-190833294 TGGATATATTTGGATATACTTGG + Intergenic
919316883 1:195981997-195982019 AGGATATATGTGTATATGAAGGG - Intergenic
920452573 1:206070980-206071002 AAGATATACGTATATATAAAGGG + Intronic
920926982 1:210351002-210351024 AGGCTACATATAGATATAAAAGG + Intronic
921473661 1:215579234-215579256 ATGATAAATCTGGATAAAAAAGG - Intronic
922057060 1:222051395-222051417 AGGATAGATATACATATAAAGGG - Intergenic
922085046 1:222338497-222338519 AGGGTGTGGGTGGATATAAAGGG - Intergenic
922156866 1:223047431-223047453 AGGATATATGTATATATGAAAGG + Intergenic
922388103 1:225108412-225108434 AGGATAGATGTATATATGAAAGG - Intronic
922484833 1:225965622-225965644 AGGATGTATGTATATATGAAAGG - Intergenic
922494543 1:226046321-226046343 AGGATAGATGTATATATGAAAGG + Intergenic
922546277 1:226459663-226459685 AGGATAGATGTATATATGAAGGG - Intergenic
922636942 1:227183127-227183149 AGGATATATGTATATATAAAAGG - Intronic
922916838 1:229264711-229264733 AGGATACATGTATATATGAAAGG - Intergenic
923081735 1:230663596-230663618 GGGATATAAGTGGATAAAACAGG - Intronic
923359580 1:233197539-233197561 AGGATAAATGTGGTAACAAACGG + Intronic
923799953 1:237199193-237199215 AGGATAGATGTATATATGAAGGG + Intronic
923824437 1:237484269-237484291 AAGATGTATGTGGATTTAGATGG - Intronic
923839531 1:237653602-237653624 AGGATAGATGTATATATGAAGGG + Intronic
924306868 1:242698542-242698564 AGGATAGATGTATATATGAAGGG + Intergenic
1062770912 10:99989-100011 AGGATAGATGTAGATAGAAAGGG + Intergenic
1063149291 10:3322087-3322109 AGGATAGATGTATATATGAAGGG - Intergenic
1063252581 10:4289442-4289464 TGGATATATGTGGGAATGAATGG + Intergenic
1063457773 10:6196363-6196385 AGGATAGATGTATATATAAGGGG + Intronic
1063724129 10:8618062-8618084 TGGTTATACGTGGGTATAAAAGG - Intergenic
1063785769 10:9380933-9380955 AGGATACATGTATATATAAGAGG - Intergenic
1063804526 10:9623262-9623284 AGGATACATGTATATATGAAAGG + Intergenic
1064325773 10:14349884-14349906 AGGCTAGATGTAGATATAAAGGG + Intronic
1064338663 10:14467318-14467340 AGGCTATAAGTGAATATAGAAGG + Intergenic
1064402395 10:15032377-15032399 AGGATAGATGTATGTATAAAGGG - Intronic
1064679962 10:17800942-17800964 AGGATAGATGTATATATGAAAGG + Intergenic
1065155891 10:22869791-22869813 AGGATAGATGTATATATGAAGGG - Intergenic
1065173734 10:23056968-23056990 AGGATACATGTATATATGAAGGG + Intergenic
1065281684 10:24145545-24145567 AGGATAGATGTATATATGAAGGG + Intronic
1065403144 10:25329647-25329669 AGAGTAAATGTGGATATTAAAGG + Intronic
1065608326 10:27444786-27444808 AGGATATATGTATATGTAAAAGG + Intergenic
1065612043 10:27481669-27481691 AGGATATATGTATGTATGAAAGG + Intergenic
1065762872 10:28999403-28999425 AGGATAGATGTATATATAAAGGG + Intergenic
1065778954 10:29148984-29149006 AGGAGATATGGGAATATACAGGG - Intergenic
1065809489 10:29428276-29428298 AGAATATATGTATATATAAAAGG + Intergenic
1065835343 10:29652595-29652617 TGGATATATTGGGTTATAAAAGG + Intronic
1067072592 10:43146069-43146091 AGGATATATGTATATATGAAAGG + Intronic
1068090508 10:52427398-52427420 AGGATAGATGTATATATGAAGGG - Intergenic
1068359779 10:55962355-55962377 AGGCTAGATGTATATATAAAGGG + Intergenic
1068406399 10:56595234-56595256 AGGATAGATGTATATATAAAAGG + Intergenic
1068488627 10:57693314-57693336 TAGATATATATGGATATATATGG + Intergenic
1068488658 10:57693617-57693639 TGGATATATATGGATATATATGG + Intergenic
1068503397 10:57868533-57868555 TGGGTATATATGGATATATATGG + Intergenic
1068543419 10:58321221-58321243 AGGATATATGTATATATAAAAGG - Intergenic
1068837714 10:61572289-61572311 AGGATAGATGTATATATGAAAGG - Intergenic
1068937495 10:62650154-62650176 AGGATACGTGTTTATATAAAAGG - Intronic
1069096267 10:64263400-64263422 AGTATAGATGTATATATAAAGGG + Intergenic
1069108297 10:64410741-64410763 AGGATATATGTATGTATGAAAGG + Intergenic
1069163547 10:65119673-65119695 AGGATATATGTATACATGAAAGG - Intergenic
1069257966 10:66358340-66358362 AGGAAATATGGGGAAAAAAAGGG + Intronic
1069817327 10:71206737-71206759 AGGATATATGTATGTATATAGGG - Intergenic
1070315778 10:75311026-75311048 AGGATAGATGTATATATAAAGGG + Intergenic
1071032746 10:81204490-81204512 AGGATAGATGTGTATATGAAAGG - Intergenic
1071033113 10:81207689-81207711 AAGATAGATGTATATATAAAAGG - Intergenic
1071109496 10:82138546-82138568 AGGATACATGTATATATGAAAGG + Intronic
1071308872 10:84324958-84324980 AGGATAGATGTATATATGAAAGG - Intergenic
1071838498 10:89444326-89444348 TATATATATGTGTATATAAAAGG + Intronic
1071853819 10:89602999-89603021 AGGATATATATAGATAAAATTGG - Intronic
1071934638 10:90514887-90514909 TGGATATATGTGGGGAGAAATGG - Intergenic
1072253398 10:93599728-93599750 AGGATAAATGGGGAAAAAAATGG + Intronic
1072590102 10:96821106-96821128 AGGATATATGTATATATGAAAGG - Intergenic
1073573445 10:104600385-104600407 AGGATAAATGTGCAGATCAAAGG + Intergenic
1073675682 10:105644653-105644675 AGGATATATGTATATATGAAAGG - Intergenic
1073735154 10:106336711-106336733 AGGATATATGTATCTATGAAAGG + Intergenic
1073909840 10:108328918-108328940 AGGATATATGTATATATAAAAGG - Intergenic
1073951129 10:108811239-108811261 AGGATATATGTATATGTGAAAGG + Intergenic
1073957392 10:108889315-108889337 AGGATATATGTATATATGAAAGG + Intergenic
1073981723 10:109161681-109161703 ATGATAGATGTATATATAAAGGG - Intergenic
1074034097 10:109720384-109720406 AGGATAGATGTATATATAAAGGG - Intergenic
1074133958 10:110610774-110610796 AGGATAGATGTATATATGAAGGG + Intergenic
1074184888 10:111092614-111092636 AGGATATATGTCTGTATGAAAGG + Intergenic
1074531194 10:114300099-114300121 AGGATAGATGTATATATGAAAGG - Intronic
1074602734 10:114931666-114931688 AGGATAGATGTATATATAAAGGG - Intergenic
1074872849 10:117590663-117590685 AGGATAGATGTATATATGAAAGG + Intergenic
1075281110 10:121139168-121139190 AGGATGTATGTGGATCTGAGAGG - Intergenic
1075573944 10:123564922-123564944 AGGATAGATGTATATATAAAGGG + Intergenic
1075902091 10:126051393-126051415 TGGATAGATGGGTATATAAATGG - Intronic
1076276127 10:129200222-129200244 AGGATAGATGTACATATGAAGGG + Intergenic
1076498764 10:130917665-130917687 TGGATATATGTTTATATACATGG - Intergenic
1076940434 10:133603127-133603149 AGGATCTATGTATATATGAAAGG - Intergenic
1077951125 11:6958603-6958625 AGGATAAATGTATATATAAAGGG + Intronic
1078044758 11:7903619-7903641 AGGAGAAATGAGGAAATAAAGGG - Intergenic
1078504485 11:11923543-11923565 AGAATATATGTGGAAAAAAATGG - Intronic
1078582069 11:12546457-12546479 AGGATATATGTATATAAGAAAGG - Intergenic
1078925164 11:15868329-15868351 AGGATATATGTATATATGAAAGG + Intergenic
1078949982 11:16119565-16119587 AGGATATATAGAAATATAAATGG - Intronic
1079210866 11:18459554-18459576 AGGATAGATGTCGATATGAAAGG - Intronic
1079447106 11:20567847-20567869 AGGATAGATGTATATATGAAGGG + Intergenic
1079748267 11:24160534-24160556 AGGATATATGTTTATATGAAAGG - Intergenic
1079762021 11:24341024-24341046 AGGATAGATGTATATATGAAGGG + Intergenic
1079792027 11:24749980-24750002 AGGATACATGTATATATGAAAGG - Intronic
1079871280 11:25801370-25801392 AGGATAGATGTACATATGAAAGG + Intergenic
1079908539 11:26280329-26280351 AGGATAGATGTATATGTAAAGGG + Intergenic
1079990894 11:27245894-27245916 AGGATAGATATATATATAAAGGG + Intergenic
1080098963 11:28437280-28437302 AGGATATATGTAGATATGAAAGG - Intergenic
1080186344 11:29491607-29491629 AGGATAGATGTGTATATAAAGGG - Intergenic
1080224576 11:29945849-29945871 AGGATATATGTATATATGAAAGG - Intergenic
1080224856 11:29949436-29949458 AGGGTAAATTTGAATATAAAAGG + Intergenic
1080589085 11:33705742-33705764 AGGATATATGTATATATGAAAGG - Intronic
1080959522 11:37142030-37142052 AGAATAGATGTGTCTATAAAGGG - Intergenic
1081001957 11:37685257-37685279 AGGATTTATTTGGATATTTAGGG - Intergenic
1081057240 11:38425066-38425088 AGGATAGATGTATATATGAAAGG - Intergenic
1081077094 11:38690782-38690804 AGGATATATGCATGTATAAAGGG - Intergenic
1081105988 11:39070509-39070531 AGGATAGATGTATATATAAAAGG + Intergenic
1081202836 11:40238819-40238841 AGGAGGTATGTTTATATAAAAGG + Intronic
1081291069 11:41326471-41326493 AGGATAGATGTATATATGAAGGG - Intronic
1081323574 11:41719145-41719167 AGGATAGATGTGTATATGAAAGG - Intergenic
1081928745 11:46852975-46852997 AATATATATATGTATATAAAAGG + Intergenic
1082778322 11:57265554-57265576 AGGATGTATGTTGATATTAGTGG + Intergenic
1082918810 11:58469457-58469479 AGGATAGATGTAAATATGAAAGG + Intergenic
1082985442 11:59165879-59165901 AGTATTTATGTGGAAATCAAAGG + Intergenic
1083092620 11:60216906-60216928 AGGATAGATGTATACATAAAGGG - Intronic
1083244144 11:61412777-61412799 ATGTTATATGTTGATATAATAGG + Intronic
1083914916 11:65735657-65735679 AGGATAGATGTATATATGAAGGG - Intergenic
1085247652 11:75116581-75116603 AGGATATATGTACATATGAAGGG - Intronic
1085882548 11:80484935-80484957 AGGATATATGTATATATGAAAGG + Intergenic
1085986756 11:81797106-81797128 GGGATAGATGTATATATAAAGGG + Intergenic
1086023096 11:82256028-82256050 AGGATATATGTGTATAAATATGG + Intergenic
1086054916 11:82635244-82635266 AGGAGATGTGTATATATAAATGG - Intergenic
1086209753 11:84305283-84305305 AGAATAAATTTGGATTTAAATGG + Intronic
1086549232 11:88035431-88035453 AGGATAGATGTATACATAAAGGG + Intergenic
1086612205 11:88771222-88771244 AGGATATATGTATATATGAAAGG + Intronic
1086763248 11:90660597-90660619 AGGATAGATGTATATATAGAGGG + Intergenic
1086833700 11:91597059-91597081 AGGATAGAGGTATATATAAAGGG - Intergenic
1087029467 11:93688240-93688262 AGGATATATGAGCATGTTAATGG + Intronic
1087029536 11:93689073-93689095 AGGATGTAGGTGGAAAGAAATGG - Intronic
1087037719 11:93771793-93771815 AGGATAGATGTATATATGAAGGG - Intronic
1087100319 11:94357446-94357468 AGGATATATGCATATATAAAAGG - Intergenic
1087366974 11:97232260-97232282 AGGATAGATGTACATATGAAGGG - Intergenic
1087408125 11:97754793-97754815 AGGATATATGTGTATATGAAAGG + Intergenic
1087429937 11:98041018-98041040 AGGATGTATGTATATATGAAAGG + Intergenic
1087448950 11:98292998-98293020 AGGATATAGGTATATATAAAAGG - Intergenic
1087567979 11:99887495-99887517 AGGATAGATGTATATATGAAGGG + Intronic
1087827947 11:102787562-102787584 AGTATATGTGTGTATATAAATGG + Intergenic
1087938620 11:104065256-104065278 AGGATAGATGTATATATAAAGGG - Intronic
1088031639 11:105258408-105258430 AGGATAGATGTATATATGAAGGG - Intergenic
1088102659 11:106172131-106172153 AGGATAGATGTATATATGAAGGG - Intergenic
1088142833 11:106637962-106637984 AGGATATATGTGTGTATATATGG + Intergenic
1088147761 11:106703263-106703285 AGGATAGATGTATGTATAAAGGG - Intronic
1088156322 11:106808087-106808109 AGGATAGATGTATATATGAAAGG - Intronic
1088205834 11:107391223-107391245 AGGATAGATGTATATATGAAGGG - Intronic
1088449694 11:109968190-109968212 AGGATAGATGTGTATATGAAAGG - Intergenic
1088779316 11:113119103-113119125 AGGATAAAAAAGGATATAAAAGG + Intronic
1088857053 11:113765495-113765517 AGGTTATAGCTGGAGATAAAGGG - Intronic
1089371001 11:117957517-117957539 AGGATAGATGTATATATGAAGGG + Intergenic
1089923810 11:122236222-122236244 AGGATATATATGTATAAAATAGG - Intergenic
1090196920 11:124824497-124824519 AGGATGTATGTATATATGAAGGG + Intergenic
1090503510 11:127285031-127285053 GGGTTATATTTGGATAGAAAAGG + Intergenic
1090570009 11:128035615-128035637 AGGATAGATGTATACATAAAGGG - Intergenic
1091071766 11:132571379-132571401 AGGATATATGTGTATATGAAAGG - Intronic
1091503227 12:1039546-1039568 AAGAAATATTTGGATATAGACGG + Intronic
1092017952 12:5175148-5175170 AGGATATATGTATATAGGAAGGG + Intergenic
1092370167 12:7910258-7910280 AGGATAGATGTATATATAAAAGG - Intergenic
1092467243 12:8744095-8744117 AGCTTATAAATGGATATAAAAGG - Intronic
1092794337 12:12095147-12095169 AGGGTATGTGTGGATGGAAAGGG + Intronic
1092927804 12:13287977-13287999 ACTATATATGTGCATATAGAAGG - Intergenic
1093037505 12:14346706-14346728 AGGATATATGTACATATGAAAGG - Intergenic
1093222007 12:16432995-16433017 AGGATAGATGTGTATATAAAGGG + Intronic
1093616196 12:21228573-21228595 AGGATATTTGTGGTTATATTGGG - Intronic
1093663510 12:21785102-21785124 AGGATAGATGTATATATAAAGGG + Intergenic
1093964140 12:25307635-25307657 AGGATAAATGTATATATGAAAGG - Intergenic
1094176028 12:27542296-27542318 AGGTTATATGTGAATATGTAAGG + Intronic
1094403224 12:30085325-30085347 AGAATATATGTATATATGAAAGG + Intergenic
1094459141 12:30674797-30674819 AGGATTTATGTGAATAACAAAGG + Intronic
1094515946 12:31126644-31126666 AATATATGTGTGTATATAAATGG - Intergenic
1094523184 12:31214733-31214755 AGGATTGATGTATATATAAAGGG + Intergenic
1094604366 12:31937923-31937945 AGGATAGATGTATATATAAAGGG - Intergenic
1094679170 12:32652347-32652369 AGGATAGATGTATATATGAAGGG - Intergenic
1094706862 12:32922753-32922775 AGGATAGATGTATATATGAAAGG + Intergenic
1094740185 12:33280049-33280071 AGGATAGATGTATATATAAAGGG + Intergenic
1095164235 12:38953050-38953072 AGGATAGATGTATATGTAAAGGG + Intergenic
1095404734 12:41855606-41855628 AGGATAGATGTATATATAAAGGG + Intergenic
1095502946 12:42860434-42860456 AGGATAGATGTATATATGAAGGG + Intergenic
1096457093 12:51796583-51796605 AGGATAGATGTATATATGAAAGG + Intronic
1096662478 12:53135510-53135532 AGGATATACATGTATATCAATGG - Intergenic
1096885114 12:54710085-54710107 AGGCTAGATGTATATATAAAGGG + Intergenic
1096906188 12:54937939-54937961 AGGATATATGAATATATGAAAGG - Intergenic
1096922913 12:55108059-55108081 AGGATAAATGTGTATATGAAGGG - Intergenic
1097058664 12:56266597-56266619 AGGATAAATGTATATATGAAAGG - Intergenic
1097371184 12:58783217-58783239 AGGATATATGTATATATGAAAGG - Intronic
1097529889 12:60785580-60785602 AGAATATATGTACATATGAAAGG + Intergenic
1098039564 12:66340524-66340546 AGGATATATGTGGATATAAAAGG + Exonic
1098613630 12:72494260-72494282 AGGATAGATCTGAACATAAATGG - Intronic
1098715636 12:73826089-73826111 AGGATATATGTATATAAAATAGG - Intergenic
1098774953 12:74600765-74600787 AGGATAGGTGTATATATAAAGGG + Intergenic
1098875640 12:75863987-75864009 AGGATATATATAGATATAAGAGG - Intergenic
1099203269 12:79700028-79700050 AGGATAGATGTATATATGAAGGG + Intergenic
1099242657 12:80156407-80156429 AGGATAGATGTATATATAAACGG - Intergenic
1099282209 12:80664972-80664994 AGGATAGATGTATATATGAAGGG + Intronic
1099400015 12:82192579-82192601 AGGATAGATGTATATACAAAAGG - Intergenic
1099423953 12:82500082-82500104 AGGATAGATGTATATATAAAGGG - Intergenic
1099632392 12:85167278-85167300 AGGATAGATGTATATATAAAGGG + Intronic
1099697742 12:86043194-86043216 ATGATAGATGTATATATAAAAGG + Intronic
1099704815 12:86138467-86138489 AATATATATATGGATATATATGG - Intronic
1099719911 12:86347180-86347202 AGCATATATGTATATATGAAAGG - Intronic
1099728235 12:86462506-86462528 AGGATAGATGTATATATAAAGGG + Intronic
1099735358 12:86561736-86561758 AGGATAGATGTATATATGAAGGG - Intronic
1099821742 12:87719936-87719958 AGGATACATGTGTATGTAAAAGG - Intergenic
1099922016 12:88970392-88970414 AGGATAGATGTACATATCAAAGG - Intergenic
1100063287 12:90608535-90608557 AGGATATATGTATATATGAAAGG + Intergenic
1100074667 12:90765389-90765411 AGGATAGATGTGTATATGCAAGG - Intergenic
1100204292 12:92331271-92331293 AGGATATATGTATATACAAAAGG - Intergenic
1100345003 12:93720777-93720799 AAGACATATGTAGATTTAAATGG - Intronic
1100384811 12:94096001-94096023 AGGATATGTGTATATATGAAAGG + Intergenic
1100569123 12:95830004-95830026 AGGATAGATGTATATTTAAAGGG + Intergenic
1100617088 12:96239220-96239242 TGCATATATGTGTAAATAAAAGG - Intronic
1101081512 12:101190325-101190347 ATGATATATTTGGTTACAAAAGG - Intronic
1101172139 12:102108549-102108571 AGGATAGATGTATATATGAAGGG - Intronic
1101729903 12:107418398-107418420 AGGATAGATGTATATATAAAGGG - Intronic
1101960792 12:109248311-109248333 AGGATATATGTATATATGAAAGG + Intronic
1102088046 12:110160174-110160196 AGGATATAGGTATATATAAAAGG + Intronic
1102322828 12:111952860-111952882 AGGATAGATGTATATATAAAGGG - Intronic
1102395810 12:112584849-112584871 AGGATAGATGTATATATAAAGGG + Intronic
1102497844 12:113331767-113331789 AGGATAGATGTATATGTAAAGGG - Intronic
1102537104 12:113589825-113589847 TGGATAAATGGGTATATAAATGG - Intergenic
1102669926 12:114609503-114609525 AGGATAGATGTATATATAGAGGG - Intergenic
1102717851 12:114989654-114989676 AGGATAAATATGTAGATAAAGGG + Intergenic
1102737459 12:115175402-115175424 AGGATAGATGTATATATGAAGGG + Intergenic
1102763521 12:115410508-115410530 AGGATAGATGTATATAAAAAGGG - Intergenic
1102860411 12:116331324-116331346 AGGATAGATGTATATATAAAGGG + Intergenic
1103148655 12:118617731-118617753 AGGATAGATGTATATATGAAAGG - Intergenic
1103395971 12:120607487-120607509 AGGATAGATGTATATATGAAGGG - Intergenic
1103396909 12:120614300-120614322 AGGATAGATGTATATATGAAGGG - Intergenic
1103610105 12:122118532-122118554 TGGATATCTCTGAATATAAACGG + Intronic
1104133510 12:125916723-125916745 AGGATATATGTACATATGCAAGG - Intergenic
1104243220 12:127011518-127011540 AGTATATATGTTTATAAAAAAGG - Intergenic
1104341158 12:127950233-127950255 AGGATGTAGGTGGATATTGACGG + Intergenic
1105227178 13:18446930-18446952 TGGATTTATGTGGATATGATGGG + Intergenic
1105245148 13:18643299-18643321 AGTGTAAATGTGCATATAAAAGG + Intergenic
1105276167 13:18929007-18929029 AGGATAGATGTAGATATGAAAGG + Intergenic
1105515302 13:21084333-21084355 AGGATAAATGTATATATACAGGG + Intergenic
1105670210 13:22605276-22605298 AGGATAGAGGTATATATAAAGGG + Intergenic
1105752863 13:23437522-23437544 AGGATAGATGTATATATAAAAGG - Intergenic
1106146137 13:27051513-27051535 ATCATATATATGGATATATATGG + Intergenic
1106363086 13:29050457-29050479 AGGAGATATGAGGAGACAAAAGG - Intronic
1106365864 13:29080406-29080428 AGGATAGATGGATATATAAAGGG + Intronic
1106899727 13:34342539-34342561 AGGATATATGTATATACAAAAGG + Intergenic
1106911308 13:34466088-34466110 AGGATAGATGTATATATGAAGGG - Intergenic
1107236513 13:38177007-38177029 AGGATATATGTATATATAGAAGG - Intergenic
1107385559 13:39904772-39904794 AGGATATTTGTATATATGAAGGG + Intergenic
1107638165 13:42414273-42414295 AGGATATATGTATATATGAAAGG + Intergenic
1107682548 13:42866633-42866655 AGGATAGATGTATATATGAAGGG - Intergenic
1108031073 13:46230336-46230358 AGGATATATGTATATATGAAAGG + Intronic
1108098061 13:46925265-46925287 AGGATAGATGTATATATGAAGGG - Intergenic
1108183960 13:47870232-47870254 AGGATATAGGTATATATAAAAGG - Intergenic
1108735354 13:53278239-53278261 AGGATAGATGTGTATATAAAGGG + Intergenic
1108815939 13:54290184-54290206 AGGATATATGTGTATATGAAAGG + Intergenic
1108882856 13:55142441-55142463 ACGATATATGTATATATAAGAGG - Intergenic
1109045682 13:57407810-57407832 AGGATAGATGTATATATAAAGGG - Intergenic
1109048232 13:57440517-57440539 AGGATAGGTGTATATATAAAGGG - Intergenic
1109241861 13:59899269-59899291 AGGATAGATGTATATATGAAAGG - Intronic
1109379683 13:61543272-61543294 AGGATACATGTATATATAAAGGG - Intergenic
1109565128 13:64103107-64103129 AGGATATATGTATATATGATGGG - Intergenic
1109593413 13:64517320-64517342 GATATATATGTGGATATATATGG - Intergenic
1109620347 13:64896279-64896301 AGGATATATGTATATATGAAAGG - Intergenic
1109795358 13:67305110-67305132 AGGATATATGTCCACATATATGG + Intergenic
1109797508 13:67335860-67335882 AGGATAGATATTTATATAAAGGG - Intergenic
1109860495 13:68191419-68191441 AGGATATATGTATATATGAAAGG - Intergenic
1109886092 13:68547244-68547266 AAGATATATGTGTATATGAAGGG + Intergenic
1109981535 13:69914197-69914219 AGGATAGATGTATATATAAAGGG - Intronic
1110010952 13:70332449-70332471 AGAATATACGTACATATAAAAGG - Intergenic
1110110210 13:71735636-71735658 GGGATATACGTGTATATATATGG + Intronic
1110142679 13:72150084-72150106 AGAATATGTGTTGATATATAAGG + Intergenic
1110326074 13:74217052-74217074 TAGATATGTGTGTATATAAAAGG - Intergenic
1110409495 13:75188709-75188731 AGGATATATGTATATATGAAAGG + Intergenic
1110467051 13:75814094-75814116 AGGACATATATGAATATAGATGG - Intronic
1110502560 13:76245442-76245464 AGAACAGATGTAGATATAAAGGG - Intergenic
1110581361 13:77133093-77133115 AGGATAAATATAGTTATAAAAGG - Intronic
1110613344 13:77513775-77513797 AGGATATATGTATATATGAAAGG + Intergenic
1110634637 13:77752515-77752537 AGGATAAATGTATATATGAAGGG + Intronic
1110681253 13:78314893-78314915 AACATATATGTAAATATAAATGG + Intergenic
1110760132 13:79222244-79222266 AGGATAGATGTATATATGAAAGG + Intergenic
1110816069 13:79861135-79861157 AGGATATATGTATACATAACAGG - Intergenic
1110825565 13:79967737-79967759 AGGATAGATATGTATATAAAGGG - Intergenic
1110882423 13:80588358-80588380 AGGATATATGTACATATGAAAGG - Intergenic
1111028373 13:82565053-82565075 AGGATATATGTATATATTAAAGG + Intergenic
1111086472 13:83381264-83381286 AGGATAGATGTGTATATAAAGGG + Intergenic
1111182453 13:84686860-84686882 AGGATATATGTATATATGAAAGG - Intergenic
1111261726 13:85749383-85749405 AGGATTTATGTATATATGAAAGG + Intergenic
1111271761 13:85895885-85895907 AGGATAGATGTATATATGAAAGG - Intergenic
1111294545 13:86261902-86261924 AGGATAAATGTGTATATAAATGG - Intergenic
1111300564 13:86343869-86343891 AGAATAAATGTACATATAAAGGG - Intergenic
1111317846 13:86584649-86584671 AGGATAGATGTATATATAAAGGG - Intergenic
1111346785 13:86967255-86967277 AGCATATATGTATAAATAAAGGG - Intergenic
1111376465 13:87385192-87385214 AGGATATAGATCTATATAAACGG - Intergenic
1111391387 13:87600033-87600055 AGGATATATGTGTAAGTGAAAGG - Intergenic
1111414647 13:87923306-87923328 AGGATAGATGTATATATAAAGGG - Intergenic
1111443099 13:88305905-88305927 AGGATATATGTAGATAAATCAGG + Intergenic
1111558653 13:89914140-89914162 AGGATATATGTATATATGAAAGG + Intergenic
1111679521 13:91426402-91426424 AGGAGAGATGTATATATAAAAGG + Intronic
1111741385 13:92209789-92209811 AGGATAGATATATATATAAAGGG + Intronic
1111786192 13:92789765-92789787 AGGATAGATGTATATATGAAAGG + Intronic
1111861835 13:93717493-93717515 TGAATATATGTGGATAAAAATGG + Intronic
1111906851 13:94265216-94265238 AGGATAGATGTATATATAAAGGG + Intronic
1111977576 13:94982977-94982999 AGGATAGATGTATATATAAAGGG - Intergenic
1112109857 13:96284221-96284243 AGGATAGATGTATATATGAAGGG + Intronic
1112183448 13:97106993-97107015 AGGATAGCTGTATATATAAAGGG + Intergenic
1112206072 13:97324583-97324605 AGGATAGATGTATATATGAAGGG + Intronic
1112228242 13:97562220-97562242 AGGATAGATGTATATATAAGAGG - Intergenic
1112245097 13:97726210-97726232 AGGATAAATGTATATATAAAGGG + Intergenic
1112286923 13:98112546-98112568 AGGATGTATGTATATATAAAGGG + Intergenic
1112742127 13:102486839-102486861 AGGATAAATGTGTATATGAAGGG - Intergenic
1112817198 13:103286817-103286839 AGGATGTATGTGAATATAACAGG + Intergenic
1113090170 13:106609773-106609795 AGGGAATATGTGCACATAAATGG - Intergenic
1113140768 13:107146750-107146772 AGGATAGATGTATACATAAAGGG - Intergenic
1113267229 13:108633216-108633238 AAGATAGATGTATATATAAAGGG + Intronic
1113519189 13:110926659-110926681 AGGATAGATGTACATATAAAAGG - Intergenic
1113998808 14:16124323-16124345 AGGAAATATATTCATATAAAAGG - Intergenic
1114174326 14:20306068-20306090 AGCATCTCTGTGGAAATAAATGG - Intergenic
1114370394 14:22080624-22080646 AGGAGATATGTGTATATATAGGG + Intergenic
1114872114 14:26671386-26671408 AGGATATCTTTGGAGAGAAATGG - Intergenic
1115131045 14:30052116-30052138 AGGATATATGTATATAAAAAGGG - Intronic
1115143472 14:30199882-30199904 AGGATATATGTATATATGAAAGG - Intergenic
1115161362 14:30399337-30399359 AGGATACATGTATATACAAAAGG + Intergenic
1115391694 14:32861286-32861308 AGGATATATGTATATATGAAAGG - Intergenic
1115613821 14:35074117-35074139 AGAATATATGTATATATGAAAGG + Intronic
1115817325 14:37177338-37177360 AGGAAATATGTGGGGAAAAAAGG - Intergenic
1116068430 14:40011972-40011994 AGGATAGATGTATATATGAAGGG - Intergenic
1116103031 14:40465751-40465773 AGGGTATATGTGGGTAAGAATGG + Intergenic
1116106907 14:40520043-40520065 AGCATATATGTATATATAAAAGG - Intergenic
1116127893 14:40812882-40812904 AGGATATATGTATAAATTAAAGG + Intergenic
1116184070 14:41574180-41574202 AGAGTATAGGTGTATATAAATGG - Intergenic
1116245493 14:42406553-42406575 AGGATATATGCATATATGAAAGG + Intergenic
1116266099 14:42692483-42692505 AGGATATATGTATGTATAAAGGG + Intergenic
1116269475 14:42742679-42742701 AGGATAGATGTATACATAAAGGG + Intergenic
1116278033 14:42862000-42862022 AGGATAGATGTATATATGAAAGG + Intergenic
1116290503 14:43030619-43030641 AGGATATATATATATATAAAGGG - Intergenic
1116307821 14:43281415-43281437 AGGATATACGTATATATAAAAGG + Intergenic
1116327343 14:43547457-43547479 AGGATAGATGTATATATGAAGGG + Intergenic
1116333735 14:43630302-43630324 AGGATATATGTATATATGAGAGG + Intergenic
1116388136 14:44358338-44358360 AGGATATATGTATATATGAAAGG + Intergenic
1116458945 14:45148435-45148457 ATCATATATGTTGATTTAAATGG + Intronic
1116508088 14:45709969-45709991 AGGATATATATATATATGAAAGG - Intergenic
1116540183 14:46092972-46092994 TGGATATATGAGGAAAAAAATGG + Intergenic
1116551757 14:46249064-46249086 AGGATATCTGTGCATATAGAAGG + Intergenic
1116606529 14:47004376-47004398 CATATATATGTGGATATATATGG - Intronic
1116661903 14:47721168-47721190 AGGATATATGTATACATGAAAGG + Intergenic
1116662948 14:47735560-47735582 AGGATGTTTGTGGTTATACAGGG - Intergenic
1116754535 14:48929503-48929525 AGAATAGATGTATATATAAAGGG - Intergenic
1116901469 14:50366087-50366109 AGGATAGATGTATATATGAAGGG - Intronic
1117048662 14:51838674-51838696 ACGATAGATGTATATATAAACGG - Intronic
1117535391 14:56698014-56698036 GGGATATATGTATATATGAAGGG + Intronic
1117543055 14:56767475-56767497 GGGGTGTATGTTGATATAAATGG - Intergenic
1117572158 14:57058241-57058263 AGGAAAAATGTGGATCAAAAGGG - Intergenic
1117645082 14:57843214-57843236 AGGATAGATGTATATATGAAAGG - Intronic
1117808646 14:59521494-59521516 AGGATATATGTATATATGAAAGG - Intronic
1117811342 14:59550552-59550574 AGGATAGATGTATACATAAAGGG + Intronic
1117961414 14:61166234-61166256 AGGATAGATGCATATATAAAGGG - Intergenic
1118052121 14:62040927-62040949 AGGATAGATGTATATATAAAGGG + Intronic
1118053603 14:62055761-62055783 AGGATGGATGTATATATAAAGGG + Intronic
1118216608 14:63814668-63814690 TGGATATATATGGATATATATGG - Intergenic
1118216611 14:63814700-63814722 TGGATATATATGGATATATATGG - Intergenic
1118216618 14:63814778-63814800 TGGATATATATGGATATATATGG - Intergenic
1118216619 14:63814788-63814810 TGGATATATATGGATATATATGG - Intergenic
1118216624 14:63814844-63814866 GAGATATATATGGATATATATGG - Intergenic
1118216633 14:63814950-63814972 TAGATATATATGGATATATATGG - Intergenic
1118216646 14:63815114-63815136 GATATATATGTGGATATATATGG - Intergenic
1118216649 14:63815158-63815180 GATATATATGTGGATATATATGG - Intergenic
1119015660 14:71051205-71051227 AATATAGGTGTGGATATAAAAGG - Intronic
1119052747 14:71386155-71386177 AGGATAGATGTATATATAAAGGG + Intronic
1119475914 14:74928305-74928327 AGAATATATATGGATATTTATGG + Intergenic
1119676844 14:76562236-76562258 AGGATAGATGTATATATGAAGGG - Intergenic
1120029107 14:79620120-79620142 AGAAGAAATGTGGATATATATGG + Intronic
1120100910 14:80444886-80444908 AGGATATATGTATATATGAAGGG + Intergenic
1120187223 14:81406245-81406267 AGGATAGATGTATATATGAAGGG - Intronic
1120275806 14:82371020-82371042 AGGATAAATGTATATATAAAGGG - Intergenic
1120356341 14:83439022-83439044 AGGATAGATGTATATATGAAGGG - Intergenic
1120423133 14:84313803-84313825 AGGATAGATGTATATATGAAAGG - Intergenic
1120626081 14:86827981-86828003 AGGATAGATGTATATATAAAAGG - Intergenic
1120655930 14:87189878-87189900 AGGATAGATGTATATATGAAAGG - Intergenic
1120676872 14:87430897-87430919 AGGACAGATGTGTATATAACAGG - Intergenic
1120760905 14:88284361-88284383 AGGATAGATGTACATATGAAAGG + Intronic
1120821726 14:88917587-88917609 AGGATAGATGTATATATGAAGGG - Intergenic
1120924819 14:89787400-89787422 AGGATATATGTATATACGAAAGG - Intergenic
1121401529 14:93682124-93682146 AGGATACATGTGGATGAATAGGG + Intronic
1122170232 14:99867173-99867195 AGGACAGATGTGCAGATAAATGG - Intronic
1123227899 15:17064774-17064796 AGGAAATATATTTATATAAAAGG + Intergenic
1123795843 15:23769130-23769152 AGGATAGATGTATATATAAAGGG + Intergenic
1123917454 15:25047096-25047118 AGGATAGATGTATATATAAAAGG - Intergenic
1124065651 15:26341256-26341278 AGGATAGATGTATACATAAAGGG + Intergenic
1124098515 15:26671159-26671181 AGGACATTTTTGGAAATAAAAGG - Intronic
1124217862 15:27824475-27824497 AGGAGATCTGCTGATATAAAGGG + Intronic
1124711572 15:32016923-32016945 AGGATAGATGTATATATGAAGGG - Intergenic
1124936916 15:34181820-34181842 TGTATATATATGGATATATATGG - Intronic
1125210064 15:37204071-37204093 AGAATATAGGTGAATAGAAATGG - Intergenic
1125339632 15:38661897-38661919 AATAAATATGTGGATATATATGG - Intergenic
1125451515 15:39812653-39812675 AGGATAGATGTATATATGAAGGG - Intronic
1126283947 15:46989040-46989062 AGGATAGATGTATATATAAAGGG - Intergenic
1126506581 15:49411331-49411353 AGAATATATTTTGATTTAAAAGG - Intronic
1126681457 15:51206128-51206150 AGGGTATATGTGGATAGGGAAGG + Intergenic
1127008758 15:54599473-54599495 ATGCTATTTGTGGATAAAAATGG + Intronic
1127020793 15:54746113-54746135 AGGATATATGTATATACGAAAGG - Intergenic
1127921920 15:63501329-63501351 AGGATAATTGTGTATATACATGG - Intergenic
1128013869 15:64324706-64324728 AGAATATATGTATATATGAAGGG - Intronic
1128434915 15:67637253-67637275 AGGATAGATGTATATATGAAGGG - Intronic
1129921781 15:79325550-79325572 AGGATATATGTATATATGAAAGG + Intronic
1129995866 15:80005659-80005681 AGTATATATGTGTATATATAAGG + Intergenic
1130066430 15:80608677-80608699 AGGTTAGATGTATATATAAAGGG - Intergenic
1130233330 15:82113141-82113163 AGGAAGTATCTGGATCTAAATGG - Intergenic
1130730741 15:86489384-86489406 ATGATATATGTGGAAATACTTGG - Intronic
1130973611 15:88755766-88755788 AGGATAGATGTATATATGAAAGG + Intergenic
1131896539 15:97037409-97037431 AGGATATATGTATATGTGAAGGG - Intergenic
1131897844 15:97053307-97053329 AGGATATATGTATATATGAAAGG + Intergenic
1131901828 15:97095885-97095907 AGGATATAGGTATATATGAATGG - Intergenic
1132303929 15:100794898-100794920 AGGATATATGTATATATGAAAGG + Intergenic
1133407209 16:5534282-5534304 AGGATATATGTATACATGAAAGG + Intergenic
1133623569 16:7549450-7549472 AGGATAGATGTATATATAAGGGG + Intronic
1133643055 16:7736516-7736538 AGAATACATGTGTATATGAAAGG + Intergenic
1133721922 16:8502615-8502637 AGGATATATGTATATATGAAAGG + Intergenic
1133925263 16:10187175-10187197 AGGATAGATGTATATATAAAGGG - Intergenic
1134726736 16:16424447-16424469 AGGATAGATGTATATACAAAGGG + Intergenic
1134749218 16:16612560-16612582 AGGATATATGTGTATATGAAAGG - Intergenic
1134778274 16:16871891-16871913 AGGAGAGATGTATATATAAAGGG + Intergenic
1134861374 16:17563533-17563555 AGGATAGATGTATATATAAAGGG + Intergenic
1134940698 16:18287416-18287438 AGGATAGATGTATATATGAAGGG - Intergenic
1134996252 16:18741083-18741105 AGGATATATGTGTATATGAAAGG + Intergenic
1135124200 16:19793836-19793858 AGGATAAATGTGTATATAAATGG + Intronic
1135519020 16:23159216-23159238 AGGATAGATGTGTATATGAAAGG - Intergenic
1135681370 16:24460151-24460173 AGGATAGATGTACATATGAAGGG + Intergenic
1135696388 16:24590923-24590945 TGTATATATCTGGATATATATGG + Intergenic
1135871654 16:26156786-26156808 AGGATCTGACTGGATATAAAGGG - Intergenic
1135959507 16:26984088-26984110 AGGATAGATGAATATATAAAGGG + Intergenic
1135977788 16:27122212-27122234 AGGATATATGTATATATGAAAGG + Intergenic
1137245680 16:46702100-46702122 TGTATATATATGTATATAAAGGG - Intergenic
1137366010 16:47860066-47860088 TGGATATATATGGATATATATGG + Intergenic
1137366011 16:47860076-47860098 TGGATATATATGGATATATATGG + Intergenic
1137448526 16:48548955-48548977 AGGATACATGGTGATAAAAAAGG + Intronic
1137523952 16:49217463-49217485 AGGATAGATGTGTATATGAAGGG + Intergenic
1137543424 16:49380286-49380308 AGGATAGATGTATATATGAAGGG - Intronic
1137661995 16:50215615-50215637 GAGATATCTGTGCATATAAAAGG + Intronic
1137687491 16:50396578-50396600 AGGATAGATGTATATATGAAAGG + Intergenic
1137816372 16:51401648-51401670 AGGATCTATGTATATATAAAAGG + Intergenic
1137906294 16:52325428-52325450 AGGATAGATTTGTATATAAAGGG - Intergenic
1137930612 16:52583947-52583969 AGGATAGATGTATATATAAAAGG - Intergenic
1138493532 16:57392758-57392780 AAGATAGATGTATATATAAAGGG - Intergenic
1138724422 16:59120193-59120215 AGGATAGATGTATATATAAAGGG + Intergenic
1138789894 16:59890981-59891003 AGGATAGATGTATATATGAAGGG - Intergenic
1138831633 16:60381808-60381830 AGAATAGATGTATATATAAAAGG + Intergenic
1138923828 16:61566648-61566670 AGGATATATGTATACATGAAAGG + Intergenic
1138999391 16:62490659-62490681 AGGATATATGCATAAATAAAAGG - Intergenic
1139048714 16:63096587-63096609 AGGATATATGTACACATGAAGGG - Intergenic
1139050028 16:63113287-63113309 AGGATGTGTGTGGATGTATAAGG + Intergenic
1139116769 16:63963688-63963710 AGGATAGATGTATATATTAAGGG - Intergenic
1139292763 16:65873285-65873307 AGGATATATGTATGTATCAACGG + Intergenic
1140279590 16:73542620-73542642 AGGAAATATCTGGATTTAAAAGG + Intergenic
1140316449 16:73902380-73902402 AGGATATATGTATACATGAAAGG - Intergenic
1140627173 16:76808011-76808033 AGGAGATGTTTGGAGATAAAAGG - Intergenic
1140700157 16:77574330-77574352 AGGATAAATGGAGATAGAAATGG + Intergenic
1141024429 16:80531430-80531452 AGGTTAGATGTATATATAAAGGG - Intergenic
1141244253 16:82291551-82291573 AGGATACATGTATATATGAAAGG - Intergenic
1141267539 16:82510564-82510586 AGGATATATGTATATATGAAAGG + Intergenic
1141275772 16:82586798-82586820 AGGATAAATGTATACATAAAGGG - Intergenic
1141363558 16:83420623-83420645 AGGATATGTGTATATATAAAAGG + Intronic
1141878193 16:86840744-86840766 AGAATATATGTATATATGAAAGG + Intergenic
1142719146 17:1764751-1764773 TGGATGTTTGTGTATATAAATGG + Intronic
1143050373 17:4120443-4120465 AGGATATATGTATATATAAAAGG + Intronic
1143277943 17:5727679-5727701 AGGATAGATGTATATATAAAGGG - Intergenic
1143464093 17:7124077-7124099 AGGATAGATGTATATATGAAAGG - Intergenic
1144000087 17:11045889-11045911 AAGATATATGTATATATAAAAGG + Intergenic
1144191768 17:12853000-12853022 AGGATAGATGTATATATGAAAGG + Intronic
1145224259 17:21114836-21114858 AGGATAGATGTGTATATGAAAGG + Intergenic
1146343138 17:32039307-32039329 AAGATATATATAGATATAGACGG - Intronic
1146436863 17:32857896-32857918 ATGATATAATTGGAGATAAATGG - Intronic
1146515770 17:33488024-33488046 AGGATCTATGTATATATGAAAGG - Intronic
1146991731 17:37280015-37280037 AACATATCTGTGGATATAATTGG - Intronic
1148232522 17:45945340-45945362 AGAATATGTGTGGCTAAAAAGGG + Intronic
1148801349 17:50228464-50228486 AGGATAGATGTATATATGAAAGG - Intergenic
1149077834 17:52617495-52617517 AGGATAGATGTATATATAAAGGG + Intergenic
1149135881 17:53363416-53363438 GGGATATATGATGATACAAAAGG - Intergenic
1149207809 17:54268587-54268609 AGGATAGATGTATATATGAAGGG + Intergenic
1149219756 17:54403269-54403291 AGGATAAATGTATATATGAAAGG + Intergenic
1149236430 17:54595639-54595661 TATATATATGTGTATATAAAGGG + Intergenic
1149397659 17:56261433-56261455 AGGATAAATGTATATATGAAAGG + Intronic
1149637095 17:58179680-58179702 AGGATAGATGTATATATGAAGGG - Intergenic
1149770749 17:59319013-59319035 AGGATAGATGTATATATGAAGGG - Intergenic
1150167258 17:62955822-62955844 AGGATAGATGTATATATGAAGGG - Intergenic
1150517338 17:65827293-65827315 AGGATAGATGTATATATGAAGGG - Intronic
1150941826 17:69701207-69701229 AGGATAAATGTATATATGAAAGG + Intergenic
1151069016 17:71187036-71187058 AGGATAGATGTATATCTAAAGGG + Intergenic
1151174407 17:72275331-72275353 AGGATCTATGTCTATATAAAAGG + Intergenic
1151184975 17:72357238-72357260 AGGACAGATGTAGATATGAACGG - Intergenic
1151261811 17:72921718-72921740 TGGATATAAGTGGAAATAAAAGG - Intronic
1151870284 17:76832079-76832101 AGGATAGATGTATATATGAAGGG + Intergenic
1152998351 18:429754-429776 ATGACAGATGTGGATATGAATGG + Intronic
1153067773 18:1066044-1066066 AGGATAGATATAAATATAAAGGG + Intergenic
1153104198 18:1508606-1508628 AGGATTGATGTATATATAAAGGG - Intergenic
1153118538 18:1691270-1691292 CGGATATAGGTGTTTATAAAAGG - Intergenic
1153175222 18:2364167-2364189 AGGATAGATGTGTACATGAAGGG - Intergenic
1153320006 18:3763464-3763486 AGGATAGATGTATATATACAGGG - Intronic
1153598677 18:6756597-6756619 AGGATATATGTATATATGAAAGG + Intronic
1154291343 18:13110583-13110605 AGGATATATGTATATATGAAAGG + Intronic
1154443798 18:14416629-14416651 AGTGTAAATGTGCATATAAAAGG - Intergenic
1154526201 18:15292545-15292567 TGGATTTATGTGGATATGATGGG - Intergenic
1154940186 18:21104780-21104802 AGGGTTTAGTTGGATATAAAAGG - Intronic
1155663950 18:28284293-28284315 AGGATATATGTATATCTGAAAGG - Intergenic
1156032400 18:32727558-32727580 AGGACATATGTGCAGATAAGGGG - Intronic
1156103698 18:33630481-33630503 AGAATATAGGTGGATAAAGAAGG + Intronic
1156447177 18:37245792-37245814 TGCACATATGTGGATATACATGG + Intronic
1156738394 18:40292753-40292775 GGGATATAAAGGGATATAAAAGG - Intergenic
1156794423 18:41025413-41025435 AGGATATCTCTGGGGATAAAAGG + Intergenic
1156826757 18:41439220-41439242 AGAATAGATGTATATATAAAGGG + Intergenic
1156890435 18:42184482-42184504 AGGATAGATGTATATACAAAGGG + Intergenic
1156987177 18:43361914-43361936 AGAACATATGTATATATAAAAGG + Intergenic
1157009648 18:43631344-43631366 TGTATATATATGGATATATATGG + Intergenic
1157011848 18:43659094-43659116 AGGATAGATGTATATATAAAGGG + Intergenic
1157069214 18:44386348-44386370 AGGAAATATGTGGGCACAAAAGG - Intergenic
1157132181 18:45017108-45017130 AGGCTTAATGTGGAGATAAAAGG + Intronic
1157335649 18:46735329-46735351 AGGATAGATGTATATATAAAGGG - Intronic
1157657646 18:49407208-49407230 AGGATGGGTGTGGCTATAAAGGG + Intronic
1157798048 18:50593842-50593864 AGGATATATATATATATGAAAGG + Intronic
1157870571 18:51226732-51226754 AGAATATATGTATATATGAAAGG + Intergenic
1157918924 18:51696431-51696453 AGGATAGATGTCTATATGAAAGG - Intergenic
1157956742 18:52107002-52107024 AGGATAGATGTATATATGAAGGG + Intergenic
1158093946 18:53748860-53748882 AGGATATATGGGGAAATAGGGGG + Intergenic
1158667808 18:59448695-59448717 GGGATACATGTGTATATGAAAGG - Intronic
1158723857 18:59950281-59950303 AGGATATATGTATATATGGAAGG - Intergenic
1158816518 18:61103869-61103891 AGGATATATGTGTGTATGAAAGG - Intergenic
1159136359 18:64341572-64341594 AGGATAGATGTATATATAAAAGG + Intergenic
1159208596 18:65286078-65286100 AGGATAGATGTAAATATGAAGGG - Intergenic
1159736006 18:72098740-72098762 AGGATAGATGTGTATATGAAAGG + Intergenic
1159780730 18:72657543-72657565 AGGATAGATGTATATATGAAGGG - Intergenic
1159849960 18:73515616-73515638 AGGATAGATATGTATATAAAGGG - Intergenic
1159942720 18:74420841-74420863 AGGATAGATGTATATATAAAAGG - Intergenic
1160020846 18:75179663-75179685 AATATATATATGGATATATATGG + Intergenic
1160246132 18:77161646-77161668 AGGATATATGTGTACATGAAAGG + Intergenic
1160319724 18:77878967-77878989 AGTATAGACATGGATATAAAAGG - Intergenic
1161734067 19:5979445-5979467 AGTATATATGTGTATATATATGG - Intergenic
1162708010 19:12570339-12570361 AGGATATCTGTATATATGAAAGG - Intronic
1162853173 19:13447507-13447529 AGGATAGATGTATATATGAAAGG + Intronic
1163219441 19:15904386-15904408 AGGATAGATGTACATATAAAGGG - Intergenic
1163231764 19:16007932-16007954 AGGATAGATGTATATATAAAGGG - Intergenic
1163383919 19:16987259-16987281 TGTATATATGTGCATATATATGG - Intronic
1164087279 19:21914677-21914699 ATGATATATATGGACATATATGG + Intergenic
1164113670 19:22195153-22195175 AGGAGAAATGAGGAAATAAAGGG + Intronic
1164290791 19:23867050-23867072 AGGAGAAATGAGGAAATAAAGGG + Intergenic
1164354147 19:27396729-27396751 AGGAAATATCTTCATATAAAGGG - Intergenic
1164359236 19:27483455-27483477 AGGAAATATCTTGAGATAAAAGG + Intergenic
1164875574 19:31683644-31683666 AGGATAGATGAATATATAAAGGG - Intergenic
1165186464 19:34026521-34026543 AGGATAGATGTGTATATAATGGG - Intergenic
1166459878 19:42977671-42977693 AGCATAGATGTATATATAAAGGG - Intronic
1166477204 19:43137725-43137747 AGGATAGATGTATATACAAAGGG - Intronic
1166913854 19:46180556-46180578 AGGATATATGTATATATGAAAGG + Intergenic
1166973938 19:46592355-46592377 AGGATAGATGTATATATGAAGGG + Intronic
1167875888 19:52412161-52412183 AGGAGAAATGAGGAAATAAAGGG - Intronic
1167882162 19:52469078-52469100 GGGATACATGTATATATAAAAGG - Intronic
1167882456 19:52471395-52471417 AGGATCTGTGTATATATAAAAGG - Intronic
1168009400 19:53518471-53518493 AGGATATATGTCTATAGGAAAGG - Intergenic
1168120247 19:54247966-54247988 AGGATAGATGTATATATAAAGGG - Intronic
1168519628 19:57038384-57038406 AGGATAGATGAGGATCAAAATGG + Intergenic
925540007 2:4956692-4956714 AGGATATATGTATTTATGAAGGG + Intergenic
925604505 2:5644740-5644762 AGAATAGATGTACATATAAAAGG - Intergenic
925713302 2:6762427-6762449 GGGATGCATGTGTATATAAAGGG - Intergenic
925739777 2:6995401-6995423 AAGATAGATGTTTATATAAAGGG + Intronic
925755223 2:7127298-7127320 AGGATATATGTACATATGAAAGG + Intergenic
925772392 2:7296183-7296205 AGGATAGATGTATATATGAAGGG + Intergenic
925840514 2:7987571-7987593 AGGATAGATGTATATATAAAGGG - Intergenic
925900265 2:8504235-8504257 AGGACAGATGTATATATAAAAGG - Intergenic
926390500 2:12386313-12386335 AGGATAGATGTATATGTAAAGGG - Intergenic
926392378 2:12406434-12406456 AGGATAGATGTATATATAAGGGG + Intergenic
926402648 2:12513935-12513957 AGAATATATATAGATATATATGG - Intergenic
926421948 2:12708477-12708499 AGGATATATGTATATATGAAAGG + Intergenic
926563581 2:14444889-14444911 AGGATATATGTATATATGAAAGG - Intergenic
926606551 2:14904169-14904191 AGGATAAATGTACATATGAAAGG + Intergenic
926841819 2:17089419-17089441 AGGATATATGTATATATGAAGGG + Intergenic
926934179 2:18070783-18070805 AGGTTAGATGCAGATATAAATGG - Intronic
926987258 2:18638680-18638702 AGGATAGATGTATATATAAAGGG - Intergenic
926994952 2:18724712-18724734 CGGATATATGTATATATGAAAGG - Intergenic
927028619 2:19096721-19096743 AGGATATATGCATATATGAAGGG - Intergenic
927355699 2:22170518-22170540 AGAATATATGTATATATGAAAGG - Intergenic
928721506 2:34126384-34126406 AGGATATATGTATATACGAAAGG - Intergenic
928785935 2:34886228-34886250 AGAATATATAAGAATATAAAAGG - Intergenic
929017486 2:37513359-37513381 AGGATTTCTGTGGGTAAAAATGG + Intergenic
929032811 2:37664501-37664523 AGGATAGATGTATATATAAAGGG - Intronic
929059911 2:37913606-37913628 AGGATATATGTATAAATGAAGGG - Intergenic
929333971 2:40717446-40717468 AGGATCTATGTATATATGAAAGG - Intergenic
929374588 2:41269771-41269793 AGGATATATGGATATATAAAAGG - Intergenic
929471916 2:42202453-42202475 AGGATACATGTATATATAAAAGG + Intronic
929881530 2:45841188-45841210 AGGATATATGTATATATGAAGGG + Intronic
930298254 2:49581958-49581980 AGGATAGATGTATACATAAAGGG - Intergenic
930986621 2:57596600-57596622 AGGATACATCTTGATAAAAAAGG - Intergenic
931129544 2:59318923-59318945 AGGATATATGTATATATGAAAGG - Intergenic
931805587 2:65800623-65800645 AGGATAGATGTATATATAAAGGG - Intergenic
932176960 2:69611592-69611614 AAGGTATATGTATATATAAAGGG - Intronic
932561457 2:72874858-72874880 AGGATATATGTATATATGAAGGG + Intergenic
932798607 2:74719342-74719364 AGGACACAGGTGGATATAAAAGG + Intergenic
932839674 2:75070457-75070479 AGGATACATGTGGGAAGAAATGG - Intronic
932859046 2:75269560-75269582 AGGATAGCTGTATATATAAAGGG + Intergenic
932905029 2:75739777-75739799 AGAATATATGTATATATGAAAGG - Intergenic
932909144 2:75787648-75787670 AGGATATTTGGGGAAATAGATGG - Intergenic
932957037 2:76364187-76364209 AGGATATATGTATATATGAAAGG - Intergenic
933008729 2:77029217-77029239 AGGATAGATGTATATATGAATGG + Intronic
933067829 2:77819968-77819990 AGGATATATGTATATATGAAAGG - Intergenic
933266122 2:80182026-80182048 AGGATAAATGTATATATGAAAGG + Intronic
933362167 2:81301802-81301824 AGGATAAATTTAGAGATAAAGGG + Intergenic
933588836 2:84209144-84209166 AGGATAGATGTATATATGAAGGG - Intergenic
934019002 2:87924326-87924348 AGAATATCTGTGGAAAGAAACGG - Intergenic
934025104 2:87996074-87996096 AGGATATATGTATATATGAAAGG + Intergenic
934073484 2:88407506-88407528 AGGATAGATGTATATAAAAAGGG - Intergenic
934074870 2:88419508-88419530 AAGCTAAATGTGGATATGAAAGG - Intergenic
935526311 2:104172010-104172032 AGGATAAATGTACATATGAAGGG - Intergenic
937664374 2:124468166-124468188 AGGATACATGTATATATTAAAGG + Intronic
937732601 2:125252606-125252628 AGGATAGGTGTATATATAAAGGG + Intergenic
937765976 2:125660959-125660981 AGGATATATGTATATGTGAAAGG - Intergenic
937820079 2:126300668-126300690 AGGATAGATGTATATATAAAGGG + Intergenic
938525302 2:132123909-132123931 TGGATTTATGTGGATATGATGGG - Intergenic
939007145 2:136802305-136802327 AAAATATATTTGGAAATAAAAGG - Intronic
939227024 2:139377343-139377365 AGGATACATGTGTATATAATAGG + Intergenic
939410373 2:141816665-141816687 AGGATACATGTATATATAAAGGG - Intronic
939456666 2:142446058-142446080 AGGATAGATGTATAAATAAAGGG + Intergenic
939709879 2:145504404-145504426 AGATTATATGTGTAAATAAAAGG + Intergenic
939774094 2:146362667-146362689 AGGATAGATGTATATATGAAAGG - Intergenic
939832443 2:147089026-147089048 AGGATATATGTACATATGAAAGG + Intergenic
939870268 2:147519066-147519088 AGGATAGATGTCTACATAAAGGG - Intergenic
940357649 2:152763254-152763276 AGGATATATGTATACATGAAAGG + Intergenic
940439355 2:153696003-153696025 AGGATAGACGTATATATAAAGGG + Intergenic
940459980 2:153952651-153952673 AGGATAGATGTATATATAAAGGG + Intronic
940711477 2:157167403-157167425 TGTATATATGTATATATAAAAGG + Intergenic
940972209 2:159906321-159906343 AGGATACATGTATATATGAAAGG - Intergenic
941045727 2:160673225-160673247 AGGATATGTATGGAAATAAAAGG - Intergenic
941136940 2:161729251-161729273 ATGTTGTTTGTGGATATAAATGG - Intronic
941283157 2:163577997-163578019 AGGATAGATGTATATATAAAGGG - Intergenic
941352418 2:164453177-164453199 AGGATATTTCTGGCAATAAATGG - Intergenic
941361252 2:164553960-164553982 AGAATATATATATATATAAAAGG + Intronic
941482837 2:166038928-166038950 AGGATATATGTGTGAATTAATGG + Intronic
941520561 2:166537024-166537046 AGGATATATGTATATATGAAAGG + Intergenic
941765695 2:169293911-169293933 AGGATCTGTGTAGATGTAAAGGG - Intronic
941787431 2:169513629-169513651 AGAATAGATGTGCATACAAATGG - Intronic
941852109 2:170194683-170194705 AGGATATACGTATATATGAAAGG + Intronic
942084577 2:172431893-172431915 AGGATAAATGCTTATATAAAAGG + Intronic
942462939 2:176181724-176181746 AAGTTATGTGTGGATATATATGG + Intergenic
942515584 2:176749046-176749068 AGGATTGATGTGGAAATCAAAGG - Intergenic
942732359 2:179074378-179074400 AGGATATATGTATATATGAGAGG - Intergenic
942784564 2:179686129-179686151 GGGAAATATGTTTATATAAATGG - Intronic
942850508 2:180479273-180479295 AGTATGTATGTAGACATAAAAGG + Intergenic
943091979 2:183386356-183386378 GATATATATGTGGATATATATGG - Intergenic
943100942 2:183485326-183485348 AGGATAGATGTATATATAAAGGG - Intergenic
943183383 2:184574004-184574026 AGGATATATGTATATCTGAACGG + Intergenic
943253712 2:185565980-185566002 AGGATAGATGTATATATAAAGGG - Intergenic
943392309 2:187285107-187285129 AGGATAGATATATATATAAAGGG + Intergenic
943636294 2:190310348-190310370 AGGACATATGTATATATGAAAGG - Intronic
943662491 2:190574333-190574355 AAGATATATGTGCTTATGAATGG + Intergenic
943830766 2:192458880-192458902 ATGATATATATGGTTATATATGG - Intergenic
943830878 2:192460249-192460271 AGGATAGATGTATATACAAAGGG + Intergenic
943922724 2:193729852-193729874 AGGATATGTGTATATATGAAGGG - Intergenic
943994297 2:194739211-194739233 AGGATATATGTATATATGAAAGG - Intergenic
944076938 2:195743350-195743372 AGGATATATGTATATATGAGAGG - Intronic
944130216 2:196339583-196339605 AGGATAGATGAGGAGATAGATGG + Intronic
944224503 2:197336535-197336557 AGGAAATATGTCAGTATAAAAGG - Intergenic
944325677 2:198400829-198400851 AGGGTATCTGTGGAGAAAAAGGG + Intronic
944336509 2:198541262-198541284 GGGATAGATGTGTATATGAAGGG - Intronic
944422267 2:199544130-199544152 AGGATAGATGTACATATAAAGGG + Intergenic
944584834 2:201164353-201164375 AGGATACATGTATATAAAAAGGG + Exonic
944619341 2:201498113-201498135 AGGATATATGTATATATAAAAGG + Intronic
944745376 2:202650506-202650528 AGGATAGATGTATATATAAAGGG + Intronic
945333011 2:208561178-208561200 AGGATAGATGTATATATGAAGGG + Intronic
945344852 2:208701406-208701428 AGGATAGATGTATATATGAAGGG + Intronic
945377765 2:209099259-209099281 AGGATAGGTGTATATATAAAGGG + Intergenic
945614602 2:212052447-212052469 AGGATAGATGTGTATATGAAGGG - Intronic
945725195 2:213466237-213466259 AGGATAGATGTATATATAAAGGG - Intronic
946656322 2:221951890-221951912 AGGATAGATGTATATATGAAGGG - Intergenic
946977452 2:225169048-225169070 AGGATAGATGTATATATAAAGGG - Intergenic
947030614 2:225788828-225788850 AGGATGTATGTGTATATGAAAGG - Intergenic
947034419 2:225835960-225835982 AGGATAGATGTATATATGAAAGG + Intergenic
947038611 2:225888524-225888546 AGGATATATGCATATATGAAGGG - Intergenic
947040377 2:225911625-225911647 AGAAAATATGTGGATTTTAAAGG + Intergenic
947067242 2:226241451-226241473 AGGATATATGTATATAGGAAAGG - Intergenic
947356384 2:229300235-229300257 AGGATATATGTATATATGAAAGG - Intergenic
948033655 2:234840333-234840355 AGGATAGATGTATATATGAAGGG - Intergenic
948096738 2:235341294-235341316 AGGATATAGGGGAAAATAAAAGG - Intergenic
948285270 2:236779486-236779508 AGGATAGATGTATATATGAAAGG + Intergenic
948344751 2:237286327-237286349 AGGATATATGTATATATAAAAGG - Intergenic
1169291603 20:4357978-4358000 AGGATAGATGTATATATAAAGGG - Intergenic
1169651861 20:7877700-7877722 TATATATATATGGATATAAAAGG - Intergenic
1169774674 20:9239646-9239668 AGGACAGATGTATATATAAAGGG + Intronic
1170084173 20:12510611-12510633 AGGATAGCTGTATATATAAACGG - Intergenic
1170177964 20:13493732-13493754 AGGATATTTATGTATATGAAAGG - Intronic
1170235719 20:14102766-14102788 AGGATATATGGGGATATATGGGG + Intronic
1170479850 20:16754924-16754946 AGGGTATATGTGTATATGAAGGG - Intronic
1171089386 20:22269662-22269684 AGGATATATGTATATATGAAGGG + Intergenic
1171230843 20:23483394-23483416 AGGATATATATAGAGATCAATGG - Intergenic
1171252461 20:23659450-23659472 AGGCTAGATGTGTATCTAAAGGG + Intergenic
1171742698 20:28919841-28919863 AGGAAATATATTTATATAAAAGG - Intergenic
1173093154 20:39995437-39995459 AGGATAGATGTGCAGATGAATGG - Intergenic
1173271002 20:41534766-41534788 AGGAGATAAGTGGACATAAAAGG + Intronic
1173404322 20:42751937-42751959 AGGATATATGTATATATGAAGGG - Intronic
1174094489 20:48077465-48077487 AGGATAGATGTATATATAAAGGG + Intergenic
1174103474 20:48145252-48145274 AGGATATATGTATGTATGAAGGG + Intergenic
1174271950 20:49376046-49376068 TGGATATATGTTGAAATTAATGG + Intronic
1174944565 20:54970907-54970929 AGGATATATGTATATAGGAAAGG + Intergenic
1174944812 20:54973669-54973691 AGGATATATGTATATACGAAAGG + Intergenic
1174956070 20:55100116-55100138 AGGATATATGTATATATGAAAGG + Intergenic
1175735466 20:61383356-61383378 TGGATATATATGAATATATATGG + Intronic
1176324698 21:5381435-5381457 AGGAAATATATTTATATAAAAGG + Intergenic
1176452289 21:6874592-6874614 AGTGTAAATGTGCATATAAAAGG + Intergenic
1176482250 21:7311851-7311873 AGGAAATATATTTATATAAAAGG + Intergenic
1176761440 21:10798239-10798261 AGGAAATATATTCATATAAAAGG + Intergenic
1176771221 21:13075944-13075966 TGGATTTATGTGGATATGATGGG + Intergenic
1176830461 21:13739641-13739663 AGTGTAAATGTGCATATAAAAGG + Intergenic
1176895891 21:14378017-14378039 AGTATATATGTGTATATGAAAGG - Intronic
1176926248 21:14752932-14752954 AGGATATAAGTAGATAAAAGGGG - Intergenic
1176982651 21:15400985-15401007 AGGAGCTATGGGGAAATAAATGG + Intergenic
1177027524 21:15938079-15938101 AGGATAGATGTACATATGAAGGG + Intergenic
1177278708 21:18950487-18950509 AGGATAGATGTATATATGAACGG - Intergenic
1177300397 21:19236734-19236756 AGGCTATATGTATATATAAAAGG - Intergenic
1177356375 21:20013641-20013663 ATGATATATGTTAATAGAAAAGG - Intergenic
1177356804 21:20018963-20018985 TACATATATGTGGATATACATGG - Intergenic
1177389130 21:20443655-20443677 AGGATAGATGAGTATATGAAGGG - Intergenic
1177462077 21:21425695-21425717 AGGATAAATGTAAATATAATTGG + Intronic
1177514071 21:22124559-22124581 AGGATATATGTATATGTGAAAGG + Intergenic
1177737914 21:25116020-25116042 AGGAGATATGTACATATTAATGG - Intergenic
1177744712 21:25197734-25197756 AGGATATAGATAGATATAAGAGG + Intergenic
1177849047 21:26324753-26324775 AGAATATTTGTATATATAAAAGG - Intergenic
1177884396 21:26731557-26731579 AGGATATATGTATATAAGAAAGG + Intergenic
1178060700 21:28850767-28850789 AGGATAGATGTGCATATAAAAGG + Intergenic
1178106300 21:29323202-29323224 AGGATATATGTATGTATGAAGGG + Intronic
1178192367 21:30299417-30299439 AGGATAGATGTATATATGAAAGG + Intergenic
1178281010 21:31282890-31282912 AGGATATATTTGGATACATTAGG - Intronic
1178339881 21:31777305-31777327 AGGTTAAATGTATATATAAAAGG - Intergenic
1178474307 21:32922900-32922922 AGGATGCATGTATATATAAAAGG - Intergenic
1178496331 21:33089529-33089551 AGGATAGATGTATATATGAAGGG + Intergenic
1178781955 21:35612140-35612162 AGGATAGATGTATACATAAAGGG + Intronic
1179252423 21:39683208-39683230 ATGAGATATTTTGATATAAAGGG + Intergenic
1179282868 21:39950053-39950075 AGGATAGATGTATATATGAAAGG - Intergenic
1180401134 22:12427074-12427096 AGGAAATATATTTATATAAAAGG + Intergenic
1180518370 22:16170389-16170411 TGGATTTATGTGGATATGATGGG + Intergenic
1182193526 22:28489852-28489874 AGGATAGATAGGTATATAAAGGG + Intronic
1182606473 22:31509203-31509225 AGGATATATGTGTATGTGAAAGG + Intronic
1182926667 22:34131569-34131591 AGGATATATGTATATATGAAAGG + Intergenic
1184314633 22:43675900-43675922 AGGAAATATTTAGATATGAATGG + Intronic
1184885115 22:47339436-47339458 AGGATAGATGTATATATGAAAGG - Intergenic
1184938745 22:47745036-47745058 AAGATAGATGTGTATATGAAGGG + Intergenic
949372198 3:3347638-3347660 AGGGTATATGTATATATGAAGGG - Intergenic
949569034 3:5273998-5274020 AGGATAGATGTGTATATAAAGGG - Intergenic
949604807 3:5641005-5641027 AGGATAGATGTATATATAAAGGG - Intergenic
949722495 3:7006856-7006878 AGGAAATATAGGGATAAAAAAGG + Intronic
949796713 3:7859549-7859571 AGGATAGATGTATATATAAAGGG - Intergenic
949844549 3:8356601-8356623 AGGATAGATGTATATATGAAAGG - Intergenic
950209095 3:11104788-11104810 AGGATATATGTATATATCAAAGG - Intergenic
950623548 3:14227036-14227058 AGGAGAAATGAGGAAATAAAAGG + Intergenic
950908405 3:16560249-16560271 AGGATAGATGTATATATGAAAGG - Intergenic
950916200 3:16647662-16647684 AGGATATATGTATATATGAAAGG + Intronic
950988317 3:17401045-17401067 AGGAAAGATGTATATATAAAGGG - Intronic
951038146 3:17956621-17956643 ATAATATATATGGATATATATGG + Intronic
951091746 3:18581535-18581557 AGGATAGATGTATATATAAAGGG - Intergenic
951138162 3:19129068-19129090 AGGATAGATGTATATATAACAGG + Intergenic
951302133 3:21010619-21010641 AGGATAGATGTATATAAAAAGGG - Intergenic
951377400 3:21936977-21936999 AAAATATTTATGGATATAAAAGG + Intronic
952141360 3:30482132-30482154 TGGATATAAGAGGAAATAAATGG - Intergenic
952164380 3:30730816-30730838 CGTGCATATGTGGATATAAATGG + Intronic
952313051 3:32207805-32207827 AGGATAGATGTATATATGAAGGG + Intergenic
952570760 3:34712983-34713005 AGGATATATGGATATATGAAAGG - Intergenic
953091896 3:39736345-39736367 AGGTAGTATGTGGATATACAGGG + Intergenic
953238711 3:41128651-41128673 AGGATATATGTAGATATATGAGG + Intergenic
953444152 3:42948390-42948412 AGGATATATGTATACACAAAAGG + Intronic
953581268 3:44159064-44159086 GGGATGCATGTGGCTATAAAGGG - Intergenic
955488070 3:59454776-59454798 AGGATGTATGTGCATACAGAGGG - Intergenic
955558046 3:60159091-60159113 AGTATATCTGTGGAATTAAATGG - Intronic
955788978 3:62568720-62568742 AGGATATATGTATATAAGAAAGG - Intronic
955803044 3:62705798-62705820 AGGATAGATGTATATATAAAAGG - Intronic
955811782 3:62798573-62798595 AGGATAGATGTGAATCTGAAGGG - Intronic
955978338 3:64499156-64499178 AGGATAGATGTACATATGAAAGG + Intergenic
956368081 3:68527466-68527488 AGTATATATTATGATATAAAAGG - Intronic
956815923 3:72908175-72908197 AGGATAAATATGGGAATAAATGG + Intronic
956851924 3:73236606-73236628 ATGATATATGTGCATATACCTGG + Intergenic
956898002 3:73683533-73683555 AGGATATACGTATATATAAAAGG + Intergenic
956940336 3:74153363-74153385 AGGATAGATGTATCTATAAAGGG + Intergenic
956972851 3:74546813-74546835 AGGATAGATGTATATATAAAAGG - Intergenic
957396329 3:79643403-79643425 AGGATAGATGTATATATGAACGG - Intronic
957450475 3:80375644-80375666 AGGATATATGCATATATGAAAGG + Intergenic
957634563 3:82763273-82763295 AGGATATATGTATATATAAAGGG - Intergenic
957659104 3:83123445-83123467 AATATATATGTAGATATATATGG - Intergenic
957750368 3:84407684-84407706 AGGATATATGTATATATGAAAGG + Intergenic
957880126 3:86201117-86201139 AGGATAGATGTATATATAAAGGG - Intergenic
957946822 3:87074618-87074640 AGGACATGTGTGACTATAAAAGG + Intergenic
958084369 3:88787448-88787470 GGGATAAATGTATATATAAAGGG + Intergenic
958139389 3:89541388-89541410 AGAATATATATATATATAAAGGG - Intergenic
958140821 3:89559993-89560015 AGGATAGATGTATATATAAGGGG - Intergenic
958141285 3:89565260-89565282 AGGATAGATGTATATATGAAGGG - Intergenic
958519299 3:95162908-95162930 AGGAAATATGTAGAAAGAAATGG + Intergenic
958601940 3:96305839-96305861 AGGATAGATGTATACATAAAGGG + Intergenic
958806638 3:98818955-98818977 AGGACAGATGTATATATAAAGGG - Intronic
958829407 3:99068953-99068975 AGGATAGATGTATATATAAAGGG - Intergenic
959172645 3:102860999-102861021 AAGATAGATGTATATATAAAGGG + Intergenic
959205934 3:103306627-103306649 AGAATATATGTTGATGAAAAGGG + Intergenic
959289086 3:104449709-104449731 AGGATATATGTGTACATCAAAGG + Intergenic
959396457 3:105844572-105844594 AGGATATATGTATACATCAATGG - Intronic
959462994 3:106650231-106650253 AGGATATATGTATATATGAAAGG + Intergenic
959472807 3:106773523-106773545 AGGATAAATGTATATAAAAAGGG - Intergenic
959649954 3:108741929-108741951 AGGATAGATGTATATATAAAGGG + Intergenic
959748835 3:109809480-109809502 AGAATACATGTATATATAAAGGG + Intergenic
959868743 3:111302471-111302493 AGGATATATGTATATATGAAGGG + Intronic
959967834 3:112376331-112376353 AGGATAGATGTATATATGAAGGG + Intergenic
960318976 3:116210671-116210693 AGGATATATGTATATATGAAGGG - Intronic
960477974 3:118154015-118154037 AGGATAGATGTATATATAAAGGG + Intergenic
960574393 3:119215539-119215561 AGGATAGATGTATATATGAAGGG - Intronic
961030754 3:123601431-123601453 AGGATAAATGTGTATATGAAAGG - Intergenic
961256197 3:125555382-125555404 AGGATAGATGTATATATAAAGGG - Intronic
961710616 3:128825147-128825169 AGGATATATGTATATATGAAAGG + Intergenic
961733448 3:128984690-128984712 AGGATAGATGTATATATGAAAGG - Intronic
961999900 3:131284972-131284994 AGGATAGATGTATATATGAAAGG - Intronic
962029924 3:131589090-131589112 AGGATATATGTATATATGAAAGG + Intronic
962075834 3:132080876-132080898 AGGATAGATGTATATATGAAAGG - Intronic
962447040 3:135475545-135475567 AGGATAGATGTATATATGAAAGG + Intergenic
962545549 3:136430862-136430884 AGTATGTGAGTGGATATAAAAGG - Intronic
963169766 3:142239064-142239086 AAGAAATAGGTGCATATAAATGG - Intergenic
963391558 3:144671447-144671469 AGAATATATGTAGATATAAGAGG + Intergenic
963460849 3:145613139-145613161 AGGATAGATGTATATATAAGGGG - Intergenic
963462443 3:145633647-145633669 AGGATATATGTATACATGAAAGG - Intergenic
963570527 3:146989138-146989160 AGGATAGATGTACAAATAAAGGG - Intergenic
963893267 3:150659289-150659311 AGGATAGATGTATATATGAAGGG + Intergenic
963913702 3:150838589-150838611 AGGATATATGTATATATGAAAGG + Intergenic
963929297 3:150985461-150985483 AGAATAGATGTATATATAAAGGG - Intergenic
964646582 3:158964711-158964733 AGGATAGATGTATATATAAAGGG + Intronic
964828422 3:160855895-160855917 AGGATAGATGTATATATAAAGGG + Intronic
965029074 3:163340532-163340554 AGGATAAATGTATACATAAAAGG + Intergenic
965086139 3:164100306-164100328 AGAATATATGGATATATAAAAGG - Intergenic
965206833 3:165729754-165729776 AGGTTAGATGTATATATAAAGGG + Intergenic
965266518 3:166550563-166550585 AGGATAGATGTATATATGAAAGG - Intergenic
965369723 3:167846582-167846604 GGGAAATATGTGAAGATAAATGG - Intergenic
965707419 3:171522965-171522987 AGGATATATGTATACATGAAAGG - Intergenic
965798361 3:172465730-172465752 AGGATAGATGTGTATATGAAGGG + Intergenic
966070781 3:175875196-175875218 AAGATATATTTGGATATGCAAGG + Intergenic
966287249 3:178312304-178312326 AGGAAATATGTATATATGAAAGG - Intergenic
966711047 3:182973153-182973175 AGTGTATATGTGTATATATAGGG - Intronic
967194998 3:187018374-187018396 AGGATAGATGTATTTATAAAGGG + Intronic
967250083 3:187528490-187528512 AGGATTTATGTGGTTAGTAAGGG - Intergenic
967403133 3:189085939-189085961 AGGATAGATGTATATATGAAAGG + Intronic
967612878 3:191528754-191528776 AGGTTAGATGTATATATAAAAGG + Intergenic
967742547 3:193019073-193019095 AGGATAGACGTATATATAAAAGG - Intergenic
967745253 3:193047802-193047824 AAGATAAATGTATATATAAAGGG - Intergenic
967760301 3:193216707-193216729 AGGATATATGTACATATGAAAGG + Intergenic
967764056 3:193258106-193258128 AGGATAGATGTATATATGAAAGG - Intronic
968010944 3:195274616-195274638 AGGATGAATGTGGATTTGAAAGG + Intergenic
968063534 3:195745426-195745448 AGGATAGATGTATATATAAAGGG - Intergenic
968430846 4:557568-557590 AGGATAGATGTATATATAAACGG - Intergenic
968684816 4:1950813-1950835 AGCATATATATGCATATAAGAGG - Intronic
969071783 4:4545466-4545488 AGGATAGGTGTATATATAAAGGG + Intergenic
969082821 4:4633054-4633076 AGGATAGATGTATATAAAAAAGG - Intergenic
969148556 4:5146151-5146173 AGGATATATGTATATATGAAGGG + Intronic
969283175 4:6185218-6185240 AGGATAGATGTATATATGAAAGG - Intronic
969303358 4:6310325-6310347 AGGATCTATGTGTCTATGAAAGG - Intergenic
969991691 4:11271086-11271108 AGGATATATGTATATAAGAAAGG + Intergenic
970052332 4:11928724-11928746 AAGATAGATGTATATATAAAGGG - Intergenic
970082036 4:12298615-12298637 AGGCTAGATGTGTATATGAAGGG + Intergenic
970088446 4:12374577-12374599 AGGATATATGTATATATGAAGGG + Intergenic
970145535 4:13031782-13031804 AGGATATATGTATATATGAAAGG + Intergenic
970186446 4:13459352-13459374 AGGATAGATGTATATATGAAAGG - Intronic
970270462 4:14341033-14341055 AGGATAAATATATATATAAAGGG + Intergenic
970282068 4:14468142-14468164 TAGAAATATGTGGACATAAAAGG - Intergenic
970353292 4:15227799-15227821 AGGATATTTGTATATATGAAAGG + Intergenic
970629110 4:17922136-17922158 AGGATAGATGTATATATGAAAGG - Intronic
970647422 4:18138422-18138444 AAGATACATGTATATATAAAAGG - Intergenic
970717368 4:18941773-18941795 AGGATAGACGTGTACATAAAGGG - Intergenic
970773690 4:19647402-19647424 AGGATACACGTATATATAAAGGG + Intergenic
970787979 4:19822563-19822585 AGGATATATGTATATATGAAAGG - Intergenic
971043996 4:22784375-22784397 AAGATATATGTACATATGAAAGG - Intergenic
971051498 4:22867537-22867559 AGGATATATGTATATATTAAAGG - Intergenic
971078835 4:23183559-23183581 AGGATCTATGTATATATGAAAGG + Intergenic
971288953 4:25317972-25317994 AGGATACATGAGGAGAGAAAAGG + Intronic
971411352 4:26375912-26375934 AGTATATGTATGAATATAAATGG - Intronic
971532268 4:27704133-27704155 AGGATATATGTATATATGAAAGG + Intergenic
971550478 4:27949335-27949357 AGGATAGATGTATATAAAAAGGG + Intergenic
971824482 4:31603787-31603809 AGGATATATGTGTATACGAAAGG + Intergenic
971896482 4:32603485-32603507 ATGATATATGTGGATATCTCTGG + Intergenic
971935565 4:33143158-33143180 AGGATAGACGTATATATAAAGGG + Intergenic
971978967 4:33729881-33729903 AGGATGTATATGTATATAATAGG + Intergenic
971978971 4:33730208-33730230 AGGATATATATGTATATAATAGG - Intergenic
972137864 4:35915381-35915403 AGGATACATATGGTAATAAAGGG + Intergenic
972150553 4:36084213-36084235 AGGATAGATGTATATATGAAGGG - Intronic
972177305 4:36423582-36423604 AGAATATATTAGGATATAAAAGG + Intergenic
972228940 4:37048002-37048024 AGGATAATTGTGGAAATAAGGGG - Intergenic
972410108 4:38785074-38785096 ACAATATATGTGGAAATACATGG - Intergenic
972676894 4:41268781-41268803 AGGATATATGTATGTATAAAGGG + Intergenic
972891922 4:43567956-43567978 AGGATAGATGTATATATGAAGGG + Intergenic
972916650 4:43889349-43889371 TAGATATCTGTGGAAATAAAGGG - Intergenic
972920740 4:43938481-43938503 AGGATTTATGTATATATGAAAGG + Intergenic
972943124 4:44221435-44221457 AGGATAGATGTATATATGAAAGG + Intronic
973003285 4:44978309-44978331 ATGATATTTGTGGATAATAAAGG - Intergenic
973038880 4:45445647-45445669 AGGATATATGTATTTATGAAGGG - Intergenic
973100579 4:46263577-46263599 AGGATAGATATGTATATCAAGGG - Intronic
973108427 4:46369832-46369854 AGGAAATGTGTGTATATAAGTGG + Intronic
973121436 4:46524569-46524591 AGGATAAATGTATATATGAAAGG + Intergenic
973260890 4:48162032-48162054 AGGATAGATGTATATATAAAAGG - Intronic
973539932 4:51925646-51925668 AGGATAGATGTATATATAAAGGG + Intergenic
973638668 4:52882801-52882823 AGGATAAATGTAGATATAAAGGG - Intronic
974115915 4:57578897-57578919 AGGATATATGTATATATGAAAGG - Intergenic
974186444 4:58453766-58453788 AGGATATATCTAGATGTATATGG - Intergenic
974221000 4:58970814-58970836 AGGATAGATGTATATATAAAGGG + Intergenic
974286941 4:59881339-59881361 AGGATAGATGTGTATATGAAGGG + Intergenic
974328949 4:60451304-60451326 AGGATATATGTATATATGAAGGG - Intergenic
974479442 4:62424189-62424211 AGGATACATGTATATATAAAGGG + Intergenic
974521199 4:62982411-62982433 TATATATATATGGATATAAATGG + Intergenic
974565307 4:63573257-63573279 AAGATAGATGTATATATAAAGGG - Intergenic
974575239 4:63711189-63711211 AGTATATATGTGGAGAAAATTGG - Intergenic
974589740 4:63929635-63929657 AGGATAGATGTATATATGAATGG + Intergenic
974598716 4:64047623-64047645 ATGATAGATGTATATATAAAGGG - Intergenic
974727603 4:65815624-65815646 AGGATATATGTATATATAAAGGG - Intergenic
974738811 4:65977600-65977622 AGGATAGATGTATACATAAAGGG - Intergenic
974813334 4:66973782-66973804 TGGATATAACTGGATACAAAGGG + Intergenic
974853402 4:67430320-67430342 GAGATAAAAGTGGATATAAAGGG + Intergenic
975060245 4:69988352-69988374 AGGATATGTGTATATATGAAAGG + Intergenic
975235497 4:71990539-71990561 AGGATAGATGTATATATGAAGGG - Intergenic
975357271 4:73422780-73422802 TGGATATATGTATATATCAATGG + Intergenic
975390672 4:73813524-73813546 AGGATAGATGTGGGTAGAACAGG + Intergenic
975681297 4:76879145-76879167 AGGATAGATGTATATATGAAGGG - Intergenic
975737677 4:77397599-77397621 AGGAGAGATGAGGAAATAAAGGG - Intronic
975876175 4:78839607-78839629 AGGATAGATATACATATAAAGGG + Intronic
975934529 4:79562325-79562347 AGGATATATGTATATATGAAGGG - Intergenic
975961940 4:79919805-79919827 AGGATAGATGTATATATAAAAGG - Intronic
976030635 4:80749426-80749448 AGAATATATGTACATATGAAAGG + Intronic
976204625 4:82613101-82613123 AAGATATATGCATATATAAAAGG + Intergenic
976577586 4:86692560-86692582 AGGAGAAATGTCAATATAAATGG - Intronic
976979935 4:91215380-91215402 AGGATAGATGTATATATAAAGGG + Intronic
977001710 4:91512610-91512632 AGGATAGATGTATATATAAAAGG - Intronic
977072220 4:92405859-92405881 AGGATAGATGTATATATAAAGGG + Intronic
977083199 4:92560150-92560172 AGGATAAATGTGGAGAAGAAAGG + Intronic
977449023 4:97170889-97170911 AGGATAGATGTATATATGAAGGG + Intergenic
977528805 4:98175510-98175532 AGGATAGATATATATATAAAGGG - Intergenic
977651930 4:99480088-99480110 AGGATAGATGTATATCTAAAGGG - Intergenic
977721913 4:100249122-100249144 AGGATAGATGTATATATAAAGGG + Intergenic
977776653 4:100929158-100929180 AGGATATAAGCATATATAAAAGG + Intergenic
977870241 4:102082127-102082149 AGGATAAATATATATATAAAAGG + Intergenic
977871733 4:102098238-102098260 GGGATATATGTATATATAAAAGG - Intergenic
977930852 4:102747156-102747178 GGGATATATATATATATAAAGGG + Intronic
977947322 4:102928651-102928673 AGGATATATGTATGTATGAAAGG + Intronic
977963760 4:103118050-103118072 AGAATATATGTGCACACAAAGGG - Intronic
978015453 4:103739325-103739347 TTAATATATGTGAATATAAAGGG + Intergenic
978079345 4:104573255-104573277 AGGATATATGTATATATGAAAGG + Intergenic
978265743 4:106822603-106822625 AGGATATATGTATATATGAAAGG + Intergenic
978309803 4:107373980-107374002 AGGATATATGTATATATGAAGGG - Intergenic
978602058 4:110439127-110439149 AGGACAGATGTATATATAAAGGG + Intronic
978949647 4:114542449-114542471 AGGATAGATGTCTATATAAAGGG - Intergenic
979013538 4:115401404-115401426 AGTATATATGTGGTGAGAAAAGG + Intergenic
979026427 4:115583419-115583441 AGGATAGATGTATATGTAAAGGG + Intergenic
979030600 4:115639459-115639481 AGGATATATGTATATATGAAGGG - Intergenic
979138903 4:117147660-117147682 AGGATATATGCATATATGAAAGG - Intergenic
979142147 4:117190423-117190445 AGGATATATGTATATATGAAGGG - Intergenic
979187720 4:117819159-117819181 AGGATAGATGTATATATGAAAGG - Intergenic
979346727 4:119595805-119595827 AGGATATATGAGGATATATGAGG - Intronic
979719414 4:123881631-123881653 AGGATAGATATATATATAAAGGG - Intergenic
979767304 4:124477009-124477031 AGGATAGATAGGTATATAAAGGG - Intergenic
979774529 4:124572762-124572784 AGGATATATGTATATGTGAAAGG + Intergenic
979786804 4:124725387-124725409 AATATTTATGTGGATATATATGG - Intergenic
979888224 4:126059284-126059306 AGAGTATATGTTTATATAAAAGG + Intergenic
979898068 4:126186223-126186245 AGGATAGATGTATATATGAAGGG + Intergenic
979973654 4:127168938-127168960 AGGATAGATGTCTATATGAAGGG - Intergenic
980004119 4:127521572-127521594 ATGATAAATGTGGAGATACAAGG + Intergenic
980007981 4:127562858-127562880 AGGATAGATGTATATATAAAGGG + Intergenic
980091134 4:128443990-128444012 AGGATATACGTATATATGAAAGG - Intergenic
980217254 4:129868270-129868292 AGGGTAGATGTATATATAAAGGG - Intergenic
980255918 4:130381205-130381227 AGGATAAATGTATGTATAAAAGG - Intergenic
980385461 4:132084231-132084253 AGGACATATGTATATATGAAAGG + Intergenic
980439725 4:132825335-132825357 AGGATAGATGTATATATGAAAGG - Intergenic
980482740 4:133408994-133409016 AGGATATATGTATATATGAAAGG - Intergenic
980513812 4:133826711-133826733 AGGATAGATGTATATATAAAAGG - Intergenic
980601766 4:135036322-135036344 AATATATATGTACATATAAAGGG - Intergenic
980678445 4:136122798-136122820 AAGATCTATGTTAATATAAAAGG - Intergenic
980760398 4:137225550-137225572 GGGATATATATATATATAAAGGG - Intergenic
980764623 4:137285522-137285544 AGTATAGATGTGGTTATTAAAGG - Intergenic
980792187 4:137633758-137633780 AGGATATATGTATATGTGAAAGG - Intergenic
980807823 4:137836427-137836449 AGTATATATGTATATATGAAAGG - Intergenic
980868512 4:138582515-138582537 AGGATAGATATCTATATAAAGGG - Intergenic
980935749 4:139224184-139224206 AGGATAGATGTATATATGAAGGG + Intergenic
981247777 4:142560409-142560431 AGGATAGATGTACATATGAAGGG + Intronic
981619178 4:146674212-146674234 AGGATAGATGTATATATGAAGGG - Intergenic
981655016 4:147103276-147103298 AAAATATATGTGCATATACATGG - Intergenic
981676388 4:147347928-147347950 AGGATAGATTTATATATAAAGGG + Intergenic
982222884 4:153140036-153140058 AGGATAGATGTATATATAAAAGG - Intergenic
982406461 4:155025649-155025671 TGGATATATATGGATTTATATGG - Intergenic
982507391 4:156237796-156237818 ATTATATATGTGTATATATATGG - Intergenic
982783309 4:159513619-159513641 AGGATAGATGTATATATGAAAGG + Intergenic
982789655 4:159576226-159576248 AGGATAGATGTATATATAAAGGG + Intergenic
982839255 4:160161517-160161539 AGGATAGATGTATGTATAAAAGG + Intergenic
982894616 4:160902876-160902898 AGGATAGATGTATGTATAAAAGG - Intergenic
982982791 4:162162889-162162911 AGGTTAGAGGTGGATGTAAATGG - Intronic
983050767 4:163044543-163044565 AGGATAGATGTATATATGAAAGG - Intergenic
983304866 4:165973100-165973122 AGGATATATGTATATATGAAAGG + Intronic
983356473 4:166665501-166665523 TGGATATATATGGATATATATGG + Intergenic
983356474 4:166665511-166665533 TGGATATATATGGATATGTATGG + Intergenic
983356475 4:166665521-166665543 TGGATATGTATGGATATATATGG + Intergenic
983356477 4:166665550-166665572 ATGATATATATGGATATATATGG + Intergenic
983356479 4:166665618-166665640 TGGATATATATGAATATATATGG + Intergenic
983356480 4:166665628-166665650 TGAATATATATGGATATATATGG + Intergenic
983356481 4:166665638-166665660 TGGATATATATGGATATATATGG + Intergenic
983356482 4:166665648-166665670 TGGATATATATGGATATATATGG + Intergenic
983356483 4:166665658-166665680 TGGATATATATGGACATATATGG + Intergenic
983356484 4:166665678-166665700 TGGATATATATGAATATATATGG + Intergenic
983356493 4:166665890-166665912 TGGATATATATGAATATATATGG + Intergenic
983356494 4:166665900-166665922 TGAATATATATGGATATATATGG + Intergenic
983356497 4:166665942-166665964 TGGATATATATGAATATATATGG + Intergenic
983356499 4:166665993-166666015 TGGATATATATGAATATATATGG + Intergenic
983356500 4:166666003-166666025 TGAATATATATGGATATATATGG + Intergenic
983356501 4:166666013-166666035 TGGATATATATGGATATATATGG + Intergenic
983459015 4:168003940-168003962 AGGATATATGTACATATGAAGGG + Intergenic
983459566 4:168011284-168011306 AGGATAGATGTATATATGAAGGG - Intergenic
983481924 4:168285706-168285728 GGCATATATGTGGATATGCATGG + Intronic
983510428 4:168603967-168603989 GAGATATTTCTGGATATAAAAGG - Intronic
983727421 4:170945853-170945875 AGGATAGATGTATATATGAAGGG + Intergenic
983785158 4:171720879-171720901 AGGATATATGTATATATAAAAGG - Intergenic
983864011 4:172741662-172741684 AGAATATATATAGATATAAGAGG + Intronic
983919088 4:173326029-173326051 AGTATATATGCCGATATACATGG - Intergenic
984288783 4:177766652-177766674 AGGATATATGTATATATGAAAGG + Intronic
984400736 4:179260859-179260881 AGAATAGATGTATATATAAAAGG - Intergenic
984639758 4:182148970-182148992 TGGATATATATTGATATATATGG - Intronic
984639759 4:182148990-182149012 CGGATATACGTTGATATATATGG - Intronic
984732863 4:183084593-183084615 AGGATAGATGTATATATAAAGGG - Intergenic
984860500 4:184233423-184233445 AGGATAAATGTATATATAAAGGG - Intergenic
984915183 4:184717235-184717257 AGAAGACATGTGAATATAAATGG - Intronic
985076293 4:186218780-186218802 AGGATAGATGTACATATAAAGGG + Intronic
985131527 4:186743000-186743022 AGGAAATATCTGGACATAAAGGG - Intergenic
985370658 4:189282360-189282382 AGGATAGATGTATATATGAAGGG - Intergenic
986145292 5:5072035-5072057 AGGATAGATGTATTTATAAAGGG + Intergenic
986148717 5:5106950-5106972 TGGAGATATGTGGATAGCAAAGG - Intergenic
986181062 5:5393322-5393344 AGGATAGATGTATATATGAAGGG + Intergenic
986191778 5:5503104-5503126 AGGATATATGTACATATAAAAGG - Intergenic
986226202 5:5816270-5816292 TGGATATATATGGATATATATGG + Intergenic
986226203 5:5816280-5816302 TGGATATATATGGATATATATGG + Intergenic
986226204 5:5816290-5816312 TGGATATATATGGATATATATGG + Intergenic
986226205 5:5816300-5816322 TGGATATATATGGATATATATGG + Intergenic
986226212 5:5816388-5816410 TGGATATATATAGATATATATGG + Intergenic
986226215 5:5816442-5816464 TGGATATATATAGATATATATGG + Intergenic
986226225 5:5816690-5816712 TGGATATATATAGATATATATGG + Intergenic
986226226 5:5816710-5816732 TGGATATATATAGATATATATGG + Intergenic
986382928 5:7204877-7204899 GGGATAGATGTGTATATTAAGGG + Intergenic
986386265 5:7237161-7237183 TGGATATCTGTGGATAAAAGAGG + Intergenic
986427714 5:7651280-7651302 AGGATAGATGTATATATAAAGGG + Intronic
986760689 5:10877099-10877121 AGGATAGATGTATATATGAAAGG + Intergenic
986777597 5:11032039-11032061 AGGATATATGTATATATGAAAGG - Intronic
986927405 5:12772842-12772864 AGGATAGATGTATATATGAAGGG - Intergenic
986981030 5:13448188-13448210 AGGATAGATGTATATATGAAGGG + Intergenic
986997671 5:13625858-13625880 AGGATATATGTATGTATGAAAGG + Intergenic
987107588 5:14655767-14655789 AGGATTGATGTATATATAAAGGG + Intergenic
987158356 5:15114318-15114340 AGGATAGATGTATATATAAAGGG + Intergenic
987702448 5:21418718-21418740 AGGAAATATGAGGAAATAAAGGG + Intergenic
987806039 5:22769604-22769626 AGGATAGATGTATATATGAAGGG - Intronic
987843138 5:23246663-23246685 AGGATAAATGTACATAAAAAGGG - Intergenic
987905251 5:24068661-24068683 AGGATAGATGACTATATAAAGGG + Intronic
987915335 5:24205387-24205409 AGGATATATGTATATTTGAAAGG - Intergenic
987946912 5:24621767-24621789 ATTATATGTGTGCATATAAATGG - Intronic
987994063 5:25251952-25251974 AGGATAGATGAATATATAAAGGG - Intergenic
988050058 5:26015944-26015966 AAGATATATGTATATATGAAGGG - Intergenic
988195371 5:27997990-27998012 AGGATAGATGTACATATAAAGGG - Intergenic
988209328 5:28183195-28183217 AGGATATATGTATATATGAAAGG + Intergenic
988248880 5:28727460-28727482 AGGATAGATGTATATATGAAGGG - Intergenic
988335311 5:29899924-29899946 AGGATATATGTATATGTGAAAGG - Intergenic
988347055 5:30050795-30050817 GGGAAACATGTGGATATAATGGG - Intergenic
988352885 5:30134818-30134840 AAGATAGATGTATATATAAAGGG + Intergenic
988361085 5:30237374-30237396 AGGATATATGTCTATACGAAGGG - Intergenic
988368781 5:30339536-30339558 AGGATAGATGTCTATATAAAGGG - Intergenic
988679334 5:33469406-33469428 AGGATATATGTATATATGAAAGG - Intronic
989153807 5:38325097-38325119 AGGATATATGTGGCAATGACTGG + Intronic
989201015 5:38763752-38763774 AGGATAGATGTATATATGAAGGG - Intergenic
989331672 5:40267071-40267093 AGTATAGATGTATATATAAAAGG - Intergenic
989356741 5:40551841-40551863 AGGATATATGTATACATGAAAGG - Intergenic
989701689 5:44273877-44273899 AGGTTATATATGTATATATATGG - Intergenic
989754860 5:44940114-44940136 AGGATATATGTATATATGAAAGG - Intergenic
989969462 5:50505009-50505031 AGGAAATATGTGTATATGAAAGG + Intergenic
990027200 5:51207711-51207733 GGGATATAAGAGGATAAAAATGG + Intergenic
990031206 5:51261674-51261696 AGGATAGATGTATATATAAAGGG - Intergenic
990120439 5:52444410-52444432 AGGCCATATGAGGATACAAAAGG + Intergenic
990146470 5:52766557-52766579 AGGATATATGTATATAGGAAAGG + Intergenic
990167640 5:53012246-53012268 TGGATTTATTTGGATAAAAAAGG + Intronic
990198463 5:53344600-53344622 AGGATCGATGTATATATAAAGGG - Intergenic
990253104 5:53937194-53937216 AGGATATCTGTGGTTAGGAATGG - Intronic
990436350 5:55795824-55795846 AATATATATGTAGATATAAAAGG + Intronic
991021743 5:61986412-61986434 AGGATATATGGGTTTTTAAATGG + Intergenic
991120157 5:63003861-63003883 AGGATAGATGTATATATGAAGGG + Intergenic
991167043 5:63575448-63575470 AGTATATATGTACATATAAAAGG - Intergenic
991168978 5:63598763-63598785 AGCATATATGTATATATAAAAGG - Intergenic
991402522 5:66268300-66268322 AGCATATATGTGTATAACAATGG - Intergenic
991912408 5:71574789-71574811 AGGAGAAATGAGGAAATAAAGGG + Intergenic
992015739 5:72573573-72573595 AGGATATATGTATATATGAGAGG - Intergenic
992242475 5:74786259-74786281 AGGACAGATGTATATATAAAGGG - Intronic
993069352 5:83140118-83140140 AGGATATATGTATATATGAAAGG + Intronic
993097237 5:83493788-83493810 GGGATATCTGGGGAAATAAATGG - Exonic
993336893 5:86670961-86670983 AGGATAGATGTATATATGAAAGG + Intergenic
993359377 5:86955111-86955133 AAAATATTTGTAGATATAAAAGG - Intergenic
993618423 5:90139798-90139820 AGGATAGATTTATATATAAAGGG + Intergenic
993636582 5:90351846-90351868 AGGATATATGTATATATGAAAGG - Intergenic
993746426 5:91603248-91603270 AGGATAGATGTATATATAAAGGG + Intergenic
993766372 5:91863751-91863773 CAGATATATGTAAATATAAAAGG + Intergenic
994018388 5:94995110-94995132 AGGATAGATGTATATATGAAGGG - Intronic
994051914 5:95371484-95371506 AGGATATATGTATATATAAAGGG - Intergenic
994358816 5:98826724-98826746 AGGATAGATGTATATATAAAAGG + Intergenic
994531206 5:100974118-100974140 AGGATAGATGTATATATAAAGGG - Intergenic
994761611 5:103861465-103861487 AGGATAGATGTATATATGAACGG - Intergenic
994786682 5:104173646-104173668 AGGATATATGTATGTATAAAAGG - Intergenic
994834689 5:104834480-104834502 TACATATATGAGGATATAAAAGG + Intergenic
994852497 5:105073857-105073879 TAGATATATTTGGATATACAAGG + Intergenic
994917282 5:105996188-105996210 AGGATAGATGTGTATATAAAAGG - Intergenic
994955850 5:106531439-106531461 AATATATATGTGTATATATATGG + Intergenic
995030216 5:107472129-107472151 AGAGTAAATGTGGATATTAAAGG + Intronic
995107634 5:108393121-108393143 AGGATATATGTATATATGAAGGG + Intergenic
995119353 5:108519490-108519512 AGGACATATGTGTTTATGAAGGG + Intergenic
995187122 5:109283223-109283245 AGGATATATGTACATATGAAAGG + Intergenic
995265641 5:110156499-110156521 AGGATAGATGTATATATAAAGGG + Intergenic
995291621 5:110462733-110462755 AGGATAGATGTATATATAAAGGG - Intronic
995321399 5:110838169-110838191 AGGATATATGTATATATGAAAGG + Intergenic
995324600 5:110875642-110875664 AAGATAGATGTATATATAAAGGG + Intergenic
995511291 5:112912449-112912471 AAAATATATATGGGTATAAATGG - Intronic
995790884 5:115885199-115885221 AGGATATATGTATATATGAAGGG + Intronic
995977299 5:118054764-118054786 AGGATACATGTATATATGAAAGG - Intergenic
995979665 5:118086458-118086480 AGGATATATGTACGTATATATGG + Intergenic
996036011 5:118759580-118759602 AGGATATATGTATATATGAAAGG + Intergenic
996165391 5:120216037-120216059 AGGATATATGTATATATAACAGG + Intergenic
996223273 5:120959285-120959307 AGGATATATGTATATATGAAAGG - Intergenic
996322529 5:122235094-122235116 AGAATAGATGTATATATAAAGGG + Intergenic
996338566 5:122411525-122411547 AGGAGATATGTGGATAAAAAGGG - Intronic
996399728 5:123048621-123048643 AGGATATATGTATATATGAAAGG + Intergenic
996761901 5:126994686-126994708 AGGATATATGTATATATGAAAGG + Intronic
996908545 5:128630810-128630832 AGGATATATGTATATACGAAGGG + Intronic
997037677 5:130212839-130212861 AGGATATATGTGTATATGAAGGG + Intergenic
997807586 5:136934384-136934406 AAGATATATGTACATATAAAAGG - Intergenic
998116717 5:139543440-139543462 AGGATCTACGTGGGTATAGAGGG - Intronic
998289986 5:140905812-140905834 AGGCTAGATGTGTATATAAAGGG + Intronic
998290765 5:140911927-140911949 AGGATAGATGTATATATAAAGGG + Intronic
998486160 5:142504426-142504448 AGGATAGATGTATATATAAAGGG - Intergenic
998975606 5:147643120-147643142 AGGATAGATGTATATATAATGGG - Intronic
998977433 5:147663567-147663589 AGGATAGATGTATCTATAAAAGG - Intronic
999065443 5:148680601-148680623 AGGGTAGATGTGTATTTAAAGGG - Intergenic
999424128 5:151472095-151472117 AGGATAGATGTACATATATAGGG + Intronic
1000139636 5:158389625-158389647 AGGATAGATGTATATATAAAGGG + Intergenic
1000167603 5:158669722-158669744 TAGATATATGTGTATATATATGG - Intergenic
1000223710 5:159237926-159237948 AGGATATATGTAAATATGAAAGG + Intergenic
1000469337 5:161621220-161621242 AGGATAGATGTATATATGAAAGG + Intronic
1000604386 5:163312653-163312675 AGGATAGATGTATATATGAAGGG - Intergenic
1000679726 5:164168500-164168522 AGGATATATGTATATATGAAAGG + Intergenic
1000853906 5:166375538-166375560 AGGATAGATGTATGTATAAAGGG - Intergenic
1001238130 5:170046857-170046879 AAGATATATGTGGATCTAGACGG - Intronic
1001291206 5:170462752-170462774 TGGATATATATATATATAAATGG + Intronic
1001529639 5:172453381-172453403 AGGTTCTAGGTGGAGATAAAGGG - Intronic
1001799541 5:174530964-174530986 TGGATATAGGTGGGTATATATGG + Intergenic
1001877692 5:175215616-175215638 GGGTTATATGTGGACACAAAAGG - Intergenic
1002684759 5:181001003-181001025 AGTTTATATGATGATATAAACGG + Intronic
1002932914 6:1646730-1646752 AGGATATAGGTGGAAAAAAATGG - Intronic
1002955694 6:1861274-1861296 AGGATACATGTGTATAAAATGGG + Intronic
1003264830 6:4556342-4556364 AGGATAGATATATATATAAAGGG + Intergenic
1003975205 6:11336498-11336520 AGTATGAATATGGATATAAAAGG + Intronic
1004519018 6:16344793-16344815 AGGATAGATGTATATATGAAGGG - Intronic
1004641194 6:17517015-17517037 AGGGTATGTGTGGATATGGATGG + Intronic
1004764762 6:18713628-18713650 AATATATATGTGAAGATAAAGGG + Intergenic
1005178160 6:23071830-23071852 AGGATACATGCATATATAAAGGG + Intergenic
1005741817 6:28798805-28798827 AGTATATATGTATATATATATGG + Intergenic
1005741819 6:28798845-28798867 AGTATATATGTATATATATATGG + Intergenic
1005910859 6:30308267-30308289 AGGGTATATGTGGGGACAAAGGG + Intergenic
1007006814 6:38371814-38371836 AGGTTAGATATTGATATAAATGG - Intronic
1007028759 6:38606287-38606309 AGGATAGATGTATATATGAAGGG - Intronic
1007192397 6:40030722-40030744 AGGATATATGCATATATGAAAGG - Intergenic
1007222245 6:40287927-40287949 AGGATAGATGTATATATAAAGGG - Intergenic
1007294060 6:40807926-40807948 AGGATAGATGTATATATGAAGGG - Intergenic
1008168107 6:48166176-48166198 AGGATATATGTACATATGAAGGG + Intergenic
1008198298 6:48553605-48553627 AGGATATATGTAGATGTGAAGGG + Intergenic
1008337936 6:50328691-50328713 AGGATATATGTATATACAAAGGG - Intergenic
1009315175 6:62210044-62210066 AGGATAGATGTATATATGAAGGG - Intronic
1009341588 6:62561264-62561286 ATGATATATCTGTAAATAAAAGG + Intergenic
1009371515 6:62909037-62909059 AGGGTATGTGTATATATAAAAGG - Intergenic
1009374930 6:62955547-62955569 TGTATATATGTGTATATATATGG + Intergenic
1009389017 6:63122968-63122990 AGTATACATCTGGATACAAAGGG + Intergenic
1009481728 6:64167656-64167678 CAGATATATGTGCATATATATGG - Intronic
1009581355 6:65538192-65538214 AGGATATAAGTTGAAAGAAAAGG + Intronic
1009587403 6:65624960-65624982 AGGATAGATGTGTATATAAAGGG - Intronic
1009616710 6:66017934-66017956 TGGATATATATGGATATATATGG + Intergenic
1009631039 6:66201530-66201552 AGGATAGATGTATATATAAAGGG + Intergenic
1009678182 6:66854730-66854752 GGGATATAAGTGTATATGAAAGG - Intergenic
1009688952 6:67001574-67001596 ATGTCATATGTGGATAAAAACGG - Intergenic
1009929048 6:70154558-70154580 AGTATATATGTATATATGAAAGG + Intronic
1010107607 6:72187852-72187874 AGGATAGATGTATATATAAAGGG + Intronic
1010326609 6:74570765-74570787 AGGATATATGTATATATGAAAGG + Intergenic
1010328468 6:74592923-74592945 AGGATACATGTGTATATAAATGG - Intergenic
1010373670 6:75141044-75141066 TGGATATATTTGGATATACTGGG + Intronic
1010397886 6:75412740-75412762 AGGACATATGTTTATATATATGG + Intronic
1010448987 6:75980834-75980856 AGGATATATGCATATATGAAAGG - Intronic
1010563779 6:77383924-77383946 AGCATACATGTGTATATTAAAGG + Intergenic
1010617616 6:78031656-78031678 AGGATATATGGATATATGAAAGG + Intergenic
1011180738 6:84617425-84617447 AGGATATATGTTTATTTTAAGGG - Intergenic
1011215291 6:84999218-84999240 AAGGTATATATGGATTTAAAAGG + Intergenic
1011324410 6:86133797-86133819 AGGATATATGTATATATGAAAGG + Intergenic
1011328046 6:86172675-86172697 AGGATAGATGGATATATAAAAGG - Intergenic
1011380781 6:86740181-86740203 AAGATATATGTACATATAAAAGG + Intergenic
1011564395 6:88659037-88659059 AGGATAGATGTATATATGAAGGG - Intronic
1011645953 6:89458324-89458346 AGGATATATGTAGGTATGAAAGG + Intronic
1011752297 6:90465481-90465503 AGGATAGATGTATATATGAAAGG + Intergenic
1011820965 6:91253707-91253729 AGGATATGTGTAGGTATAAGTGG - Intergenic
1012002279 6:93667801-93667823 AGGATACATGTATATAAAAAAGG - Intergenic
1012071826 6:94630173-94630195 AGGATAGATGAATATATAAAGGG - Intergenic
1012100499 6:95079233-95079255 AGGATATATATATATATAAAGGG - Intergenic
1012119098 6:95340799-95340821 AGGTTAGCTGTGGTTATAAAGGG - Intergenic
1012420186 6:99056398-99056420 AGGATAGATGTATATGTAAAGGG - Intergenic
1012652635 6:101775785-101775807 ATTATATATGTGTATATATATGG + Intronic
1012720563 6:102737070-102737092 AGGATATATGTATATGTAAAAGG - Intergenic
1012730825 6:102877419-102877441 AGGATAGATATGTATATAAAAGG - Intergenic
1012747867 6:103117445-103117467 AGGATATATGTGTAGATAAATGG - Intergenic
1012750822 6:103161319-103161341 AGGATAGATGTATATATGAAGGG - Intergenic
1013399574 6:109779371-109779393 AGTTTATATGTGGGAATAAAAGG + Intronic
1013416682 6:109931891-109931913 AGGATATATGTATATATAAAAGG + Intergenic
1013442267 6:110182289-110182311 AGGATAGAACTGGAAATAAAAGG - Intronic
1013695400 6:112697191-112697213 TGGATAGATGTATATATAAAGGG + Intergenic
1013751554 6:113413026-113413048 AGGATATTAATTGATATAAAAGG + Intergenic
1013839220 6:114370577-114370599 AGGATAGATGTATATATGAAGGG + Intergenic
1013847546 6:114472027-114472049 AGCATATATGTATATATAAAAGG - Intergenic
1013851318 6:114519727-114519749 AGGATAGATGTATATATAAAGGG + Intergenic
1013927286 6:115488389-115488411 AGGATATATGCACACATAAAAGG - Intergenic
1014087962 6:117370006-117370028 TGAATGTATGTGGATATATATGG + Intronic
1014160053 6:118157423-118157445 AGGATAGATGTATATATGAAAGG + Intronic
1014334831 6:120120262-120120284 AGGATAGATGTACATATGAAAGG - Intergenic
1014389337 6:120841590-120841612 AGGATAGATGTACATATTAAAGG - Intergenic
1014415040 6:121173388-121173410 AGGATACAAGTATATATAAAAGG - Intronic
1014433677 6:121398506-121398528 AGAATAGATGTATATATAAAGGG + Intergenic
1014557668 6:122853562-122853584 AGGATATATGTATATATAAAAGG + Intergenic
1014706550 6:124754970-124754992 AGGATATATGTATAAATGAAAGG + Intronic
1014720857 6:124916666-124916688 AGGATATGGGCTGATATAAATGG + Intergenic
1014908129 6:127055700-127055722 AGGATATATGTGTATATGAAGGG + Intergenic
1015131256 6:129812494-129812516 AGGATATATTTGTATATCAAAGG - Intergenic
1015218181 6:130773969-130773991 AGGATAGATGTATATATAGAGGG - Intergenic
1015466754 6:133557025-133557047 AGGAGATATATATATATAAAGGG + Intergenic
1015726404 6:136303791-136303813 AGGATAGATGTATATATGAAGGG - Intergenic
1015808925 6:137141891-137141913 AGGATAGATGTATATATGAAAGG + Intergenic
1016151134 6:140744610-140744632 AGGATATATGTACATACAAAAGG + Intergenic
1016224212 6:141715136-141715158 AGGATATATGTATTCATAAAAGG + Intergenic
1016244802 6:141968987-141969009 GGGATATATGTATATATAAAAGG - Intergenic
1016250048 6:142030114-142030136 AGGATAGATGTATATATGAAAGG + Intergenic
1016419322 6:143868259-143868281 AGGCTAGATCTGTATATAAAGGG + Intronic
1016508708 6:144815365-144815387 AGGATAGATGTATATATGAATGG + Intronic
1016512617 6:144860334-144860356 AGGATAGATGTATATATGAAAGG - Intergenic
1016657554 6:146539430-146539452 AGGATAGATGTATATATAAAGGG + Intergenic
1016859859 6:148706826-148706848 AGGATAAATGTATATATGAAAGG + Intergenic
1017221666 6:151972700-151972722 AGGATAGATGTATATATAAAGGG + Intronic
1017293300 6:152765939-152765961 AGGATAGATGTATATATGAAAGG + Intergenic
1017330562 6:153193503-153193525 AGGATAGATGTCTATATGAAAGG - Intergenic
1017424457 6:154306055-154306077 AAGATATATGTCTATATGAAAGG - Intronic
1017584173 6:155901898-155901920 AGGATAGATGTATATATAAAGGG - Intergenic
1017952617 6:159148978-159149000 AGGATAGATGTGTATATAAAGGG - Intergenic
1018269803 6:162065062-162065084 AGGATCTATGTGTATATGAAAGG + Intronic
1018486266 6:164243859-164243881 AGGATAGATGTATATATAAAGGG - Intergenic
1018537034 6:164831618-164831640 AGGATAGATGTATATATGAAGGG - Intergenic
1018777016 6:167026903-167026925 AGTATATATGGGTATAGAAATGG + Intronic
1018780730 6:167062958-167062980 AGGATGGATGTAGATGTAAAGGG + Intergenic
1018830433 6:167438373-167438395 AGGATATATGTATACATGAAAGG - Intergenic
1019040379 6:169099087-169099109 AGGATAGATGTTTACATAAAGGG - Intergenic
1019119008 6:169788517-169788539 ATGATATATGTGTACTTAAAAGG - Intergenic
1019255994 7:51562-51584 AGGATAGAAGTGTATATGAAAGG + Intergenic
1019806367 7:3129216-3129238 AGGATAGATGTATACATAAAAGG + Intergenic
1019947455 7:4341349-4341371 AGGATAGATGTATATATGAAGGG + Intergenic
1020579230 7:9973221-9973243 GAGATAGATGTGGTTATAAAGGG + Intergenic
1020621072 7:10519868-10519890 GTGATATATGTGGAAAGAAAAGG + Intergenic
1020623751 7:10551435-10551457 AGGATAGATGTATATATGAAGGG - Intergenic
1020886317 7:13822892-13822914 AGGATAGATCTAGATATGAAGGG - Intergenic
1021157287 7:17226494-17226516 TATATATATGTGGATATATATGG - Intergenic
1021298945 7:18946332-18946354 CACATATAAGTGGATATAAATGG + Intronic
1021355145 7:19644900-19644922 AGGATATATGTATATATGAAAGG - Intergenic
1021523477 7:21560319-21560341 AGGATATATGTATATATGAAAGG + Intronic
1021942411 7:25690869-25690891 AGGATAGATGTATATATAAAGGG + Intergenic
1022884254 7:34625489-34625511 AGGATAGATGTGTATATAAAGGG - Intergenic
1022951481 7:35342787-35342809 AGGATATATGTATATATAAAAGG + Intergenic
1022979301 7:35589048-35589070 AGGATATATGTATATATGAAAGG - Intergenic
1023463664 7:40429353-40429375 AGGATAGATGTATATATAAAGGG + Intronic
1023496914 7:40807712-40807734 AGGATAGATGTATATATAAAGGG + Intronic
1023576816 7:41636700-41636722 AGGATAGATGTATATATAAAGGG + Intergenic
1023637911 7:42230943-42230965 GTGATATATGTGGATTTAAGAGG - Intronic
1023942506 7:44778832-44778854 AGGATAGATGTATATATGAAAGG + Intergenic
1024492792 7:50004529-50004551 AGGATATATGTATCTATAATAGG - Intronic
1024744613 7:52391586-52391608 AGGATAGATGTATATATGAAAGG - Intergenic
1024865126 7:53896510-53896532 AGGATATATGTATATATGAAAGG - Intergenic
1025621968 7:63181622-63181644 AGGACAGATGTCTATATAAAAGG + Intergenic
1026046134 7:66906426-66906448 AGGATAGATGTATATATATAAGG + Intergenic
1026072159 7:67131619-67131641 AGGATAGATGTACATATGAAGGG + Intronic
1026140693 7:67703783-67703805 AGGATAGATGTATATACAAAGGG + Intergenic
1026176596 7:68003016-68003038 AGGATAAATGTATATATAAAGGG + Intergenic
1026181255 7:68042909-68042931 AGGATAGATGTATATATAAAGGG - Intergenic
1026181378 7:68044059-68044081 AGGATACATGTATCTATAAAGGG - Intergenic
1026192799 7:68144855-68144877 AGGCTATATGTATATATGAAAGG - Intergenic
1026346710 7:69480785-69480807 AGGATAACTTTGGATAGAAAGGG + Intergenic
1026507925 7:71002452-71002474 AGGATAGATGTATATATGAAGGG - Intergenic
1026512221 7:71037103-71037125 AGGATAGATGTATATATAAATGG + Intergenic
1026530318 7:71191858-71191880 AGGATAGATGTATATATGAAAGG + Intronic
1026559217 7:71434252-71434274 AAGATAGATGTATATATAAAGGG - Intronic
1026613466 7:71881348-71881370 AGGATAGATGTATATATGAAGGG - Intronic
1027671804 7:81109521-81109543 AGGAAATTTGAGGAAATAAAAGG - Intergenic
1027678984 7:81195286-81195308 AGGATACATGTATATATGAAAGG - Intronic
1027699851 7:81456357-81456379 AGGATAGATGTGTATATGAAGGG - Intergenic
1027777534 7:82485213-82485235 AGGATAGATGTATATATAAAGGG - Intergenic
1027794920 7:82680132-82680154 AGGATATATGCATATATGAAAGG - Intergenic
1027807898 7:82852708-82852730 AGGATATATGTATATATGAAAGG - Intronic
1028044168 7:86094237-86094259 AGGATAGATGTATATATAAAGGG - Intergenic
1028590480 7:92488161-92488183 AGGATGTATGTGGATAAAGGGGG + Intronic
1028787284 7:94810022-94810044 AGGATATATGTATACATGAAAGG + Intergenic
1028828317 7:95299804-95299826 AGGATATATATATATGTAAAGGG - Intronic
1028937696 7:96484791-96484813 AAGATATAAATGGATATAAATGG - Intronic
1029013065 7:97282977-97282999 AGGATAGATGTATACATAAAGGG - Intergenic
1029064391 7:97834892-97834914 AGGAAATTTGTGGATCTTAACGG + Intergenic
1029191132 7:98773028-98773050 AGGATAGATGTATATACAAAGGG + Intergenic
1029806434 7:103001948-103001970 AGGATATATGGATATATAAAAGG - Intronic
1029928318 7:104342532-104342554 ATGCTATTTGTGGGTATAAAAGG - Intronic
1030037607 7:105421413-105421435 AGGATAGATGTACATATGAAAGG + Intergenic
1030241349 7:107329478-107329500 ATTATATATGTGTATATATAGGG - Intronic
1030405990 7:109114296-109114318 AGGATAGATGTGTATATAAAGGG + Intergenic
1030450279 7:109700398-109700420 AGGATATATGAATATATGAAAGG - Intergenic
1030479998 7:110091108-110091130 AGGATAGATGTATATGTAAAGGG + Intergenic
1030506251 7:110427047-110427069 ATAATATATGTAGAAATAAAAGG + Intergenic
1030507040 7:110437521-110437543 AGGATAGATGTATATATGAAAGG - Intergenic
1030532793 7:110730915-110730937 AGGATACATGTAAATTTAAAGGG - Intronic
1030547859 7:110920240-110920262 AGGATACATGTATATATAAATGG - Intronic
1030559419 7:111065844-111065866 AGGATAGATATGTATATAAAAGG - Intronic
1030708707 7:112723566-112723588 AGGATGTATGTATATATGAAAGG + Intergenic
1030810918 7:113971120-113971142 AGGATAGATGTACATATGAAGGG + Intronic
1030882759 7:114901688-114901710 AGAATAGATGTAGATATGAAGGG + Intergenic
1030951860 7:115800549-115800571 AGGTTAGATGTATATATAAAGGG - Intergenic
1031092695 7:117379037-117379059 AGGTTAGATGTGGCTATAAAGGG + Intronic
1031144102 7:117978866-117978888 AGGACAGATGTATATATAAAGGG + Intergenic
1031185449 7:118474307-118474329 AGGATAGATGTGTATATGAAGGG + Intergenic
1031303145 7:120089596-120089618 AAGAAATATGTGGATATATATGG + Intergenic
1031382820 7:121109490-121109512 CGGATATATATGTAAATAAAGGG - Intronic
1031455408 7:121973315-121973337 ATGATATATATACATATAAAAGG + Intronic
1031676167 7:124615022-124615044 AGGATAAATGTATATATAAAGGG - Intergenic
1031682363 7:124690105-124690127 AGGATATGTGTACATATGAAAGG - Intergenic
1031882310 7:127211082-127211104 AGGATAGATGTATATATGAAGGG + Intronic
1031893162 7:127318729-127318751 AGGATAGATATTTATATAAAGGG + Intergenic
1031915737 7:127561415-127561437 AGGATGTATGTATATATGAAAGG + Intergenic
1032248880 7:130235811-130235833 AGGATAGATATACATATAAAGGG - Intergenic
1032634598 7:133693046-133693068 AGGATAGATGTATATATGAAGGG + Intronic
1032650194 7:133869516-133869538 TGGAGATGTGTGGATAGAAAGGG - Intronic
1032715145 7:134502554-134502576 AGGATAGATGCAGATATGAAAGG + Intergenic
1033070450 7:138197085-138197107 AGGATAGATGTATATATAAAGGG - Intergenic
1033403591 7:141050694-141050716 TGGATATATGTATATATGAAAGG + Intergenic
1033487900 7:141809622-141809644 AGGATATATGTATATATGAAAGG + Intergenic
1033501167 7:141951096-141951118 AGGATAGATGTATATATGAAGGG - Intronic
1033508687 7:142032455-142032477 AACATATATGTGGAGAGAAAAGG - Intronic
1033861225 7:145630502-145630524 AGGATATATGTATGTATGAAAGG - Intergenic
1033985325 7:147219214-147219236 AGGCTATATGTATATATGAAGGG + Intronic
1034076881 7:148240622-148240644 AGGATAGATGCATATATAAAGGG + Intronic
1034824740 7:154251470-154251492 AGGATATATGCATATATAAAAGG + Intronic
1035360385 7:158309499-158309521 AGGATAGATGTGTATATAAAGGG - Intronic
1036032326 8:4988041-4988063 AGGATAAATGTATATATAAAGGG - Intronic
1036506028 8:9356838-9356860 AGGATGTAGGTGCATATAAAAGG - Intergenic
1036521141 8:9492623-9492645 AGGATACATCTGGATTTTAAAGG + Intergenic
1037078888 8:14757994-14758016 TGGATGTATGTGTATATACATGG - Intronic
1037177797 8:15967378-15967400 AGGATAGATGTATATATAAAGGG - Intergenic
1037391059 8:18392221-18392243 AGGATAGATGTATACATAAAGGG + Intronic
1037687619 8:21156927-21156949 AATTTATTTGTGGATATAAATGG - Intergenic
1037748629 8:21665574-21665596 AGGATAGATGTATATATGAAAGG - Intergenic
1038397215 8:27255733-27255755 AGGAAAAATGTGGTTAAAAATGG + Intronic
1038715053 8:29984098-29984120 AGGATATATGTATATATGATGGG - Intergenic
1038914776 8:32008941-32008963 TGGATATATGTGGATATACCTGG - Intronic
1038997342 8:32939136-32939158 AGGATATATGTGGTCAGCAAAGG + Intergenic
1039016750 8:33157865-33157887 AGGAAATATGTGCATATACCAGG + Intergenic
1039131703 8:34272313-34272335 AGGAGATATGTACATAAAAAAGG + Intergenic
1039169963 8:34733240-34733262 AGAATATATTAGGATATCAAAGG + Intergenic
1039230270 8:35438930-35438952 AGCATATAAGTGGAGATAAAAGG + Intronic
1039280006 8:35974252-35974274 AGGATAGATGTATATATAAAGGG + Intergenic
1039291348 8:36097280-36097302 AGTATAAAAGTGGCTATAAAAGG + Intergenic
1039383860 8:37113196-37113218 AGGATAAATGTAGATATAAAAGG + Intergenic
1039385417 8:37131343-37131365 AGGATAGATGTGTCTATAAAGGG + Intergenic
1039419774 8:37426548-37426570 AGGATAGATGTGTATATGAAAGG - Intergenic
1039651823 8:39349279-39349301 AGGATAGATGTATATATAAAGGG - Intergenic
1039745008 8:40417200-40417222 AGGACAGATGTATATATAAAGGG + Intergenic
1040351251 8:46571458-46571480 AAGAAATATGTGGATCTTAAAGG + Intergenic
1040394935 8:46988741-46988763 AGGATCTATATAGATATATATGG - Intergenic
1040428633 8:47315680-47315702 AGGATATAAAAGCATATAAATGG + Intronic
1040478603 8:47803274-47803296 AAGATATAAGTGGATAAAAGCGG + Intronic
1040613295 8:49008613-49008635 TGAATATAAGTGGATATAAGTGG + Intergenic
1040660871 8:49573544-49573566 AGGATAAATGTATACATAAAAGG - Intergenic
1040677320 8:49766028-49766050 AGAATATACGTATATATAAAAGG - Intergenic
1041210826 8:55549357-55549379 AGGATATATGTTTGTATGAAAGG - Intergenic
1041213604 8:55577921-55577943 GGGATATATATGGAAATATATGG - Intergenic
1041408242 8:57525573-57525595 AAAATATATGTGAATCTAAAAGG + Intergenic
1041925401 8:63230835-63230857 AGGATATATGTATATATGCAAGG - Intergenic
1042101425 8:65279436-65279458 AGGATAGATGTATATATGAAGGG + Intergenic
1042388067 8:68201351-68201373 AGGGTAGATGTATATATAAAGGG + Intronic
1042538756 8:69886176-69886198 AGGGTAGGTGTGGCTATAAAAGG + Intergenic
1042683988 8:71417224-71417246 AGGATAGATGTATATATAAAGGG - Intronic
1042855311 8:73261202-73261224 AGGATAGATGTATATATGAAGGG - Intergenic
1043018507 8:74970538-74970560 AGGATGTTTGTGTATATGAAAGG - Intergenic
1043095532 8:75965726-75965748 TGGATATATGTGGATATATGTGG - Intergenic
1043180892 8:77085286-77085308 AGGATAGATGTATTTATAAAGGG - Intergenic
1043273345 8:78361851-78361873 AGGATAGATGTATATATGAAGGG + Intergenic
1043364224 8:79513126-79513148 AGGGTAGATGTGGAAAGAAAAGG - Intergenic
1043509207 8:80932949-80932971 AGGATAGATGTATATATGAAGGG - Intergenic
1043652678 8:82617022-82617044 AGAATATATATGCATATACATGG - Intergenic
1043662079 8:82755895-82755917 AAGATATATGTAGATATAAAAGG - Intergenic
1043716203 8:83490074-83490096 AGGATATATGTATATATGAGAGG + Intergenic
1043886267 8:85604218-85604240 AGGATAAATATATATATAAAGGG + Intergenic
1043951152 8:86310459-86310481 GGGATATATGTATATATAAAAGG - Intronic
1044294091 8:90506933-90506955 AGGATAGATGTATATATAAAGGG - Intergenic
1044330571 8:90915603-90915625 AGGATAGATGTTTATATGAAGGG + Intronic
1045588353 8:103564375-103564397 AGGATAGATGTATATATAAAGGG + Intronic
1045620763 8:103975579-103975601 AGGATATATGTATATACGAAAGG + Intronic
1045642659 8:104268992-104269014 AAGATATATGTATATATGAAAGG - Intergenic
1045711765 8:104993069-104993091 AGGATATATGTATATATGAAGGG + Intronic
1045932713 8:107646072-107646094 AGGATAAATGTATATATGAAGGG + Intergenic
1046029504 8:108766634-108766656 AGGATACATGTATATATGAAAGG + Intronic
1046119821 8:109831760-109831782 AGGATATATGTATATATGAAAGG - Intergenic
1046258772 8:111738236-111738258 AGGATATATGTCTATATATATGG - Intergenic
1047028812 8:120853528-120853550 AGGAAAGATGTGTATATAAGGGG + Intergenic
1047054044 8:121144728-121144750 AGGATAGATGTATATATAAAGGG + Intergenic
1047160174 8:122369570-122369592 AGGATATATGTATATATGAAAGG + Intergenic
1047375842 8:124295220-124295242 AGGATATATGTATATATGAAAGG - Intergenic
1047449328 8:124949622-124949644 AGGATAGATGTATATATAAAAGG - Intergenic
1047610230 8:126513638-126513660 AGGACATTTGTGGAAAAAAATGG - Intergenic
1047885703 8:129248213-129248235 AGGATAGACGTATATATAAAGGG + Intergenic
1048029473 8:130617564-130617586 AGGATAGATGTATATATAAAAGG + Intergenic
1048217278 8:132507943-132507965 AGGATAGATGTATATATAAAGGG + Intergenic
1048337181 8:133511732-133511754 AGGATAGATGTATATATAAAGGG + Intronic
1048499442 8:134962301-134962323 AGGATATATGTATATAGGAAGGG - Intergenic
1048521550 8:135160079-135160101 AGGATAGATGTACATATGAAAGG - Intergenic
1048601457 8:135923028-135923050 AGGATATATGTACATATGGAAGG - Intergenic
1048841635 8:138571886-138571908 AGGATAGATGTATATATGAAAGG - Intergenic
1048895160 8:138985536-138985558 AGGATATATGTATATATGAAAGG - Intergenic
1048952777 8:139509921-139509943 AGGATAGATGTACATATAACAGG + Intergenic
1049073898 8:140378570-140378592 AGGATATATACATATATAAAGGG - Intronic
1049239948 8:141532396-141532418 AGGATAGATGTATATATAAAGGG - Intergenic
1049737150 8:144214803-144214825 AGGATACATGTGTATATGAAGGG + Intronic
1050132482 9:2427074-2427096 AGGAAATATGGGCATAGAAATGG - Intergenic
1050214152 9:3303798-3303820 AGGAAATATGTGGGTGAAAATGG + Intronic
1050233601 9:3555291-3555313 AGGATATATGTATATATGAAAGG + Intergenic
1050313556 9:4377543-4377565 AGGATATATGTATATATGAAAGG - Intergenic
1050494945 9:6230731-6230753 AGGATCTATGAGGATATAGTGGG - Intronic
1050657591 9:7846294-7846316 AGGATAGATGTATATATGAAGGG + Intronic
1050771501 9:9206916-9206938 AGGATAGATGTATATATGAAAGG - Intronic
1050888423 9:10793874-10793896 AGAACATATGTATATATAAAAGG + Intergenic
1050975749 9:11936143-11936165 AGGACATATGTGTATATCAAAGG + Intergenic
1050991042 9:12152442-12152464 AGGATAGATGTGTATACAAAGGG - Intergenic
1051227573 9:14918068-14918090 AGGATAGATGTATATAAAAAGGG + Intergenic
1051547510 9:18292911-18292933 AGGATATATGTATATATGAAAGG - Intergenic
1051551715 9:18337435-18337457 AGGATAGATGTATATATGAAAGG - Intergenic
1051719107 9:20017501-20017523 AGGATAGATGTACATATGAAAGG + Intergenic
1051776897 9:20644183-20644205 AGGATATACGTATATATGAAGGG - Intergenic
1051861446 9:21629325-21629347 AGGGTATATGTATATATGAAAGG - Intergenic
1051995764 9:23215598-23215620 ATTATATATGTTTATATAAAAGG - Intergenic
1052024916 9:23563528-23563550 GTGATACATGTGGTTATAAAGGG - Intergenic
1052028404 9:23600862-23600884 ATGATATATGTGTATGGAAAAGG - Intergenic
1052097163 9:24396938-24396960 AGGATATATGTATATATGAAAGG - Intergenic
1052294242 9:26879972-26879994 AGGATATATGTATATGTGAAAGG - Intronic
1052382959 9:27791040-27791062 AGGATATATGTATATATGAAGGG - Intergenic
1052440775 9:28494015-28494037 AGCATAGATGTATATATAAAGGG - Intronic
1052789399 9:32860603-32860625 AGGATATATGTATATATGACGGG + Intergenic
1053095788 9:35327233-35327255 AGGATATATGTATATATAAAAGG + Intronic
1053604946 9:39648217-39648239 AGGATATATGTATATACGAAAGG - Intergenic
1053862823 9:42404567-42404589 AGGATATATGTATATACGAAAGG - Intergenic
1054248595 9:62694198-62694220 AGGATATATGTATATACGAAAGG + Intergenic
1054562709 9:66728724-66728746 AGGATATATGTATATACGAAAGG + Intergenic
1055207995 9:73756628-73756650 AGGGTATCTGTGGATTCAAAGGG - Intergenic
1055728268 9:79255201-79255223 AGCATTTATGTGGATTTGAAGGG - Intergenic
1055791070 9:79923749-79923771 AGGATACATGTACATATGAAAGG - Intergenic
1055800078 9:80025089-80025111 AGGAAAAATGTATATATAAAGGG + Intergenic
1055878121 9:80967373-80967395 AGGATATATGTATATATGAAAGG - Intergenic
1055907887 9:81314904-81314926 AGGATATACGTATATATGAAAGG - Intergenic
1056185949 9:84135056-84135078 AGGATAGATGTATATATGAAGGG - Intergenic
1056452883 9:86733894-86733916 AGGATATATGTATATATAAAAGG + Intergenic
1057188261 9:93071174-93071196 AGCATAGATGTATATATAAAGGG + Intronic
1057706870 9:97400897-97400919 AGGATAGATGTATACATAAAGGG + Intergenic
1057762216 9:97885809-97885831 AGCATATATCTAGGTATAAAAGG + Intergenic
1057866429 9:98685423-98685445 AGGATAGATGTATATATGAAGGG - Intronic
1057915200 9:99049976-99049998 AGGACATTTGAGGATAGAAAGGG - Intronic
1058090773 9:100803271-100803293 AGGATAGATGTATATATGAAAGG + Intergenic
1058094739 9:100846845-100846867 AGGATACATGTATATATGAAAGG + Intergenic
1058235015 9:102479314-102479336 AGCATATATGTATATATGAAAGG + Intergenic
1058340264 9:103886957-103886979 AGGATATATGTGTATATAAAAGG + Intergenic
1058386727 9:104445060-104445082 AAGATATATGTATATATGAAGGG - Intergenic
1058649838 9:107164972-107164994 AGGATAGATGTATATATAAAGGG - Intergenic
1058946834 9:109865065-109865087 AGGATTTAGGTAGATACAAATGG - Intronic
1059306497 9:113357344-113357366 AGGGTACATGTGGCTATAAAAGG - Intronic
1059550830 9:115227295-115227317 AGAATATATGTATATATGAAAGG + Intronic
1059580971 9:115547902-115547924 AGGATAGATGTATATATGAAGGG - Intergenic
1059599136 9:115757268-115757290 AAGATCTATGTGGGTATAAATGG + Intergenic
1059809058 9:117835756-117835778 AGAATAAATATGTATATAAAGGG - Intergenic
1059889027 9:118780303-118780325 AGGATAGATGTATATATGAAAGG - Intergenic
1059929440 9:119246561-119246583 AGGATAGATGTATATATAAAGGG - Intronic
1060007517 9:120013796-120013818 AGGATAGATGTATATATGAAGGG - Intergenic
1060860225 9:126948031-126948053 CTGATATGTGTGGATATACAGGG - Intronic
1060982071 9:127798722-127798744 CTGCTATATGTGGGTATAAAAGG + Intronic
1061467329 9:130791881-130791903 AGGATATATGTATATATGAAAGG - Intronic
1061656424 9:132094710-132094732 AGGATAGATGTATATATGAAAGG + Intergenic
1062179285 9:135182211-135182233 AGGATAGATGTACATATAAAAGG - Intergenic
1062603773 9:137333386-137333408 AGGATAGATGTGCATACGAAAGG - Intronic
1203516892 Un_GL000213v1:9923-9945 AGTGTAAATGTGCATATAAAAGG - Intergenic
1203382486 Un_KI270435v1:69735-69757 AGGAAATATATTTATATAAAAGG + Intergenic
1203402097 Un_KI270519v1:117173-117195 AGGAAATATATTCATATAAAAGG + Intergenic
1185823897 X:3230683-3230705 AGGATCTATGTGTATATGAAAGG + Intergenic
1185849173 X:3469313-3469335 AGGATAGATGTGTCTATGAAAGG - Intergenic
1185990511 X:4889790-4889812 GGGATATATGTATATATGAAAGG - Intergenic
1186055259 X:5643222-5643244 AGGATAGATGTATATATAAAGGG + Intergenic
1186129917 X:6455516-6455538 AGGATAGATGTATATATAAAGGG + Intergenic
1186139433 X:6555422-6555444 AGGATAGATGTATATATAAAGGG - Intergenic
1186151285 X:6677144-6677166 AGGATAGATGTATACATAAAGGG - Intergenic
1186183244 X:6993188-6993210 AGGATAGAGGTATATATAAAGGG - Intergenic
1186187260 X:7033327-7033349 AGGATAGATGTATATATAAAGGG - Intergenic
1186217474 X:7315462-7315484 AGGATAGATGTCTATATGAAAGG + Intronic
1186304569 X:8241827-8241849 AGGATAGATGTATATATAAAGGG + Intergenic
1186334829 X:8574829-8574851 AGGATAGATGTATATATAAAGGG - Intronic
1186906898 X:14120378-14120400 AGGATAGATGTATATATGAAAGG + Intergenic
1187148959 X:16664317-16664339 AGGAAATATGTTTATATTAAAGG + Intronic
1187319498 X:18227072-18227094 AGGATAGATGTATATATAAAGGG + Intergenic
1187523906 X:20037096-20037118 AGGATAGATGTATATATAAAGGG + Intronic
1187524335 X:20040294-20040316 AGGATAGATGTATATATAAAGGG - Intronic
1187660270 X:21538561-21538583 AGGATATATGTATATATGAAAGG + Intronic
1187801577 X:23069544-23069566 AGGATATATGTATATATAAAAGG + Intergenic
1187927575 X:24263998-24264020 AGGATAGATGTGTCTATGAAAGG + Intergenic
1187932309 X:24304600-24304622 AGGATAGATGTATATATTAAGGG - Intergenic
1188163708 X:26834692-26834714 AGGATATATGTATATATAGAAGG - Intergenic
1188338916 X:28974915-28974937 AGGATATGTATAGATATAAATGG + Intronic
1188761692 X:34040275-34040297 AGGATATATGTTTACATAAAAGG - Intergenic
1188767810 X:34117884-34117906 AGGATATATGTATACATAAAAGG - Intergenic
1188775758 X:34216321-34216343 AGGATATATGTATATATAAAAGG - Intergenic
1188978787 X:36707236-36707258 AGGGTATCTGTGGACATACAGGG + Intergenic
1189785611 X:44556520-44556542 AGGATATATGTGTATATGAAAGG + Intergenic
1189924665 X:45940094-45940116 CGTAAGTATGTGGATATAAATGG + Intergenic
1190010505 X:46780634-46780656 AGGACATATGTATATATGAAAGG + Intergenic
1190019742 X:46863286-46863308 AGCATATATGTGCAGATAGATGG + Intronic
1190035274 X:47017632-47017654 TGCATATATGTATATATAAATGG + Intronic
1190169600 X:48101426-48101448 AGGATATATGTATATAAAAAGGG + Intergenic
1190524722 X:51317222-51317244 AGGATATATGCCTATATGAAAGG - Intergenic
1190545554 X:51522812-51522834 AGGATATATGCCTATATGAAAGG + Intergenic
1190970091 X:55340304-55340326 AGGATAGATGTATATATAAATGG - Intergenic
1191013319 X:55784224-55784246 AGGATGTATATGTATATGAAAGG + Intergenic
1191718893 X:64212879-64212901 AGGATATATGTATATATGAAAGG + Intergenic
1191719668 X:64219000-64219022 AGGATATATGTATATGTAAAAGG + Intergenic
1191732408 X:64351502-64351524 AGGATATATGTATATAGGAAAGG + Intronic
1191862918 X:65680627-65680649 AGCATACATGTGGGAATAAATGG - Intronic
1191991411 X:67040799-67040821 AGGATAGATGTTTATACAAAGGG + Intergenic
1192163248 X:68804394-68804416 AGGGTATATGTGAAAATTAAAGG + Intergenic
1192319621 X:70079177-70079199 AGCATTTATGTGGAGATTAAGGG + Intergenic
1192995822 X:76512243-76512265 AGGATAGATGTATATATAAAGGG - Intergenic
1192996512 X:76518353-76518375 AGGATAGATGTATATATAAAGGG - Intergenic
1193121165 X:77824115-77824137 AGGATAGATGTGTATATGAAGGG - Intergenic
1193350549 X:80458944-80458966 AGCATATGTGTAGATATATAAGG - Intergenic
1193398362 X:81012837-81012859 AGAATAGATGTATATATAAAAGG + Intergenic
1193442439 X:81559366-81559388 AAGATATATGTATATATAAAAGG - Intergenic
1193444505 X:81583761-81583783 AGGATAGATGTATATATAAAGGG + Intergenic
1193563534 X:83049673-83049695 AGGATATATGTATATATGCAAGG + Intergenic
1193564372 X:83059410-83059432 AGGATATAGGTATATATAAAAGG + Intergenic
1193846771 X:86481239-86481261 AAGATATATGTGTACAAAAATGG - Intronic
1193852246 X:86553020-86553042 AGGATAGATGTATATATGAAGGG + Intronic
1193915285 X:87355551-87355573 AGGATAGATGTATATATGAAAGG + Intergenic
1194064947 X:89249738-89249760 AGGATATATGCATATATGAAAGG - Intergenic
1194071824 X:89334366-89334388 AGGATATATGTGTATATAAAGGG + Intergenic
1194077952 X:89420103-89420125 AGGATATATGTATATATGAAAGG + Intergenic
1194128951 X:90055450-90055472 AGGATATATGTATGTATGAAAGG + Intergenic
1194179363 X:90694095-90694117 AGGATAGATTTATATATAAAGGG + Intergenic
1194180087 X:90700300-90700322 AGGATATATGTATATAGTAAAGG + Intergenic
1194255091 X:91625744-91625766 AGGATATATGTATATATGAAAGG + Intergenic
1194278989 X:91923698-91923720 AGGGTATATGTATATATGAAGGG - Intronic
1194294903 X:92115463-92115485 AGTATATATGTATATATTAAAGG + Intronic
1194343629 X:92733828-92733850 AGGATAGATGTATATATAAAGGG - Intergenic
1194345671 X:92761550-92761572 AGGATACATGTATATATGAAAGG - Intergenic
1194474916 X:94346706-94346728 AGGATATATGTACATATAAAAGG - Intergenic
1194477754 X:94379877-94379899 AGGATAGATGTATATATAACAGG + Intergenic
1194488629 X:94518586-94518608 AGGATATATGCATATGTAAAAGG + Intergenic
1194521445 X:94922993-94923015 AGGATATACGTACATATAGAAGG - Intergenic
1194823876 X:98537795-98537817 AGGATAGATGTATATATAAAGGG - Intergenic
1194824962 X:98550535-98550557 ATGATATATGTATATATGAAGGG + Intergenic
1194885456 X:99310468-99310490 AGGATAGATATACATATAAAGGG + Intergenic
1194910567 X:99637640-99637662 AGGATATATGTATATATGAAAGG - Intergenic
1195271577 X:103236589-103236611 AGGATATAGGTATATATGAAAGG + Intergenic
1195309232 X:103614772-103614794 AGGATGGATGTATATATAAAGGG - Intronic
1195420494 X:104670043-104670065 AGGATAGATGTATATATGAAAGG + Intronic
1195437877 X:104865947-104865969 AGGATATATGTATATATGAAGGG - Intronic
1195731572 X:107973541-107973563 AGGATATATTGGTAAATAAATGG + Intergenic
1195999723 X:110768879-110768901 AGGATATATGTATACATGAAAGG - Intronic
1196083108 X:111654821-111654843 TGGATATATATGCATATATATGG + Intergenic
1196364649 X:114911038-114911060 AGCATATATGTTGAAAGAAAAGG - Intergenic
1196512242 X:116525383-116525405 AGGATAGATGTATATATGAAAGG + Intergenic
1196558216 X:117116836-117116858 ATGATATATGTATATATGAAGGG + Intergenic
1196666730 X:118325087-118325109 AGGATAGATGTTTATATGAAAGG - Intergenic
1196772356 X:119307748-119307770 AGGATAGATGTATATATGAAGGG - Intergenic
1196878026 X:120172567-120172589 AGGATATATATATATATATATGG - Intergenic
1196878028 X:120172590-120172612 AGGATATATATATATATATATGG - Intergenic
1196933948 X:120710518-120710540 AGGATATATGTATATATAAAGGG - Intergenic
1197013717 X:121598621-121598643 AGGATAGATGTATATATAAAGGG + Intergenic
1197062537 X:122198499-122198521 AGGATAGATGTATATAAAAAGGG + Intergenic
1197079383 X:122394078-122394100 AGGATAGATGTATATATAAAGGG - Intergenic
1197110118 X:122763040-122763062 AGAATATATGTATATATGAAAGG + Intergenic
1197353560 X:125405750-125405772 AGGGCATATGTGCATGTAAATGG + Intergenic
1197364433 X:125546180-125546202 AGAATATATGTATATATGAAAGG + Intergenic
1197388447 X:125828984-125829006 AGGATATATGCATATATGAAAGG - Intergenic
1197399208 X:125969182-125969204 AGGATAGATGTACACATAAAGGG + Intergenic
1197426886 X:126307853-126307875 AGAATATATGTATATATGAAAGG + Intergenic
1197456971 X:126689082-126689104 AGCATAGATGTATATATAAAGGG + Intergenic
1197537684 X:127709634-127709656 AGGACATATGTATATATGAAAGG - Intergenic
1197554739 X:127939219-127939241 AGGATAGATGTATATATGAAAGG + Intergenic
1197845681 X:130799478-130799500 AGGGTAGATGTATATATAAAGGG - Intronic
1198546186 X:137695200-137695222 AGGATAGATGTATATATGAAAGG - Intergenic
1198593306 X:138208885-138208907 AGGATAGATGTATATATGAAAGG + Intergenic
1198615344 X:138452444-138452466 AGGATACATGTATATATGAAGGG - Intergenic
1198698568 X:139370887-139370909 TTGATATATGTGGTTATAAAAGG - Intergenic
1198710939 X:139503122-139503144 TGGATATATATGGATATATATGG - Intergenic
1198710944 X:139503186-139503208 TGTATATATATGGATATATATGG - Intergenic
1198710945 X:139503196-139503218 TGGATATATATGTATATATATGG - Intergenic
1198710948 X:139503236-139503258 TGGATATATATGGATATATATGG - Intergenic
1198710949 X:139503246-139503268 TGGATATATATGGATATATATGG - Intergenic
1198834521 X:140788869-140788891 TGTATATATGTGTATATATATGG - Intergenic
1198933582 X:141884470-141884492 AGGATAGAGGTATATATAAAGGG - Intronic
1199012623 X:142775763-142775785 AGGACAAATGTCTATATAAAAGG - Intergenic
1199046722 X:143182861-143182883 AGGATAGATGTGTATATGAAGGG - Intergenic
1199111138 X:143936164-143936186 AGGATATATGTATATATGAAAGG - Intergenic
1199114080 X:143969694-143969716 AGGATATATGTTTATATGAAAGG + Intergenic
1199116224 X:143996512-143996534 AGGATATATGTATAAATAAAGGG + Intergenic
1199125525 X:144114814-144114836 AGAATATCTGTGGAAAGAAACGG + Intergenic
1199155925 X:144549185-144549207 GGGATAGATGTACATATAAAGGG - Intergenic
1199155930 X:144549216-144549238 AATATATATGTATATATAAAGGG - Intergenic
1199277395 X:145962388-145962410 AGGATATATATAAATATAAAGGG - Intergenic
1199287093 X:146065553-146065575 AGTATATATGTATATATGAAAGG - Intergenic
1199374774 X:147095125-147095147 AGGATCTTTGTGGTTGTAAATGG + Intergenic
1199682640 X:150237728-150237750 AGGATGTTTGTGTATGTAAATGG - Intergenic
1200345907 X:155448512-155448534 AGGATAGATGTATATATAAAGGG + Intergenic
1200430599 Y:3075657-3075679 AGGATATATGTATATATGAAAGG + Intergenic
1200526029 Y:4276268-4276290 AGGATAGATTTATATATAAAGGG + Intergenic
1200526744 Y:4282468-4282490 AGGATATATGTATATAGTAAAGG + Intergenic
1200573876 Y:4865320-4865342 AGGATATATGTATATATGAAAGG + Intergenic
1200596466 Y:5147199-5147221 AGGGTATATGTATATATGAAGGG - Intronic
1200612399 Y:5339983-5340005 AGTATATATGTATATATTAAAGG + Intronic
1200651982 Y:5850491-5850513 AGGATAGATGTATATGTAAAGGG - Intergenic
1200654017 Y:5878201-5878223 AGGATACATGTATATATGAAAGG - Intergenic
1200719123 Y:6583815-6583837 AGGATATATGTATATATGAAAGG - Intergenic
1200726070 Y:6670094-6670116 AGGATATATGTGTATATAAAGGG + Intergenic
1200745635 Y:6901641-6901663 GGAATATATATGCATATAAAAGG + Intergenic
1201400999 Y:13603819-13603841 AGGATATATGTATACATGAAAGG + Intergenic
1201480918 Y:14438607-14438629 AAGATAAATGTGTATATAAGGGG + Intergenic
1201746907 Y:17386167-17386189 AGGATAGATGTATATATTAAAGG + Intergenic
1202079948 Y:21073971-21073993 AAGATAGATGTGTATATGAAGGG + Intergenic
1202274690 Y:23103601-23103623 AGGAGAGATGTGTATATGAAAGG - Intergenic
1202291337 Y:23317085-23317107 AGGAGAGATGTGTATATGAAAGG + Intergenic
1202427682 Y:24737337-24737359 AGGAGAGATGTGTATATGAAAGG - Intergenic
1202443109 Y:24932757-24932779 AGGAGAGATGTGTATATGAAAGG + Intergenic