ID: 1098041037

View in Genome Browser
Species Human (GRCh38)
Location 12:66354227-66354249
Sequence CCTTAGATGCAGAGAGACCC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 228
Summary {0: 1, 1: 0, 2: 1, 3: 16, 4: 210}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1098041037_1098041040 -9 Left 1098041037 12:66354227-66354249 CCCGGGTCTCTCTGCATCTAAGG 0: 1
1: 0
2: 1
3: 16
4: 210
Right 1098041040 12:66354241-66354263 CATCTAAGGCCAACCACAGCTGG 0: 1
1: 0
2: 0
3: 4
4: 92

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1098041037 Original CRISPR CCTTAGATGCAGAGAGACCC GGG (reversed) Intronic
900098881 1:952595-952617 CATTTGCTGCGGAGAGACCCGGG + Exonic
900692110 1:3987259-3987281 CCTCAAGTGCAGGGAGACCCAGG - Intergenic
900874090 1:5329196-5329218 CCACAGATGCAGAGAGAGACAGG + Intergenic
902094759 1:13933865-13933887 CCTTAGAGGCAGACAGCCCTGGG - Intergenic
902134771 1:14295543-14295565 ACAGACATGCAGAGAGACCCAGG + Intergenic
902328802 1:15720331-15720353 CCCTAGAAGAAGAGAGAACCAGG + Intronic
902470068 1:16643035-16643057 CCTCAGATGCTGAGAAATCCAGG - Intergenic
903013641 1:20348077-20348099 CTTTAGAGTCAGAAAGACCCAGG - Intronic
903323459 1:22556123-22556145 TCCTAGATGCAGAGAGCCCTTGG + Intergenic
903476349 1:23621562-23621584 CTTTGGATCCAGAGAGACCTGGG - Intronic
904296617 1:29523489-29523511 CCTTAGAGTCAGAGACACCTGGG + Intergenic
904455613 1:30646409-30646431 CCTTGGAGTCAGACAGACCCAGG - Intergenic
904463519 1:30694321-30694343 CCTTAGAGCCAGAGACACCTGGG - Intergenic
904966040 1:34373454-34373476 CCTTTGGTCCAGAGAGACTCAGG - Intergenic
906686226 1:47765174-47765196 ACTGAGATCCAGAGAGAACCAGG - Exonic
907125003 1:52041976-52041998 CTTTAGATTCAGAAAGACCTAGG + Intronic
907574634 1:55514964-55514986 CCTGAGACTCAGTGAGACCCTGG - Intergenic
913117006 1:115706487-115706509 CCTGGGAACCAGAGAGACCCTGG + Intronic
917495516 1:175537010-175537032 CTTTAGATGCAGAGAGGCTGTGG - Intronic
919745939 1:201009207-201009229 CATTGGATGCAGGGAGACCAAGG + Intronic
922057974 1:222059496-222059518 TTTTAGATACAGATAGACCCTGG - Intergenic
922912501 1:229229525-229229547 CCTCAGACCCAGAGAGACGCTGG + Intergenic
1063410100 10:5830966-5830988 CCTCAGCTGCAGAGAGTCACTGG + Intronic
1064583788 10:16819307-16819329 CCTTAGAAGAAGAGACACCAAGG - Intergenic
1065491959 10:26291303-26291325 CCATAGATGCAGAGAGCTCCTGG + Intronic
1065856570 10:29835832-29835854 CCTTAGATGAAGAGAGAATAAGG + Intergenic
1066357933 10:34702703-34702725 CTTTAGATGGATAGAGGCCCAGG - Intronic
1067551532 10:47239860-47239882 CCTTAAATTGAGAGTGACCCTGG - Intergenic
1069626780 10:69873057-69873079 CCTCAGATGTGGAGTGACCCAGG + Intronic
1069864504 10:71493266-71493288 CCTTAGAAGCAGAGAGGCCCAGG + Intronic
1073184112 10:101605271-101605293 CCTCAGAGGGAGAGAGACTCTGG - Intronic
1075490067 10:122859040-122859062 CAAAAGATGCAGAGAGACCAAGG - Intronic
1078040408 11:7856421-7856443 GGTTAGATGCAGAGATACCAGGG - Intergenic
1080229190 11:29999355-29999377 CATTAGAAGCAGACAGATCCTGG - Intergenic
1082813922 11:57495936-57495958 CTTTGGATTCAGAGAGACCTCGG - Intronic
1084332343 11:68437608-68437630 CCTTCGCTGCAGAGGGACCTGGG + Intronic
1089346305 11:117793924-117793946 GCTGAGTGGCAGAGAGACCCCGG - Intronic
1089642405 11:119856493-119856515 CCTTAGAGTCTGAGAGACCTGGG + Intergenic
1089900663 11:121980374-121980396 CTTTAGATGCAGAGACACAAAGG + Intergenic
1091788411 12:3256941-3256963 GCTTAGATCCAGGGAGAACCTGG + Intronic
1091825767 12:3511571-3511593 ACTTAGATGCATAGAAACCCAGG - Intronic
1092126297 12:6077325-6077347 CCTAAGGTGCAGAGAGAACCCGG - Intronic
1093784649 12:23178083-23178105 GCTTAGAGACACAGAGACCCTGG - Intergenic
1096109949 12:49022682-49022704 CCTTGGCTGCATAGAGCCCCAGG + Exonic
1096676501 12:53229218-53229240 ACTAAAATGCAGAGAGACCATGG + Intronic
1098041037 12:66354227-66354249 CCTTAGATGCAGAGAGACCCGGG - Intronic
1098874666 12:75854548-75854570 CCTTCGATTCATAAAGACCCGGG - Intergenic
1101592604 12:106138083-106138105 CCTGCGAGGGAGAGAGACCCCGG + Intronic
1101744746 12:107531013-107531035 CCTTAGAGTCAGACAGACCTAGG + Intronic
1102566074 12:113798290-113798312 CCATGGATGCAGAGAGCCCCTGG + Intergenic
1104451020 12:128868206-128868228 CCTGGGATTCAGGGAGACCCAGG - Intronic
1106170317 13:27283086-27283108 CTTTAGATTCAGAGAGATTCAGG - Intergenic
1112791571 13:103008215-103008237 CCAAAGATGAAGAGAGACACAGG - Intergenic
1115770883 14:36663157-36663179 ACCTACAAGCAGAGAGACCCCGG + Exonic
1117227207 14:53674374-53674396 CCTTACAAGAAGAGAGACCATGG + Intergenic
1117998897 14:61504741-61504763 CCTTAGTTTCAGAGACACACTGG + Intronic
1121442963 14:93960251-93960273 CCTCAGTTACAGAGGGACCCTGG - Intronic
1122119452 14:99544236-99544258 CCTTGGCTGTAGACAGACCCAGG - Intronic
1122154464 14:99741995-99742017 CCTTTGGTGCTGAGTGACCCAGG + Intronic
1122598336 14:102908537-102908559 CCTCAGCTGCAGAGAGACCATGG - Exonic
1125489660 15:40137117-40137139 CATTAGATGCAGAGAGCCAGTGG - Intergenic
1127487266 15:59430671-59430693 CTTTAGAAGAAGAGAGACCTTGG + Intronic
1128838019 15:70827076-70827098 GCTTAGAGACAGAGAGACCTTGG + Intergenic
1128858054 15:71037511-71037533 CCTGAGATGCAGAAGAACCCAGG + Intronic
1129609797 15:77044164-77044186 CCTTAGATGCTCTGGGACCCAGG + Exonic
1129929476 15:79398492-79398514 CCTTAGAGCCAGAGAGACCGTGG + Intronic
1130862707 15:87905214-87905236 CTTGACATGCATAGAGACCCTGG + Intronic
1132703807 16:1232596-1232618 CCGGAGATGCAGAGAGACGTGGG + Intergenic
1132707711 16:1253799-1253821 CCGGAGATGCAGAGAGACGTGGG - Intergenic
1132951522 16:2564997-2565019 GCTTCGATGCACAAAGACCCCGG - Intronic
1132962828 16:2635173-2635195 GCTTCGATGCACAAAGACCCCGG + Intergenic
1133496487 16:6323030-6323052 CCTTATATGCAGAGGGAAGCTGG - Intronic
1136599298 16:31273812-31273834 CCTCAGAAACAGAGAGAGCCTGG - Intronic
1136627617 16:31471915-31471937 CCTCAGCTGCAGGGAGCCCCAGG - Intronic
1136983930 16:35082833-35082855 CTTAACAAGCAGAGAGACCCTGG - Intergenic
1137675940 16:50303966-50303988 CCTTGGAACCAGAGAGTCCCTGG - Intronic
1137738090 16:50739962-50739984 CCTTAGATGAAGTCAGGCCCCGG + Intergenic
1138560243 16:57797063-57797085 CCATAGAAGCAGAGAGACCTCGG + Intronic
1139642630 16:68303632-68303654 CCTTAGAAGTAGAGAAACCTCGG - Intronic
1139961786 16:70722131-70722153 GCTCAGATGCAGTGAGTCCCAGG - Intronic
1142620153 17:1160473-1160495 CCTTAGAGTCAGAGAGACGTAGG - Intronic
1143291927 17:5837968-5837990 GCTGAGAAGCAGAGAGACCCAGG + Intronic
1144655194 17:17030782-17030804 CCTTAGGAGCAGAGGGGCCCTGG - Intergenic
1145126723 17:20306783-20306805 TCTTAGATGCAGGAAGCCCCTGG + Intronic
1147048490 17:37772639-37772661 CTTTGGAGTCAGAGAGACCCAGG + Intergenic
1147448466 17:40489192-40489214 CCTTGGAATCAGACAGACCCAGG + Intronic
1149629269 17:58108651-58108673 CCTTAGATGGAGAGAAACTGAGG + Intergenic
1149907043 17:60536040-60536062 CCTTTGCTGCAGACATACCCGGG - Intergenic
1151036795 17:70810067-70810089 CATTAGAGGCAGAGAGTCCTGGG - Intergenic
1151531276 17:74706736-74706758 CCTCAGTGTCAGAGAGACCCTGG + Intronic
1153321617 18:3779179-3779201 CCTTCCATGCAGAGAGATACAGG - Intronic
1155888974 18:31242969-31242991 CTTGAGCTGCACAGAGACCCAGG + Intergenic
1156533888 18:37844683-37844705 CTTTTGATGCAGTGAGGCCCAGG - Intergenic
1158974862 18:62702513-62702535 CCCTTGGTGCAGAGAGACTCAGG + Intergenic
1159072200 18:63637910-63637932 CTTTAGATACTGAGAGACCGTGG + Exonic
1160424074 18:78768318-78768340 CCTCACCTGCAGAGAGGCCCAGG - Intergenic
1161179209 19:2867924-2867946 CTTTAGAAGGAGAGAGGCCCAGG - Intronic
1162728235 19:12702336-12702358 AGATAGATGCAGAGAGACCTGGG - Intronic
1163031944 19:14550512-14550534 CCTGAGTTGGAGAGAGACCCAGG + Intronic
1165178223 19:33945800-33945822 CTTTAAATGCAGCGAGACACAGG + Intergenic
1165227719 19:34366111-34366133 CCGTAGATGCAGGCAGACCCTGG - Intronic
1166189636 19:41167498-41167520 CTCTGGATTCAGAGAGACCCAGG + Intergenic
1166501301 19:43343537-43343559 CCGTGGAGGCAGGGAGACCCAGG + Intergenic
1168061015 19:53892341-53892363 CCCTAGCTGGAGAGAGAGCCCGG + Intronic
929897490 2:45974716-45974738 CCTTACATTCAGAGAGGTCCAGG + Intronic
934148065 2:89115825-89115847 CCTAAGAGGCAGAGAGACAAAGG + Intergenic
934221220 2:90084784-90084806 CCTAAGAGGCAGAGAGACAAAGG - Intergenic
934955270 2:98612192-98612214 TTTTAGTTGCAGAGAGACCTGGG + Intronic
936085770 2:109467961-109467983 GGTCAGAGGCAGAGAGACCCTGG + Intronic
936688788 2:114861013-114861035 CCTTTGATGAAAAGAGACCTGGG - Intronic
938763255 2:134443788-134443810 CTTCAGATGCAGACAGACTCAGG - Intronic
939217641 2:139260187-139260209 CCCTAGAGGCAGAGAGAGCAGGG + Intergenic
939347143 2:140980221-140980243 CATTAAATACAGAGAGGCCCTGG - Intronic
941797470 2:169616002-169616024 CCCTACCTGCAGACAGACCCTGG + Intronic
942187523 2:173438435-173438457 TCTAAAATGCAGACAGACCCTGG - Intergenic
942675391 2:178421442-178421464 CCTTAGAGGCTCAGAGTCCCCGG + Intergenic
944118493 2:196214240-196214262 CTTTAGCTTCAGAGAGACCTAGG - Intronic
945173062 2:207017070-207017092 CCTTTGAGGCACAGAGACTCAGG + Intergenic
945372369 2:209035086-209035108 CCTGAGATGCAGAAATACCAGGG + Intergenic
945841243 2:214890339-214890361 CATGAGATGCAAAGAAACCCTGG + Intergenic
945987286 2:216365153-216365175 CCTAAGATGCAATGAGAACCTGG - Intronic
1170815818 20:19713430-19713452 GGTTGGAAGCAGAGAGACCCCGG - Intronic
1172619135 20:36307782-36307804 GCTCAGAGGCAGAGAGAGCCAGG - Intronic
1172878098 20:38178350-38178372 CATTAGATGCTGTGTGACCCTGG + Intergenic
1173144299 20:40511458-40511480 CCTTAGGTGCCAAGAAACCCAGG - Intergenic
1173488049 20:43456083-43456105 CTTGAGATGCAGAGATGCCCCGG - Intergenic
1174387764 20:50197452-50197474 CCTTGGTTGCAGAGTGACCTTGG + Intergenic
1174703590 20:52634166-52634188 CCTTATAAGAAGAGAGACCCAGG + Intergenic
1176521691 21:7829522-7829544 TCTGAGATGCCGAGAGAGCCGGG + Intronic
1178089554 21:29148341-29148363 CCTTAGAGCCAGAGAGTACCTGG + Intronic
1178144391 21:29721692-29721714 CCTTAGAAGCAGGGTGTCCCAGG + Intronic
1178655711 21:34459534-34459556 TCTGAGATGCCGAGAGAGCCGGG + Intergenic
1178702060 21:34841880-34841902 CCATGGGTGCAGACAGACCCTGG - Intronic
1178966608 21:37125547-37125569 CCATAGATACAGAGAGATACAGG - Intronic
1178966896 21:37128745-37128767 CCATAGATACAGAGAGATACAGG - Intronic
1179050415 21:37884394-37884416 GCTGAGATGCAGAGAGAAGCTGG - Intronic
1181434360 22:22901563-22901585 CCTTACCTGCAGAGATGCCCAGG - Intergenic
1183061825 22:35340847-35340869 CCTGAGATGCTGGGAGACCCAGG - Intronic
1183686735 22:39365332-39365354 CTTTGGATCCAGAGAGACTCAGG + Intronic
1184031842 22:41899829-41899851 CCTGAAAAGCAGAGGGACCCAGG - Intronic
950107755 3:10398979-10399001 GCACAGGTGCAGAGAGACCCTGG - Intronic
950291497 3:11788138-11788160 CCATAGCTGGAGAGTGACCCTGG + Intergenic
950583171 3:13876295-13876317 CTTGAGATGCAGGGAGATCCTGG + Intronic
952869613 3:37886595-37886617 CCTGATATTCAGAGAGACCAAGG + Intronic
954299365 3:49691218-49691240 CCTCAGATGCTGAGAAATCCAGG + Exonic
954304356 3:49717644-49717666 CCTGTGAGGCTGAGAGACCCAGG - Exonic
955399588 3:58581876-58581898 TCTTAGCTGCAGAAGGACCCTGG + Intronic
956387472 3:68735361-68735383 CCTTTGATGCAGAGAAAGCAAGG + Intronic
959707172 3:109348970-109348992 TCTTAGATGCAGAGAGACTGGGG - Intergenic
960332559 3:116380048-116380070 CTTTAGATGCAGGCAGACCATGG + Intronic
961047835 3:123721642-123721664 CCTTACATGCTGGGGGACCCTGG - Intronic
961270122 3:125681922-125681944 CCTTACATGCTGGGGGACCCTGG + Intergenic
964724017 3:159795576-159795598 CCTGACATGCAAAGAGTCCCTGG + Intronic
965692325 3:171370981-171371003 CTTCAGATTCAGAGAGACCTGGG + Intronic
969282461 4:6179909-6179931 TCTTAGATTCAGAGAGACCTGGG - Intronic
971927570 4:33033666-33033688 CCTTTGATGCACAGAAACTCAGG + Intergenic
973105782 4:46335414-46335436 CCTAAAATGCACAGAGACTCAGG - Intronic
975155352 4:71066225-71066247 CTTTGGATCCAGAGAGATCCTGG - Intergenic
976649085 4:87416100-87416122 CTTTAGCTGCAGAGAGAACTAGG + Intergenic
979263858 4:118679077-118679099 CCGCAGATGGAGAGAGACACAGG - Intergenic
979440899 4:120748824-120748846 CCTAGGATGCAGTCAGACCCTGG - Intronic
980098136 4:128514279-128514301 CCTTATAAGAAGAGACACCCGGG + Intergenic
980873586 4:138637853-138637875 TCCTAGATGCAGAGAAATCCAGG + Intergenic
981578813 4:146231914-146231936 CATTAGATGCATGGAGACCTAGG + Intergenic
983513455 4:168632843-168632865 CATTACAAGCATAGAGACCCTGG + Intronic
984649339 4:182252954-182252976 CCTTTGATACAGAGAGGCCTGGG - Intronic
985705685 5:1400254-1400276 CCTGAGACCCAGAGAGGCCCCGG - Intronic
986536589 5:8794192-8794214 CCAGAGATGCACAGGGACCCTGG - Intergenic
992676740 5:79112515-79112537 CCTTGGGTGCAGCGAGAACCCGG - Intronic
992996968 5:82343767-82343789 CCTCAAATGCAAAGTGACCCAGG + Intronic
993356291 5:86912868-86912890 CCTTAGATTCAGATAGGCCAGGG - Intergenic
994817435 5:104601953-104601975 CCTTCGGTGCAGACAGAACCTGG - Intergenic
995504667 5:112847545-112847567 CCTTAGATTCCAAGAAACCCTGG - Intronic
997030978 5:130127447-130127469 GCTTAGAGTCAGACAGACCCAGG - Intronic
1001964285 5:175899709-175899731 CCTGAGAGCCAGACAGACCCAGG + Intergenic
1005904005 6:30244700-30244722 ACTTATCTGCAGAGACACCCAGG + Intergenic
1006297507 6:33176468-33176490 CCTGAGGTCCAGAGGGACCCTGG + Exonic
1006969829 6:38031110-38031132 CCTTGGATACAGAAAGACCTGGG - Intronic
1007831458 6:44641965-44641987 CCTTAGATCCAGACAGGCTCTGG + Intergenic
1009243460 6:61205393-61205415 CCCCAGATGCAGAGATACCTGGG + Intergenic
1009311837 6:62163694-62163716 TCTTTGGTGCAGACAGACCCAGG + Intronic
1009538392 6:64921709-64921731 AGTTAGATTCAGAGAGACACAGG - Intronic
1012556911 6:100524736-100524758 ACTAAGAAGCAGAGAGAGCCTGG - Intronic
1013952017 6:115794583-115794605 CCTCAGATTCAGAGAGCACCTGG + Intergenic
1014632968 6:123810226-123810248 GCTGAGATTCAGACAGACCCGGG - Intronic
1021935518 7:25627130-25627152 CCCAAGAGGCAGAGAGACCTAGG + Intergenic
1024061260 7:45700214-45700236 CCTGAGATTCAGGGTGACCCTGG - Intronic
1026026995 7:66753556-66753578 ACAGAGATGCAGAGAGACCCTGG - Intronic
1031332357 7:120481710-120481732 TCTTTGACGCAGAGGGACCCAGG + Intronic
1031992501 7:128207438-128207460 CCACGGCTGCAGAGAGACCCTGG + Intergenic
1032460796 7:132108854-132108876 CCTTAGCTGCAAAGAAAGCCAGG + Intergenic
1034101231 7:148452189-148452211 CATTAGCTGCAGAGAAGCCCTGG - Intergenic
1035374912 7:158401500-158401522 GCGTGGAGGCAGAGAGACCCTGG + Intronic
1035386904 7:158479093-158479115 CCGGAGATGCAGACAGACCGAGG + Intronic
1037633168 8:20676704-20676726 GCTTACTTGCAGTGAGACCCTGG + Intergenic
1037959578 8:23085838-23085860 CCTTAGAGACAGAGAGGGCCCGG + Intronic
1038059492 8:23896703-23896725 TCTAAGAAGGAGAGAGACCCAGG - Intergenic
1038629284 8:29225697-29225719 CTTTAGTTGGAGAGAGACGCTGG - Intronic
1040686117 8:49875178-49875200 CCTCAGACACAGGGAGACCCCGG + Intergenic
1042458994 8:69040203-69040225 TCTTATAGGCAGAGAGAACCTGG - Intergenic
1042572158 8:70177409-70177431 CCATAGATGCAGTGAAAACCTGG - Intronic
1043365267 8:79525582-79525604 CATTAGAGTCAGACAGACCCGGG + Intergenic
1044872897 8:96637923-96637945 CTTTAGAAACAGGGAGACCCAGG - Intergenic
1045556567 8:103220084-103220106 GCTTAGATGGAGACAGACCTGGG - Intronic
1047322557 8:123801707-123801729 CCTTAGAGAAAGTGAGACCCAGG + Intronic
1048030120 8:130623271-130623293 AATTAGATGCTGAGAGAGCCTGG - Intergenic
1048054826 8:130853266-130853288 CCTTAAAGGCAGAGATGCCCTGG - Intronic
1048862528 8:138734512-138734534 GCTGAGATGCATAGAAACCCAGG + Intronic
1049297931 8:141853143-141853165 CCCTAGAGGTAGAGAGACACAGG + Intergenic
1050095263 9:2058130-2058152 CCTTAACTGCAGAGACACCAGGG + Intronic
1051720605 9:20033241-20033263 CATTAGATTCAGACAGACCTGGG + Intergenic
1052396522 9:27945149-27945171 ACAGAGATGAAGAGAGACCCTGG + Intergenic
1053117950 9:35521951-35521973 TCTTAGATGCTGAGAGCACCTGG - Intronic
1053366508 9:37526208-37526230 CCTTGGATGCAGAGAAGCACAGG - Intronic
1060203147 9:121663885-121663907 CCTTAGATTCAGAGATATCCGGG + Intronic
1060666737 9:125436289-125436311 CCTCAGAAGCAGAGAGGCTCTGG + Intergenic
1061053119 9:128207630-128207652 ACTTACAAGCAGAGAAACCCTGG + Intronic
1062207535 9:135345577-135345599 CATCACATGCAGAGAGACTCAGG - Exonic
1062316549 9:135970122-135970144 CCTCAGATCTAGAGAGACCAAGG + Intergenic
1189163215 X:38832487-38832509 CTTTAAAATCAGAGAGACCCTGG + Intergenic
1191910966 X:66149075-66149097 CCAAAGATGCAGAGAGACAAAGG + Intergenic
1192170594 X:68852172-68852194 CCTTGGAAGCAGAGAGTCCTGGG - Intergenic
1194933917 X:99924284-99924306 TATTAGATGCAGTGAGATCCAGG + Intergenic
1197715191 X:129701424-129701446 CCTTCCATGCAGAAAGGCCCAGG + Intergenic
1198276107 X:135097583-135097605 CAGGAGCTGCAGAGAGACCCAGG + Intergenic
1198310406 X:135423152-135423174 CAGGAGCTGCAGAGAGACCCAGG - Intergenic
1199323855 X:146474115-146474137 CCTTAGCTTCAGTGATACCCCGG - Intergenic
1201322045 Y:12710029-12710051 CCTTAGATACAGAAAAACACAGG - Intronic