ID: 1098041958

View in Genome Browser
Species Human (GRCh38)
Location 12:66361724-66361746
Sequence AAGCAGAGGCTGAGTCAGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 690
Summary {0: 1, 1: 0, 2: 7, 3: 86, 4: 596}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1098041958_1098041962 -6 Left 1098041958 12:66361724-66361746 CCCTCCTGACTCAGCCTCTGCTT 0: 1
1: 0
2: 7
3: 86
4: 596
Right 1098041962 12:66361741-66361763 CTGCTTTCTAGCTCCCAGCTTGG 0: 1
1: 0
2: 0
3: 18
4: 235
1098041958_1098041964 5 Left 1098041958 12:66361724-66361746 CCCTCCTGACTCAGCCTCTGCTT 0: 1
1: 0
2: 7
3: 86
4: 596
Right 1098041964 12:66361752-66361774 CTCCCAGCTTGGCTCTGGCCTGG 0: 1
1: 0
2: 4
3: 42
4: 353
1098041958_1098041963 0 Left 1098041958 12:66361724-66361746 CCCTCCTGACTCAGCCTCTGCTT 0: 1
1: 0
2: 7
3: 86
4: 596
Right 1098041963 12:66361747-66361769 TCTAGCTCCCAGCTTGGCTCTGG 0: 1
1: 0
2: 0
3: 13
4: 181

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1098041958 Original CRISPR AAGCAGAGGCTGAGTCAGGA GGG (reversed) Intronic
900014621 1:139370-139392 AGGCAGAGGCTGGGCCTGGAGGG + Intergenic
900044488 1:494572-494594 AGGCAGAGGCTGGGCCTGGAGGG + Intergenic
900065892 1:729478-729500 AGGCAGAGGCTGGGCCTGGAGGG + Intergenic
900228281 1:1543060-1543082 AGGCAGAGGCAGAGGCGGGACGG + Intronic
900828575 1:4947297-4947319 AAGGAGAGGCTAGGTCAGAATGG + Intergenic
901342406 1:8507162-8507184 ACTCAGAGGCTGAGGCAGGTTGG + Intronic
901560586 1:10067126-10067148 AGGCAGAAGCTAAGACAGGATGG - Intronic
901778229 1:11575351-11575373 GATCTGAGGCTGAATCAGGAAGG - Intergenic
901822735 1:11840514-11840536 AAGCAGAGGTAGAATCAGGCGGG + Exonic
901935125 1:12621460-12621482 AAGCAGAGCCTGATTCAGGAGGG - Intergenic
902225664 1:14995016-14995038 AGGAGGAGGCTGAGTCAGTAGGG + Intronic
902687521 1:18088312-18088334 AGAAAGAGGCTGAGGCAGGATGG + Intergenic
904737162 1:32643499-32643521 ACCTAGAGGCTGAGGCAGGAGGG - Intronic
905304515 1:37008174-37008196 AAGCAGAGGCTGGGGTAGAAAGG + Intronic
905335422 1:37241361-37241383 AAGCCTAGGCTGAGGCAGGCAGG - Intergenic
905388509 1:37621217-37621239 AAGCAGGGGCTGGATGAGGAAGG + Intronic
905448365 1:38042247-38042269 AATGAGAGGCTGAGGCAGGGTGG + Intergenic
905593995 1:39189773-39189795 CAGTACAGGCTGTGTCAGGAGGG - Intronic
905757006 1:40518951-40518973 ATGCGAAGGCTGAATCAGGAAGG - Intergenic
906065911 1:42980014-42980036 AAAGGGAGGCTGAGTCAGGAAGG + Intergenic
906106524 1:43297064-43297086 CAACAGAGGATGAGTCAGGGGGG - Intergenic
907104228 1:51866112-51866134 CTCCAGAGGCTGAGGCAGGAGGG + Intronic
907373590 1:54018268-54018290 AAGCAGAGGCAAAGGCAGGAGGG + Intergenic
907385305 1:54121948-54121970 GAGCATAGGCAGAGCCAGGAGGG + Intergenic
907507127 1:54927699-54927721 AAGCACATGGTGAGTTAGGAAGG + Intergenic
907512752 1:54973892-54973914 AAGGAGAGGCTGAATCAGTGTGG - Intergenic
907708635 1:56855055-56855077 CAGCAGAGGCTGTGTTAGAATGG + Intronic
908859444 1:68466450-68466472 CTACAGAGGCTGAGGCAGGAGGG + Intergenic
909498170 1:76303070-76303092 AATCAGAGGCTGAGTTACAAAGG + Intronic
910152886 1:84174125-84174147 AAGCAGATGCCGAATCAGGGAGG - Intronic
910262674 1:85307208-85307230 ACTGAGAGGCTGAGTAAGGATGG + Intergenic
910574038 1:88738039-88738061 GAGAAGAGGCAGAGTCAAGATGG - Intronic
910828950 1:91440381-91440403 AAGCAGGGGCTGAGGAAGGAGGG + Intergenic
911127471 1:94353833-94353855 AAGAACAGGCTGAGAGAGGATGG - Intergenic
911179851 1:94850624-94850646 AAGCAGAGGCAGAGCCAGCCTGG - Intronic
911664136 1:100535118-100535140 AGCCAGAGACTGAGTCTGGAAGG + Intergenic
912537463 1:110385602-110385624 AAGCAGGGGCTGAGGGAGGGAGG - Intronic
912563386 1:110566317-110566339 AAGCAGAGGCAGAGTAGTGAAGG + Intergenic
912798970 1:112709382-112709404 AAGCAGTGGCTGGATCATGAAGG + Intronic
915580653 1:156811081-156811103 AAGGAGATGCTGAGAGAGGAGGG - Intronic
915724998 1:158011173-158011195 AAAGAGAGGGTTAGTCAGGATGG - Intronic
916084814 1:161260719-161260741 ATTCAGCTGCTGAGTCAGGAGGG - Intronic
916707112 1:167362618-167362640 ACTCAGAGGCTGAGGCAGGAAGG - Intronic
919928783 1:202208029-202208051 AGGGAGAGGCTGAGCCAGCAGGG - Intronic
920225725 1:204437533-204437555 AAGCAGAGGCTGGCTCTAGATGG + Intronic
920916900 1:210265067-210265089 AAGGTGAGGGAGAGTCAGGAAGG + Intergenic
922101017 1:222476827-222476849 AGGCAGAGGCTGGGCCTGGAGGG + Intergenic
922498113 1:226076542-226076564 TATAAGAGGCTGAGGCAGGAGGG + Intergenic
922595443 1:226809514-226809536 AAGCAGAGGATCAGTTAAGAAGG - Intergenic
922998728 1:229987840-229987862 ATGCAGAGGATTAGTCTGGAAGG - Intergenic
923123723 1:231017512-231017534 AGGCAGGGGCTGATTCAGCAAGG + Intergenic
923151858 1:231240935-231240957 AAGCAGAGGCCAACCCAGGACGG + Intronic
923552747 1:234977202-234977224 AAGGAGAGGCTGAGTAGGGAGGG + Intergenic
923617433 1:235549366-235549388 AAACGGAGGCTGAATCTGGAGGG + Exonic
924343943 1:243056944-243056966 AGGCAGAGGCTGGGCCTGGAGGG + Intergenic
924497583 1:244605090-244605112 AAGGTGTGGCTGAGTCTGGAAGG - Intronic
924623891 1:245684927-245684949 AGGCAGAGGCCAAGCCAGGATGG + Intronic
1062764238 10:48938-48960 AGGCCGGGGCTGAGTCAGGGAGG + Intronic
1062960571 10:1570635-1570657 CAGCAGTGGGTGAGTCAGGAGGG + Intronic
1063353104 10:5374201-5374223 AAGTAGAGGCGGAGGCTGGACGG + Exonic
1064609251 10:17080015-17080037 GAGCAGAAGCTGAGGCAGGAAGG - Intronic
1066317162 10:34259480-34259502 CAGAAGGGGCAGAGTCAGGAAGG - Intronic
1066446279 10:35486686-35486708 AGGCAGAGGCTGGATCACGATGG - Intronic
1066732389 10:38448119-38448141 AGGCAGAGGCTGTGCCTGGAGGG - Intergenic
1067669103 10:48303485-48303507 CAGCAGAGGCTGAGTTTGAAAGG + Intergenic
1069237816 10:66100060-66100082 AAGCAGAGTCTGAGATTGGAAGG + Intronic
1069568598 10:69480238-69480260 AAGCACAGTCTCAGGCAGGAAGG + Intronic
1069720117 10:70544494-70544516 AGGCAGGAGCTGAGTGAGGAGGG + Intronic
1069797311 10:71061693-71061715 CAGCAAAGGCTGAGAGAGGAGGG - Intergenic
1071982914 10:91021915-91021937 ATGCTGAGGCTGAGTGAAGAAGG - Intergenic
1073110801 10:101062025-101062047 AAGCAGAGGCGCAGTCAGCCGGG - Exonic
1073253306 10:102134844-102134866 TAGCACAGGGAGAGTCAGGAAGG + Intronic
1073455282 10:103633023-103633045 AAACAGAGTCTGACACAGGAAGG + Intronic
1073808473 10:107126106-107126128 AAGCAAAGACTTATTCAGGAAGG - Intronic
1074190158 10:111128599-111128621 TAGCAGAGGCTCACCCAGGATGG + Intergenic
1074262228 10:111865570-111865592 AAGCAGAGGAGGAGTGAGGTTGG + Intergenic
1074413249 10:113245623-113245645 GAGGAGAGGCTGACTGAGGAGGG + Intergenic
1074690241 10:115997852-115997874 ATGCATAGGATGAGTCAGGGAGG + Intergenic
1074733054 10:116397963-116397985 AAGGATAGGCTTAGTCAGAAAGG + Intergenic
1074979153 10:118605453-118605475 ACGGAGATGCTGAGTCAGGCAGG - Intergenic
1075084724 10:119406985-119407007 AAGTGGAGGCTCACTCAGGATGG + Intronic
1075442406 10:122490622-122490644 GACCAGAGGCTGAGCCAGGTGGG + Intronic
1075773967 10:124967461-124967483 AAGCAGAGGCTGGATTACGAAGG + Intronic
1075976249 10:126698109-126698131 ATGCAGAGGAAGAGTCTGGATGG - Intergenic
1076350255 10:129810682-129810704 CAGCAGGGGCTGAGCCAGGCGGG + Intergenic
1076497478 10:130906326-130906348 CAGCAAAGGCAGAGTCTGGACGG - Intergenic
1076970817 11:131047-131069 AGGCAGAGGCTGGGCCTGGAGGG + Intergenic
1077093778 11:790894-790916 ATGCAGAGGCTGAAAAAGGAGGG + Exonic
1077233167 11:1467750-1467772 AAACGGAGGCAGAGGCAGGAAGG + Intergenic
1077503999 11:2921906-2921928 CAGCAGTGACTGCGTCAGGATGG - Intronic
1077608584 11:3628818-3628840 ATGCAGGGGCAGAGGCAGGATGG + Intergenic
1077998566 11:7474841-7474863 AAGCACAGGCTAACTCTGGAGGG + Intergenic
1078157565 11:8811839-8811861 CTTCAGAGGCTGAGGCAGGAGGG - Intronic
1078243053 11:9547946-9547968 GCTCAGAGGCTGAGGCAGGAGGG + Intergenic
1079868802 11:25769456-25769478 CAGCAGAGGGTGAGTCATGTGGG + Intergenic
1080126165 11:28736471-28736493 AAACAGAGGCAGAGTCATGAAGG + Intergenic
1081651796 11:44828783-44828805 AAGCAGGGGGAGAGTCAGGGAGG - Intronic
1081654624 11:44849289-44849311 AAGCAGGACCTGAGTGAGGATGG + Intronic
1081975416 11:47231292-47231314 GAGCAGTGGCTGAGTTAGGAGGG - Intronic
1082026076 11:47573279-47573301 AAGCACTGGATGAGTCGGGAAGG + Exonic
1082809178 11:57468197-57468219 ATGGAGATGCTGAGGCAGGAAGG - Intronic
1083303124 11:61749091-61749113 GGGCAGAGGCTGGGGCAGGAAGG - Intergenic
1083331521 11:61900544-61900566 GAGGAGAGGCTGCGGCAGGAGGG + Intronic
1083549447 11:63575394-63575416 AAGCAAAGGTGGAGTCAGGGAGG + Intronic
1083585107 11:63851336-63851358 TAGTGGAGGCTGAGGCAGGAGGG + Intronic
1083782230 11:64924623-64924645 AAGGGGGGGCTGCGTCAGGAAGG - Intronic
1083800985 11:65046126-65046148 AAGCAGTGGCTCAGTCATGGGGG + Intronic
1083932085 11:65851564-65851586 AAGGAGAGGCTGAGACAGAGAGG + Intronic
1084888677 11:72225696-72225718 AAGCAGAGGCTGAGGCTGTATGG + Intronic
1084956325 11:72693549-72693571 ATGGAGAGGCTGGGGCAGGATGG - Intronic
1085044574 11:73345514-73345536 GAGCAGTGGCTGGGTCAGGCAGG + Intronic
1085632688 11:78132383-78132405 AGGCAGAAGGAGAGTCAGGAAGG - Intronic
1085735565 11:79036128-79036150 AAGCAGAATCTGAGTCAGTGGGG + Intronic
1085781708 11:79415067-79415089 AAACAGAGGCTGAGGAAGAAAGG - Intronic
1086455832 11:86957625-86957647 TAGAAGTGGCTGAGTCTGGAGGG + Intergenic
1086989700 11:93289419-93289441 TAGCAGAAGCTGAGTAAGTAAGG - Intergenic
1087064608 11:94015891-94015913 TAGCAGAGGTTGATTCATGAGGG + Intergenic
1087081344 11:94173815-94173837 AAGCAGAGACTGAATTAAGAGGG - Intronic
1087624940 11:100585477-100585499 AAGCAGAGGCAGAGAGAGGATGG - Intergenic
1088011402 11:105005665-105005687 CAGCAGAGGCTGTGGCAAGAAGG - Intronic
1088015882 11:105059307-105059329 CAGCAGAGGTTGTGGCAGGAAGG - Intronic
1089625872 11:119750521-119750543 GAGCAGAGGCTGCATCTGGATGG + Intergenic
1089746073 11:120617990-120618012 AGGCAGAGGCTGAGAGAGTATGG + Intronic
1089898147 11:121953086-121953108 AAGCAGAGGCTAATTGAGGCAGG + Intergenic
1090692482 11:129198810-129198832 AAGCAGAGGCTGAAACAGTTTGG + Intronic
1090844181 11:130517355-130517377 AAGCTGAGGCTTTGTTAGGAAGG + Intergenic
1091268598 11:134289928-134289950 AGGCAAGGGCGGAGTCAGGACGG - Intronic
1091951448 12:4596355-4596377 AGGGAGAGGCACAGTCAGGAAGG - Intronic
1092163345 12:6328036-6328058 GAACAGGGGCTGAGGCAGGAAGG + Intronic
1092196411 12:6552209-6552231 ACCCAGAGGCTGACACAGGAAGG - Intronic
1094807527 12:34107406-34107428 AAGAAGAGGGGGAGTCTGGAAGG + Intergenic
1095097014 12:38154329-38154351 AAGCAGACGTTGAGGCAGCACGG + Intergenic
1095685408 12:45027977-45027999 AAGAAGCCGCTGAGTTAGGATGG + Intronic
1096265843 12:50121870-50121892 AAGAAGAGGGTGAGTTAGAAAGG - Intergenic
1096568109 12:52498132-52498154 ATGCACAGGGTGAGTCAAGACGG - Intergenic
1096984964 12:55750072-55750094 AAGCAGGGGCATAGTCAGGGTGG + Exonic
1097371933 12:58794566-58794588 AAGATGAGGCTGGGTCAGCATGG + Intronic
1098041958 12:66361724-66361746 AAGCAGAGGCTGAGTCAGGAGGG - Intronic
1098236064 12:68419621-68419643 CTGGAGAGGCTGAGACAGGAGGG + Intergenic
1098753877 12:74332450-74332472 AAGCATAGGCTGAGGCAGGTAGG - Intergenic
1099215190 12:79844794-79844816 GAGCAGAGGAAGAGGCAGGAAGG - Intronic
1101201198 12:102438190-102438212 AAGCTGAGGCAAAGTCAGGAAGG + Intronic
1101832196 12:108267463-108267485 AAACAGAGGCTGTGTCAAGAAGG + Intergenic
1102634337 12:114309763-114309785 AGGCAGAGCCTGTGTCATGAGGG + Intergenic
1102722473 12:115029251-115029273 AAGCAGAGCCTGAGACAAGGAGG + Intergenic
1104285058 12:127417657-127417679 AAGCAGAAGGAAAGTCAGGAAGG - Intergenic
1104429185 12:128702970-128702992 CAGCAGAGGGTGAGTCATCATGG + Intronic
1104483657 12:129130409-129130431 AGGGAGGGGCAGAGTCAGGATGG - Intronic
1105472901 13:20707765-20707787 TATGAGAGGCTGAGACAGGAGGG - Intronic
1105540888 13:21315708-21315730 TACCAGAGGCTGAGTGGGGAGGG - Intergenic
1107354056 13:39546967-39546989 AGGCAGAGGCAGAGTCTGAAAGG - Intronic
1108020683 13:46124979-46125001 AAGAAGAGGAGGAGACAGGAGGG - Intergenic
1108647334 13:52443430-52443452 AAGAAGAGGAAGAGACAGGAGGG + Intronic
1109459890 13:62643073-62643095 AGGCAGAGAATGAGTCAGGGTGG - Intergenic
1109587190 13:64421889-64421911 AAGCAGATGAAGAGTCAGAAAGG + Intergenic
1110264999 13:73527651-73527673 AAGCAAAGCCTGAGTCAAGATGG + Intergenic
1111063816 13:83063463-83063485 CAGCAGCAGCTGAGACAGGAGGG - Intergenic
1111527714 13:89493234-89493256 AAGCAGAGGCTGAAACAGTTTGG - Intergenic
1111763477 13:92496792-92496814 GAGAAGAGGCTGAGTTAGCATGG + Intronic
1113475332 13:110576475-110576497 CTCCAGAGGCTGAGGCAGGAGGG + Intergenic
1113536992 13:111076084-111076106 TGGCAGTGGCTGAGACAGGAGGG + Intergenic
1113942916 13:114027938-114027960 AAGCAGAGGCGGCGTCAGGAGGG + Intronic
1114405508 14:22452697-22452719 AGGCAGAGGCTGGGCCAGGCAGG - Intergenic
1114548290 14:23518553-23518575 AACCAGAGTCTGTGTGAGGATGG - Intergenic
1114550931 14:23532547-23532569 AAGGTGAGGCTGGGTCAGGAAGG - Exonic
1115358731 14:32477505-32477527 AAGCAGTGGCTGAGGCTGGCAGG + Intronic
1115368800 14:32588971-32588993 GAGCAGAGGTAGAGACAGGAAGG - Intronic
1115761710 14:36582832-36582854 AAGCTGGGGCTGGGTCAGGCGGG - Intergenic
1116588884 14:46745637-46745659 AAGAAGTGTCTGAGACAGGAAGG + Intergenic
1117313159 14:54548493-54548515 AAACAGAGGCAAAATCAGGAAGG - Intergenic
1117494122 14:56284968-56284990 AGGTAGAGGCTGAGACAGGTAGG + Intronic
1117533293 14:56679958-56679980 AAGCAGAGGCTCAGTGAGTTGGG - Intronic
1118474863 14:66107053-66107075 AAGTAATGGCTGAGTCAGGATGG - Intergenic
1118994495 14:70823519-70823541 AAGCAGAAGCTGAGACAGGGAGG - Intergenic
1119320386 14:73726820-73726842 AAGCAGAGGCAAGGTGAGGAGGG - Exonic
1122828317 14:104383079-104383101 AAGCAGAGGCTCAGGGAGCAGGG - Intergenic
1124902277 15:33835485-33835507 AAGGAGAGGCAGAGACAGGGAGG - Intronic
1125261033 15:37824948-37824970 AAGTAGAAGCTGAGTCATGAGGG - Intergenic
1125819916 15:42620371-42620393 CTCCAGAGGCTGAGGCAGGAGGG + Intronic
1125824171 15:42661550-42661572 CTCCAGAGGCTGAGGCAGGAGGG - Intronic
1126878861 15:53072947-53072969 AAGCAGAGGCAGAAACAGCATGG + Intergenic
1127714913 15:61640592-61640614 GAGCAGAGACTGAGTGAGGAAGG + Intergenic
1128253970 15:66183739-66183761 ATGCAGATTCTGAGTCAGGAGGG + Intronic
1128527728 15:68423824-68423846 AAGCCCAGGCTGGGTGAGGAAGG - Intronic
1128560943 15:68667308-68667330 AAGCAGAGGAAGAAGCAGGATGG - Intronic
1128730295 15:70016050-70016072 AAGCAGAGGCCAAGCCAGGCTGG - Intergenic
1129600356 15:76995015-76995037 AAGCAGAGGCAGGAGCAGGATGG + Intronic
1130120655 15:81044891-81044913 AAGATGAGGCTTAGACAGGATGG - Intronic
1130230467 15:82092983-82093005 AAGCTGAGACTGAGACTGGAGGG + Intergenic
1131033156 15:89203410-89203432 AAGCACTGGCTCAGCCAGGAGGG + Intergenic
1131070347 15:89461825-89461847 AAGCAGGGGCCAAGGCAGGAGGG + Intergenic
1131176046 15:90210459-90210481 GAGCAAAGCCTGAGGCAGGAGGG + Intronic
1131208287 15:90470912-90470934 AAGCAGAGGTCGAGAAAGGAAGG - Intronic
1132057798 15:98665339-98665361 AGGCAGATGCAGAGTCAGGAGGG - Intronic
1132091173 15:98949003-98949025 ATGGAGAGGATGAGTAAGGATGG - Intronic
1132225996 15:100141859-100141881 AAGCGGAGACTGAGACAGGCAGG + Intronic
1132488794 16:213229-213251 AGGCTGAGGCTGACTCAGGCTGG + Intronic
1132606213 16:794795-794817 AAGGAGGGGCTGAGTGAGGCTGG + Intronic
1132885285 16:2179657-2179679 GGGCACAGGCTGCGTCAGGACGG + Exonic
1133107116 16:3519213-3519235 CAACAGAGGCTGAGTAAAGAAGG - Intronic
1133737519 16:8627270-8627292 AAGCAGAGGCTGGGTCAGGCTGG - Intronic
1133966530 16:10535951-10535973 CAGCAGATGCTGATTCAAGAGGG + Intronic
1134801272 16:17086966-17086988 AAGCTGAGGTTCATTCAGGAGGG + Intergenic
1134823671 16:17267099-17267121 CAGCACAGGGTGAGGCAGGAAGG + Intronic
1135028191 16:19014757-19014779 AAGCTGATCCTGAGTCTGGAGGG - Intronic
1135197042 16:20403208-20403230 AAGCAGAGGCAGGATCAGTAAGG - Intronic
1135547947 16:23378383-23378405 AGGCAGAGGCTGAGCCATCATGG + Intronic
1135584578 16:23659085-23659107 AATTAGAGGCTGAGTCAGCAAGG - Intronic
1135892127 16:26366665-26366687 AAGCAGAGGGAGAGGGAGGAGGG + Intergenic
1136097008 16:27963847-27963869 ATGCAAAGGCAGACTCAGGATGG - Intronic
1136635346 16:31517971-31517993 ATGCAGAGTCTGAGCCAGAAGGG + Intergenic
1138090457 16:54169607-54169629 AAGAAAAGGCTGGGGCAGGAGGG - Intergenic
1138505887 16:57478118-57478140 AAGCTGAGGCTGAGGTAGGGAGG - Intronic
1139082345 16:63538360-63538382 AAACATAGGCTGTGTCATGATGG - Intergenic
1139503358 16:67386455-67386477 AAGAAGAGGCAGAGGCAGGCCGG + Intergenic
1140563343 16:76010382-76010404 AGGCAGAGGCTGAGTCTTCAGGG + Intergenic
1141424118 16:83934500-83934522 AAGCCGAGGCCGAGACAGGAGGG - Intronic
1141965806 16:87442181-87442203 CAGCAGAGTCTGAGGCTGGACGG + Intronic
1142199274 16:88753362-88753384 AAGGACGGGCTGAGACAGGAGGG + Intronic
1142419026 16:89958991-89959013 CTGCAGAGGGTGAGTCAGGGAGG - Intronic
1142449433 16:90166439-90166461 AGGCAGAGGCTGGGCCTGGAGGG - Intergenic
1142457657 17:65410-65432 AGGCAGAGGCTGGGCCTGGAGGG + Intergenic
1142546216 17:705344-705366 TCGGAGAGGCTGAGGCAGGAGGG + Intronic
1142653379 17:1372496-1372518 ATGATGAAGCTGAGTCAGGAAGG - Intronic
1142721137 17:1776691-1776713 AAGCTGAAGCTGAGTTATGAAGG + Exonic
1143115879 17:4581723-4581745 GAGCAGAAGCACAGTCAGGAAGG + Intergenic
1143378300 17:6480121-6480143 CAGCAGTGGCTGATTCAGGAGGG - Intronic
1143419176 17:6775903-6775925 AACCCGGGGCTGGGTCAGGATGG + Intergenic
1143481108 17:7227842-7227864 AACAGGAGGCTGAGTCAGGGAGG - Intronic
1143592297 17:7892898-7892920 CACCTGAGGCTGAGGCAGGAGGG - Intronic
1143764050 17:9126046-9126068 TTGCAGAAGCAGAGTCAGGATGG + Intronic
1143982262 17:10880153-10880175 AGGGAGTGGCTGAGTTAGGATGG + Intergenic
1144418871 17:15077367-15077389 AATCACAGCCAGAGTCAGGAAGG + Intergenic
1144647528 17:16985574-16985596 GGGCAGAGGCTGGGACAGGATGG + Intergenic
1145169365 17:20641119-20641141 AAGCAGTGGCTGAGTAAGTCCGG - Intergenic
1145897239 17:28466242-28466264 AAGCAGAGGCTGAGGAGGAAGGG + Intronic
1146522523 17:33537149-33537171 TGGCAGAGGCTGAGTCAGAAAGG - Intronic
1147036332 17:37684221-37684243 AAACCAAGGCTGAGTCAGGAAGG - Intergenic
1147757324 17:42777627-42777649 AAAGAGAGCCTGAGTCAGCAAGG - Intronic
1147818823 17:43229604-43229626 TTCCAGAGGCTGAGGCAGGAGGG + Intergenic
1147832106 17:43304306-43304328 TTCCAGAGGCTGAGGCAGGAGGG + Intergenic
1147960732 17:44166113-44166135 AGGCTGAGGCTAAGGCAGGAGGG - Intergenic
1148713032 17:49695625-49695647 AAGCCCAGGCTTAGTCAGCAGGG - Intergenic
1148780805 17:50120621-50120643 GAGCATAGGCTGACTCTGGAAGG - Intronic
1149521378 17:57320800-57320822 CTGCAGAGGGTGTGTCAGGAAGG + Intronic
1149573376 17:57693412-57693434 AGGCAGAGGCAGAGGCAGGTGGG - Intergenic
1149686736 17:58539993-58540015 ATTCATAGGCTGACTCAGGATGG - Intronic
1150293062 17:63992969-63992991 TGGCAGGGGCAGAGTCAGGAGGG + Intergenic
1150910811 17:69385417-69385439 AAGCAGAGGTTGAGCCTGGGAGG + Intergenic
1151252830 17:72850624-72850646 GGCCAGTGGCTGAGTCAGGAAGG - Intronic
1151416628 17:73970519-73970541 CAGCAGAGGCTGCATCAGGAGGG - Intergenic
1151768584 17:76145167-76145189 AGGCAGCAGCTGAGTGAGGATGG + Exonic
1151897670 17:76991258-76991280 AAGCAGGAGCTGGGCCAGGAAGG - Intergenic
1152850286 17:82629933-82629955 AAGGAGAGGCTCAGTGAGGGAGG - Intronic
1153647306 18:7206765-7206787 GAGAAGAGGCTTAGCCAGGAAGG - Intergenic
1153769025 18:8400705-8400727 GAGGTGAGGCTGAGTCTGGAGGG - Intronic
1155057514 18:22197882-22197904 AATGAGTGGCTGAGACAGGAAGG - Intronic
1155173491 18:23284222-23284244 AGTCACAGGATGAGTCAGGAGGG - Intronic
1155492175 18:26410202-26410224 CCTGAGAGGCTGAGTCAGGAGGG - Intergenic
1155862840 18:30925751-30925773 ATGCTTAGGCTGAGTCTGGAAGG + Intergenic
1157081420 18:44529428-44529450 AGGCGGAGGCTGAGGCAGAATGG + Intergenic
1157174238 18:45436760-45436782 AAGCAGAAGCTGAGTAAGGATGG + Intronic
1157286726 18:46382057-46382079 ATGCCCAGGCTGAGGCAGGAGGG - Intronic
1157354263 18:46918231-46918253 AGGAAGATGCTGAGTCAAGATGG + Intronic
1157449225 18:47772895-47772917 GTGCAGAGGCTGAAGCAGGAAGG + Intergenic
1157481040 18:48053978-48054000 GCGCAGAGGCTGAGTGAGGATGG + Intronic
1157746277 18:50138840-50138862 CAGCCCAGGCTGAGGCAGGATGG - Intronic
1157930958 18:51822825-51822847 AAGAAGAGGCAGGGACAGGAAGG - Intergenic
1158408225 18:57179350-57179372 AAGCAGAGGGTGAGTGAAGGTGG + Intergenic
1158538214 18:58327491-58327513 AGGGAGAGGCTGAGCCAGGAAGG + Intronic
1158679841 18:59557347-59557369 AAGCAGAAACTGAGTGATGAGGG - Intronic
1158907329 18:62026689-62026711 TAGCAGAGGCAGAGTCAGGAAGG - Intergenic
1159011007 18:63058438-63058460 AAGCAGGGGCTAAGACAGGTAGG - Intergenic
1159075811 18:63680496-63680518 AAAGACAGGCTGACTCAGGATGG - Intronic
1159325509 18:66910852-66910874 AACCAGAGGCTGAGTGATTAGGG - Intergenic
1159556412 18:69950498-69950520 AAGCAGAGGCTGTGTCAGGTTGG + Intronic
1159801388 18:72904523-72904545 AAGATGAGGCAGAGACAGGAGGG + Intergenic
1159973020 18:74676911-74676933 GAGCAGAGGCTGACTGAGCAAGG + Intronic
1160647770 19:201336-201358 AGGCAGAGGCTGGGCCTGGAGGG + Intergenic
1160696314 19:486300-486322 GTGCAGAGGCTGAGTCCGGAGGG - Intergenic
1160734150 19:654164-654186 AAGCACAGGCTGGGTGGGGAGGG + Intronic
1160757479 19:765194-765216 GAGCAGAGACTGAGGGAGGAGGG + Intergenic
1160873401 19:1286819-1286841 AAGCAGATGCTGGGTCCTGAGGG - Intronic
1161261796 19:3341849-3341871 AAACTGAGGCTGAGAGAGGAAGG - Intergenic
1161322173 19:3646368-3646390 TAGGGGAGGCTGAGGCAGGATGG + Intronic
1161470875 19:4456290-4456312 GAGCAAAGGCTGAGTGAGGGAGG - Intronic
1161935430 19:7368925-7368947 ACGCAGAGGAGGAGTCAGCAGGG + Intronic
1162147293 19:8620637-8620659 AAGATGAGGATGAGGCAGGAGGG + Intergenic
1162339915 19:10086223-10086245 GAGCAGAGGCGGAGCCAGGGCGG + Exonic
1162872974 19:13599867-13599889 AAGCAGATGCTGAGCCGGGGAGG + Intronic
1162946372 19:14046422-14046444 GGGCAGAGGCTGAATCTGGAGGG - Exonic
1163628389 19:18403796-18403818 CAGCTGGGGCTGTGTCAGGAAGG - Intergenic
1163731411 19:18951636-18951658 AAACAGAGGCTCAGGGAGGAAGG - Intergenic
1164633623 19:29777449-29777471 AGGCAGTGGCAGAGTCAGGTTGG - Intergenic
1166482095 19:43183103-43183125 AAGCAGAGGCAGAGACACCATGG + Intronic
1167035859 19:46994615-46994637 AAACAGAGGCAGGGCCAGGAAGG + Intronic
1168238008 19:55075816-55075838 AGGCGGAGGCGGAGGCAGGACGG + Intronic
1168289095 19:55348289-55348311 AAGCACAGCCTGAGTGGGGATGG - Intergenic
924986507 2:275688-275710 AAGCCTAGGCTCAGTGAGGAAGG + Intronic
924996448 2:365992-366014 CAGCAGAGACTGAGCCAGGGCGG + Intergenic
925384081 2:3449887-3449909 AAGGAAAGGCCGAGTGAGGATGG + Intronic
925601414 2:5611991-5612013 AAGAAGAGGCTGACTTAGGCAGG + Intergenic
925882113 2:8361636-8361658 AAGCAGAGGGTGAAACATGAGGG - Intergenic
925883956 2:8378176-8378198 AAGCTGAGGTTGAGCCAGGTGGG - Intergenic
926036974 2:9643528-9643550 AAGCTGAGGCTGAGTCTACAGGG - Intergenic
926686007 2:15698073-15698095 AGGCAGAGGCAGAGGCAGAATGG + Intronic
927017448 2:18979889-18979911 AAGCAGAGGCTGATTGATGTTGG + Intergenic
927045438 2:19273475-19273497 GAGCAGAGGCAGATCCAGGATGG + Intergenic
927179185 2:20432285-20432307 ATACAGAGGCTGTTTCAGGAAGG + Intergenic
927577676 2:24213162-24213184 AAGCAGGGCCTGAGTCTTGAGGG - Intronic
927713311 2:25339047-25339069 AAGGAGAGGCAGTGTGAGGAGGG - Intronic
928437384 2:31263656-31263678 AGGGTGAGGCTGAGCCAGGAAGG - Intronic
928732477 2:34247534-34247556 AATGAGAGATTGAGTCAGGATGG - Intergenic
929484604 2:42342421-42342443 AAGGAGAGGCTGAGTCTGTGTGG - Intronic
929914765 2:46125510-46125532 AAGAAGAGGCTGGGGGAGGATGG + Intronic
930235567 2:48885646-48885668 AAGGAGAGGCTGATACAGGAAGG + Intergenic
931357454 2:61549599-61549621 AAGCTGAGGCTGAGGCAGAATGG + Intergenic
931450626 2:62364961-62364983 AGGCTGAGGCTGAAGCAGGAGGG - Intergenic
932688186 2:73891354-73891376 AAGACGAAGCAGAGTCAGGAAGG + Intergenic
932770510 2:74498417-74498439 AAGTAGAGGGAGAGCCAGGAAGG + Intronic
932791264 2:74655922-74655944 AACCAGAGGTTGAGCTAGGAAGG + Intronic
932887981 2:75564218-75564240 ACGCACAGGCTGATACAGGAAGG + Intronic
933123095 2:78567665-78567687 AAGCAGAGACTGAGTGAGATTGG + Intergenic
934659151 2:96133921-96133943 AAGAAGGGGCTGAGGCAGGGAGG + Intronic
934751976 2:96799486-96799508 AAACAAAGGATGAGGCAGGATGG - Intronic
935207103 2:100905681-100905703 AAGCAGTGGCAGAGGCAGAAAGG - Intronic
936398168 2:112145377-112145399 CTCCAGAGGCTGAGGCAGGAGGG - Intronic
936879483 2:117232742-117232764 AAGCAGGGGCAGTGTCAGAAAGG + Intergenic
937820774 2:126308159-126308181 AAGGAGAGGCTGAGTTTGGCTGG - Intergenic
937860666 2:126706430-126706452 CTTCAGAGGCTGAGACAGGAGGG + Intergenic
937982664 2:127624454-127624476 AAACAGAGGCTGGGCCTGGAAGG - Intronic
938155124 2:128930105-128930127 AAGCAGAGACTGTGGGAGGAAGG - Intergenic
938672677 2:133600767-133600789 AAGCAGAGCCTGAGCGGGGATGG - Intergenic
939092766 2:137798656-137798678 AGGCAGAGGCTGAATCAGTTTGG + Intergenic
939375527 2:141360649-141360671 AAGCTGAGGCTGGGGCAGGAAGG + Intronic
940592460 2:155747808-155747830 AAGTTGAGGCAGAGTCAAGATGG + Intergenic
941953711 2:171182811-171182833 ATCCAGAGGTTGAGGCAGGAAGG + Intronic
942095996 2:172537156-172537178 AGGCAGAGGCAGAGGCAGAAAGG - Intergenic
942156706 2:173136508-173136530 AAGCAGAGGGTGAGAAAGAAAGG + Intronic
944550673 2:200841828-200841850 CTCCAGAGGCTGAGGCAGGAAGG + Intergenic
944876593 2:203968789-203968811 GAGCAGAGGCAGAGAGAGGAGGG - Intergenic
945568175 2:211430439-211430461 AGGCAGAGGCTGAGACTAGAGGG + Intronic
945914536 2:215689196-215689218 ACTCAGAGGCTGAGGCAGGAGGG - Intergenic
946169852 2:217888421-217888443 AAGCAGAGGCAGTGTCAGACAGG + Intronic
946267682 2:218561808-218561830 AAGCAGGGCCTGAGTCCTGAAGG - Intronic
946472584 2:219975925-219975947 TAGGAGAGGCTGTGTCAGGTGGG + Intergenic
946731861 2:222717514-222717536 AGGGAGAGGATGAGGCAGGAAGG + Intergenic
947239028 2:227974354-227974376 AACCAGAGGCAGGGTCTGGAAGG + Intergenic
947561455 2:231157394-231157416 AAACAGAGGCTGAAAGAGGAAGG - Intronic
947669583 2:231927733-231927755 AAGCTGTGCCTGAGGCAGGAAGG + Intergenic
947747326 2:232515315-232515337 GAGCAGAGAATGAGACAGGATGG - Intergenic
947952733 2:234161942-234161964 GAGCACAGGCTGAGGGAGGAGGG - Intergenic
948079182 2:235191580-235191602 AGGCAGAGGCTGGGTCTTGAGGG - Intergenic
948889475 2:240900033-240900055 AAGCAGGGGCTGGGGGAGGAAGG + Intergenic
1170139003 20:13106583-13106605 AGGCAGAGGCTATATCAGGAAGG + Intronic
1170345745 20:15384917-15384939 AAGCAGAGCCAGATTAAGGAGGG - Intronic
1170359711 20:15532721-15532743 GAACAGAGGCTGATTCTGGAGGG - Intronic
1170524208 20:17221444-17221466 AAGCAGTGGCAGACTGAGGATGG + Intergenic
1170924157 20:20707739-20707761 AAGCAGAAGCTGAGGCTGGCTGG - Intronic
1171198688 20:23223923-23223945 AAGACGAGGCTGAGGTAGGAAGG + Intergenic
1171331049 20:24339166-24339188 AAACAGAGGCTGAGAAAGAAAGG - Intergenic
1172084030 20:32364644-32364666 CAGCTGAGACTGAGGCAGGAGGG - Intronic
1172764726 20:37345555-37345577 AAGTAGGGGCTGGGGCAGGAGGG - Intronic
1173050878 20:39560521-39560543 AAACAGAGGCTGAGACCTGAAGG - Intergenic
1173187100 20:40848625-40848647 AAGCAGAGGCTGGGTGGGGTGGG + Intergenic
1173224288 20:41152891-41152913 GTGCAAAGGCTGAGGCAGGAAGG + Intronic
1173247037 20:41344096-41344118 ATGCAGATGCTGATTCAGTAGGG + Intronic
1173350732 20:42243024-42243046 AGGCAGAGGCAGAGGCAGAAAGG + Intronic
1173499206 20:43540123-43540145 AAGCAGAGGCAGAGGCTGGCAGG - Intronic
1173569457 20:44067177-44067199 AAGCAGAGCCTGAGGCAGCAGGG + Intronic
1173614347 20:44393119-44393141 AACCAGAGTCTGGGTCAGGCAGG + Intronic
1173979877 20:47215614-47215636 TTGGAGAGGCTGAGTCAGGGGGG - Intronic
1174244240 20:49164406-49164428 CTCCAGAGGCTGAGGCAGGAGGG - Intronic
1174466371 20:50720742-50720764 ATGAAGAAACTGAGTCAGGAAGG + Intergenic
1174523557 20:51153950-51153972 AGGCAGTGGCTGAATCATGAAGG + Intergenic
1174527668 20:51186737-51186759 AACCAGAGGCTGAGTCACATGGG + Intergenic
1174563834 20:51450405-51450427 AATAGGAGGCTGAGGCAGGAAGG + Intronic
1175499083 20:59436781-59436803 AGGGAGAGGCAGGGTCAGGAAGG + Intergenic
1175857124 20:62127598-62127620 AAGCAGCGGCTGAGGCTGGAGGG - Intronic
1175988705 20:62777025-62777047 AAGGAGAGGGTGGGACAGGAAGG + Intergenic
1176949578 21:15029364-15029386 GAGTAGAGGCTGAGTCAGCATGG - Intronic
1177232531 21:18341167-18341189 CCGGAGAGGCTGAGGCAGGAGGG - Intronic
1178477206 21:32947393-32947415 AACCAGAGACTGAGCCAGGCAGG + Intergenic
1178600166 21:33987830-33987852 ACCCAGAGGCTGAGTCAGGTTGG - Intergenic
1179081975 21:38179700-38179722 CAGCAGAGACTGAGTCATAAAGG + Intronic
1179111914 21:38454429-38454451 AAGCAGATTCTGACTCAGCAGGG - Intronic
1179191417 21:39125457-39125479 AAATAGAGGCTGCGGCAGGACGG + Intergenic
1179317799 21:40260375-40260397 CAGCTGTGGCTGAGGCAGGAAGG - Intronic
1179510198 21:41867549-41867571 ATGCGGAGGCTGCGGCAGGAGGG - Intronic
1179911229 21:44449946-44449968 GGGCAGGGGCTGGGTCAGGAGGG + Intergenic
1180742814 22:18065492-18065514 AGGCAGAGGCGGGGGCAGGAGGG + Intergenic
1181065047 22:20301670-20301692 CCCCAGAGGCTGTGTCAGGAAGG - Intergenic
1181106057 22:20576393-20576415 AAGTGGAGGCTGAGCCAGGATGG + Intronic
1181408709 22:22703214-22703236 AAGGAAAGGCAGAGGCAGGAGGG - Intergenic
1181422333 22:22810645-22810667 AAGGAGAGGCAGAGGGAGGAGGG - Intronic
1181432880 22:22893840-22893862 CAGCAGAGGGTGAGACAGGCTGG - Intronic
1182070922 22:27463058-27463080 CAGCAGAGGCTGAGGCAGGGAGG + Intergenic
1182107215 22:27698135-27698157 AAGCTGAGCCTGAGTCACGGAGG + Intergenic
1182431754 22:30302927-30302949 AAACAGAGCCAGAGTCAGGCAGG + Intronic
1182681254 22:32081834-32081856 GAGGAGAGGCGGAGTTAGGAGGG - Intronic
1182894553 22:33848533-33848555 AGGCAGAGTTTGAGTCAGGCTGG - Intronic
1183063511 22:35349169-35349191 AAACTGAGGCTGAGGGAGGAAGG + Intergenic
1183091914 22:35528090-35528112 AAGCAAGGGCTGGGTCAGGTGGG - Intergenic
1183176598 22:36229045-36229067 AAGCAGTGGGTGAGTGTGGAAGG - Intronic
1183388904 22:37532371-37532393 TTCCAGAGGCTGAGGCAGGAGGG - Intergenic
1183529702 22:38346763-38346785 AAGCAGGGGCTGGGGCAGGATGG + Intronic
1183637074 22:39070620-39070642 CTCCACAGGCTGAGTCAGGAAGG + Intronic
1183684979 22:39356566-39356588 AAACAGAGGCTGGGAGAGGAAGG + Intronic
1183688771 22:39376522-39376544 AAGCAGAGGCCTAGACAGGAAGG + Intronic
1183706732 22:39478965-39478987 AGGCTGAGGCTGACCCAGGATGG - Intronic
1184078050 22:42196113-42196135 AAGGGAAGGCTGAGTCAGTAAGG + Intronic
1184250319 22:43256500-43256522 CAGCAGGGGCTGGGTAAGGAAGG + Intronic
1184339651 22:43879278-43879300 AGGCAGGGGCTGGGTCAGGAGGG - Intergenic
1184870193 22:47232922-47232944 AGTCAGAGGCTGAATCAAGAAGG + Intergenic
1184959794 22:47920737-47920759 CAGCAGAGGCTGGGAAAGGAAGG - Intergenic
1184986414 22:48139189-48139211 AGGCTGGGGCTGAGGCAGGAGGG + Intergenic
1185116350 22:48940425-48940447 AAGCACAGCCTGAGGCAGGGTGG + Intergenic
949188642 3:1224248-1224270 TACCAGAGGCTGAGTCAGGGAGG + Intronic
949731927 3:7123677-7123699 AAGCAGGGAGTGAGTGAGGAAGG - Intronic
950028536 3:9836717-9836739 AAGATAAGGCTGAGGCAGGAGGG + Intronic
950108304 3:10402293-10402315 AAGGAGAGGCAGAGGCAGGTTGG - Exonic
950161461 3:10764163-10764185 AGGCAGAGGCTGCCTCGGGACGG - Intergenic
950438709 3:12994913-12994935 TAGCAGAGGCTGGGCCTGGAAGG + Intronic
950453837 3:13080719-13080741 AGGCTGAGGCTGAGGCAGGGAGG - Intergenic
950678646 3:14569715-14569737 GCGCAGAGGCTGAGGCTGGAAGG - Intergenic
951191316 3:19774937-19774959 AAGGTGAGGATGAGGCAGGAAGG - Intergenic
951614915 3:24531715-24531737 AAGCAGAGGCCGAGTCATTAAGG + Intergenic
952747518 3:36795163-36795185 AAAAAGAGACTGAGTGAGGAAGG - Intergenic
953121169 3:40044057-40044079 AAGCAGAAGCTGGATGAGGAAGG + Exonic
953240830 3:41148002-41148024 TTTCAGAGGCTGAGGCAGGAGGG + Intergenic
953582521 3:44169833-44169855 AATCAGAGGTAGAGCCAGGACGG + Intergenic
953628818 3:44593737-44593759 GAGTAGAGGATGAGGCAGGAAGG + Intronic
955213130 3:56960685-56960707 AAGAGGAGGTTGAGGCAGGAGGG - Intronic
955229607 3:57086997-57087019 AGGAAGAGGTGGAGTCAGGAGGG + Intergenic
955397461 3:58567203-58567225 CAGCAGAGGCTGAACCAGGTGGG - Exonic
955819557 3:62881715-62881737 CAGCAGAGGCAGAAGCAGGAAGG - Intergenic
956525995 3:70161786-70161808 AAGAAGAGCCTGGGTCAAGATGG - Intergenic
956891697 3:73620406-73620428 AATCAGGGGGTAAGTCAGGATGG + Intronic
957538406 3:81535959-81535981 AAGCTGGGGCTGAGTGAGGGTGG - Intronic
958521092 3:95186523-95186545 CTGCAGAGGCTAAGGCAGGAGGG - Intergenic
960152215 3:114261948-114261970 AAGCATTGCCTGAGGCAGGATGG + Intergenic
961339909 3:126211201-126211223 TGGCAGAGACTGAGTCACGAGGG + Intergenic
961351623 3:126307976-126307998 AAGCACAGGCTGGGTCTGGGTGG + Intergenic
961558164 3:127710831-127710853 GAATAGAGGCTGAGTCAGAAGGG - Intronic
961623852 3:128245514-128245536 AAGCAGAGTGGGAGACAGGAGGG + Intronic
963127731 3:141830771-141830793 AAGCAGAGGCCAAGCCTGGAGGG - Intergenic
965122039 3:164572538-164572560 CAGCAGAGGCTGAATTAGTAGGG - Intergenic
965887000 3:173458184-173458206 AAACAGAGGGTGAGAGAGGAGGG + Intronic
966833710 3:184032865-184032887 GAGCAGAGACTGAGAGAGGAGGG - Exonic
968050964 3:195654702-195654724 AAGAGGAGGCCGAGTCAGGCGGG + Intergenic
968104861 3:195993636-195993658 AAGAGGAGGCCGAGTCAGGCGGG - Intergenic
968303156 3:197631220-197631242 AAGAGGAGGCTGAGTCAGGCGGG - Intergenic
968370077 3:198218779-198218801 AGGCAGAGGCTGGGCCTGGAGGG - Intergenic
968502030 4:955303-955325 AAGCAGGGGCTGCGGCAGAAGGG - Intronic
968814874 4:2817149-2817171 CAGGAGTGGCTGAATCAGGAAGG + Intronic
968869013 4:3231892-3231914 AAGCAGATCCTAAGGCAGGATGG + Intronic
968927985 4:3559998-3560020 ATGCAGGGACTGAGTCAGGCAGG + Intergenic
969206663 4:5652277-5652299 GAGGAGAGGCTGCGTCAGGATGG + Intronic
969570844 4:8007351-8007373 AAGCAGGGGCTGGGAGAGGATGG - Intronic
969634627 4:8359769-8359791 AAGCATTGCCTGAGGCAGGATGG - Intergenic
969934459 4:10667033-10667055 AAGCAGAATCTGACTCAGGGAGG - Intronic
970213157 4:13731713-13731735 AAGCAGAGGATGAGGCTGGAAGG + Intergenic
970534059 4:17011170-17011192 AAACTGAGGCAGAGACAGGAAGG + Intergenic
970566103 4:17334088-17334110 AAGCAGAGTCTGAGGCAGGATGG - Intergenic
971298016 4:25417230-25417252 TATGAGAGGCTGAGGCAGGAGGG - Intronic
972265540 4:37455442-37455464 GAACAGATGCTGAGACAGGAAGG + Intronic
972316773 4:37934265-37934287 AAGCTCAGGATGAGTCAGAATGG + Intronic
972362099 4:38336189-38336211 AAGAAGTGGTTGAGTCATGAGGG + Intergenic
972544896 4:40071172-40071194 AAGGAGAGGCAGAGTAGGGAAGG - Intronic
973619048 4:52709611-52709633 AAGAAGAGGCAGAGTCATGGTGG + Intergenic
974368968 4:60989117-60989139 AAGCAGGGCCTGGGTGAGGATGG - Intergenic
975038951 4:69720929-69720951 GAGCAGGGGCTAAATCAGGAGGG - Intergenic
975795591 4:78003370-78003392 CTTCAGAGGCTGAGGCAGGAGGG - Intergenic
975815202 4:78210004-78210026 CAGCAGAGGCTGGGTCAACAAGG - Intronic
976222858 4:82772030-82772052 AAGCCCAGGCTGAGTCTCGAAGG + Intronic
976330998 4:83830981-83831003 CAGCAGAGGCTGAGTCTAGGTGG - Intergenic
976818160 4:89174511-89174533 AAGAAGGGGCAGAGTGAGGATGG - Intergenic
978442927 4:108752948-108752970 AAGCACTGGCTGAGTCTGCATGG + Exonic
978523293 4:109638722-109638744 AAGCAGTGGCAGAGTTTGGAGGG - Intronic
978721745 4:111918015-111918037 ATGCAGTGGCAGAGCCAGGAAGG - Intergenic
979258775 4:118630744-118630766 AGGCAGAGGCTGGGCCTGGAGGG - Intergenic
979329574 4:119409812-119409834 AGGCAGAGGCTGGGCCTGGAGGG + Intergenic
979724210 4:123941552-123941574 AAACAGAGGCTGGCTAAGGAAGG + Intergenic
979771685 4:124533012-124533034 CATCAGAGCCTGACTCAGGATGG + Intergenic
982301435 4:153882758-153882780 AAGCAGTGGTTGAGGGAGGAGGG + Intergenic
984081380 4:175253328-175253350 AGGCAAAGGCTGAGCCAAGAGGG + Intergenic
984535741 4:180973157-180973179 AAGCAGAAGCTAAGTGAAGAGGG + Intergenic
984617284 4:181913200-181913222 ACGCAGAAGCCGAGACAGGAAGG + Intergenic
985981983 5:3477665-3477687 AAACAGAAGCTGAGAAAGGATGG + Intergenic
986153117 5:5146091-5146113 GAGCAGAGGCTGAGTCATTTCGG - Intronic
986216063 5:5720225-5720247 GAACAGTGGCAGAGTCAGGATGG + Intergenic
986270210 5:6223655-6223677 AAAGGGAGGCTGAGTCAGGGAGG + Intergenic
987266876 5:16265200-16265222 AAGATAAGGCTGAGCCAGGACGG - Intergenic
987372614 5:17207262-17207284 CTCCAGAGGCTGAGGCAGGAGGG + Intronic
988318701 5:29665091-29665113 AATTAGAGGTTGAGTCAAGAGGG + Intergenic
988979656 5:36553941-36553963 AAGGAGAGGCAGACTCAGGGTGG + Intergenic
989807986 5:45635531-45635553 AAGTAGACGTTGAGTAAGGAAGG - Intronic
990803087 5:59627812-59627834 AGGCAGAGGCTGAACAAGGATGG + Intronic
992240212 5:74761400-74761422 AGTCAGAAGCTGAGTCAGAAAGG + Intronic
994281849 5:97914026-97914048 TTCCAGAGGCTGAGGCAGGAGGG + Intergenic
994926804 5:106126507-106126529 AAACAGAAGCTGGGTTAGGAAGG - Intergenic
997106276 5:131022791-131022813 AAGCAGAGGATGAGAATGGATGG - Intergenic
997929985 5:138064732-138064754 AAGCAGAGGATGTGCCAAGAAGG - Intergenic
998913952 5:146994299-146994321 AATAAGTGGCTGAGTCAGGAGGG + Intronic
999101276 5:149027969-149027991 AAACAGAGGCTGAGACATAAAGG - Exonic
999157401 5:149468167-149468189 AAGAGGAGGCTGAGGCAGGTGGG + Intergenic
999382189 5:151129168-151129190 AGGCAGGGGCTGGGTCATGAAGG - Intronic
999621772 5:153481219-153481241 AAACAGAGGCAGAGTCTGAATGG - Intergenic
999743049 5:154571467-154571489 ATGCAGATTCTGATTCAGGAAGG + Intergenic
999992250 5:157060326-157060348 TAGCTGGGGCTGAGTCAGCAGGG - Intergenic
1000313255 5:160064708-160064730 AAGCACAGGCTGAGGGTGGATGG + Intronic
1000367756 5:160506747-160506769 AGACAGAGGCTGAGTGAGAAAGG - Intergenic
1001018222 5:168160781-168160803 AGGCTGAGGCTGAGGCTGGAGGG + Intronic
1001257411 5:170194527-170194549 GAGCAGAGGCAGAGTCTGGGAGG + Intergenic
1001309273 5:170599090-170599112 AACCAGAGGCAGAGACTGGAAGG + Intronic
1001617635 5:173056239-173056261 AATCAGGGGCTGAGTCCGGCCGG - Intergenic
1001944573 5:175768071-175768093 AGGCAGAGGCTGAGTGTGAAAGG - Intergenic
1001951784 5:175821307-175821329 ACAGAGAGACTGAGTCAGGAAGG - Intronic
1002077001 5:176714250-176714272 AAGGAGGAGATGAGTCAGGAAGG - Intergenic
1002130925 5:177081230-177081252 AAGAAGAGGAAGAGTAAGGAAGG + Intergenic
1002209540 5:177589005-177589027 ATGTAGAGGTTCAGTCAGGATGG - Intergenic
1002729356 5:181324357-181324379 AGGCAGAGGCTGGGCCTGGAGGG - Intergenic
1002873719 6:1191123-1191145 AAGCTGAGGCTGAGTGCTGATGG + Intergenic
1002900616 6:1406890-1406912 TAGCAGAGGCTGAGTCATTGAGG + Intergenic
1003110625 6:3249557-3249579 AAGAAGGGGCTGAGCCAGGCTGG - Intronic
1003118900 6:3304174-3304196 GACCAGAGCCTGAGGCAGGAGGG + Intronic
1006408353 6:33857858-33857880 GACCAGAGGCTGACTCAGCAGGG + Intergenic
1006451472 6:34108072-34108094 CAGCACAGGCTGGGTGAGGAGGG + Intronic
1006669636 6:35721816-35721838 AAACTGAGGCTTGGTCAGGAAGG - Intronic
1007163374 6:39810836-39810858 AAGCAGAGCCTCGGACAGGATGG - Intronic
1007341223 6:41192584-41192606 AACCAGAGGCAGAGCCAGAAAGG - Intronic
1007370116 6:41421260-41421282 AAGCAGAGCCTGAGGCAGGTGGG + Intergenic
1007615808 6:43179371-43179393 AAGGGGAGGCTGAGGGAGGACGG - Exonic
1007688802 6:43684443-43684465 AAGCAGGGCTTGAGGCAGGAAGG - Intronic
1007769958 6:44184330-44184352 AAACAGAGGCTGTGCCAGGATGG - Exonic
1007816271 6:44527687-44527709 AGGCAGAGGCTGTGGCAGGGCGG + Intergenic
1008519877 6:52352830-52352852 AAGCTTAGGGTGAGTCATGAAGG - Intergenic
1008583713 6:52929923-52929945 ATGCAGATGCTGATTCAGTAAGG + Intergenic
1008600761 6:53091753-53091775 GAACAGTGGCTGAGTCAGAAGGG - Intronic
1009815987 6:68736118-68736140 CAGGAGAGGCTGAAGCAGGAGGG - Intronic
1010293409 6:74166990-74167012 CAGCAGAGGCTGACTCAGTTTGG - Intergenic
1010472722 6:76248918-76248940 AAGCAGAAACTGATTCAAGAAGG + Intergenic
1010664059 6:78606072-78606094 ATGCACAGGATGAGTCAGAAGGG - Intergenic
1011232632 6:85179847-85179869 AAGCAAAGAGGGAGTCAGGAAGG - Intergenic
1016554345 6:145318774-145318796 AAGGAGAAACTGAGTAAGGAAGG + Intergenic
1016848867 6:148596167-148596189 AAGGAGAGGCTGGGACTGGACGG - Intergenic
1016861274 6:148721109-148721131 AAGGTGAGGCTGAGTCAGCCAGG - Intergenic
1017056507 6:150441448-150441470 CAGCAGAGGTGGAGGCAGGAAGG - Intergenic
1017456135 6:154603285-154603307 GAGAAGAAGCTAAGTCAGGAAGG - Intergenic
1017463353 6:154672089-154672111 TTGCAGAGGCTGACCCAGGAGGG + Intergenic
1018329876 6:162715803-162715825 TAGCAGAGGCTGTGTTGGGAAGG - Intronic
1018755032 6:166841645-166841667 CTGCAGAGGCTGAGTCAGAAAGG + Intronic
1018830970 6:167443332-167443354 AAACAGAGGCTGTCTCGGGAGGG - Intergenic
1019888262 7:3924258-3924280 AAGGAGAGGATGAGTTAGGATGG + Intronic
1020709578 7:11590198-11590220 ATGAAGAGGTTGAGTCAAGAAGG + Intronic
1020963824 7:14840899-14840921 AAGCAGAGGATGAGACAGCCTGG - Intronic
1021067721 7:16197577-16197599 AGGCAGAGGCAGAGGCAGGAAGG - Intronic
1021067882 7:16198794-16198816 AGGCAGAGGCAGAGGCAGGAAGG - Intronic
1022462696 7:30626455-30626477 ATTCGGAGGCTGAGACAGGAGGG - Intronic
1022495961 7:30853320-30853342 GAGCAGAAGCTAATTCAGGATGG + Intronic
1022711555 7:32855512-32855534 AAGCAAAGGCTGAAGCAGGGAGG - Intergenic
1022819908 7:33949395-33949417 ATGCAGAGGCTGGCTCTGGAAGG - Intronic
1023135462 7:37047292-37047314 AAGGAAAGGCAGAGACAGGAAGG - Intronic
1023225062 7:37960557-37960579 AAGCAAAGGCTGAGGCTGCAAGG + Intronic
1023842630 7:44105666-44105688 AAGGAGAGCCAGAGGCAGGAGGG - Intronic
1023849592 7:44142798-44142820 CTCCAGAGGCTGAGGCAGGAAGG - Intergenic
1024310538 7:47965312-47965334 ATGCAGAGACTTTGTCAGGATGG - Exonic
1024652423 7:51416498-51416520 AAGTAGAGGCTTAGTCAAGAAGG + Intergenic
1025037601 7:55607147-55607169 AAGTAGAGGCTTAGTCAAGAAGG + Intergenic
1025187379 7:56871520-56871542 GAGGAGAGGCTGGGGCAGGAGGG + Intergenic
1025259855 7:57411613-57411635 AAGGAGAGGGTGAGAGAGGAGGG + Intergenic
1025683143 7:63695596-63695618 GAGGAGAGGCTGGGGCAGGAGGG - Intergenic
1025684546 7:63705400-63705422 GAGGAGAGGCTGGGGCAGGAGGG - Intergenic
1026423912 7:70270476-70270498 AAGCAGAGGATGAGTGGAGAGGG + Intronic
1026557646 7:71422128-71422150 AAGAAGGGGTTGGGTCAGGAGGG + Intronic
1027052675 7:75029767-75029789 AGGCAGAGCCTGAGTGAGGCCGG + Intronic
1028616388 7:92772618-92772640 GGGCAGTGGCTGAGCCAGGATGG - Intronic
1029202227 7:98846839-98846861 AAGAAGAGGTTGAGTCAGCAGGG - Exonic
1030160360 7:106502159-106502181 CTGCAGAAGCAGAGTCAGGAGGG - Intergenic
1030673585 7:112363267-112363289 ATACAGAGGCTGAGACAGGAGGG + Intergenic
1030903410 7:115151873-115151895 AAGCAGAGGTCAGGTCAGGATGG - Intergenic
1031428951 7:121642190-121642212 AAGAATAGGCTGTGTCAAGAAGG + Intergenic
1032051079 7:128651493-128651515 AGGCAGAGGCTGGGCCTGGAGGG - Intergenic
1032520037 7:132536916-132536938 AAGCAGAGGCTGACACAGAGTGG - Intronic
1032640627 7:133763201-133763223 AAGCAGAGGCTGTGGCAGGGGGG - Intronic
1033651412 7:143346431-143346453 GAGCAGAGGGTGATTTAGGAGGG + Intronic
1033705206 7:143879870-143879892 CAGCAGAGGCTGAGGGAGAAGGG - Intronic
1034599274 7:152233564-152233586 AAACAAAGGCTGACTCAAGAAGG + Intronic
1035637416 8:1156877-1156899 ATGAGGAGGCTGACTCAGGAAGG + Intergenic
1036437543 8:8749010-8749032 AAGCAGAGGCTGTGTCTAGATGG + Intergenic
1036656307 8:10679578-10679600 GGGGAGAGGCTTAGTCAGGAGGG - Intronic
1036661238 8:10710471-10710493 AAGCAGAGGCTGACTGCAGAAGG + Intronic
1037503174 8:19505210-19505232 AATCAGAGGCCGTGTAAGGACGG + Exonic
1038239790 8:25797859-25797881 AAGGAGAGGCTGGGTTACGAGGG + Intergenic
1038388013 8:27167825-27167847 AAGCAGATGCTGACACAAGACGG - Intergenic
1038749326 8:30281435-30281457 ACGCAGACTCTGATTCAGGAGGG + Intergenic
1039569442 8:38575395-38575417 AATGAGAGGCAGAGCCAGGAGGG - Intergenic
1039594593 8:38779756-38779778 CAGCAGAGGCTTAGCAAGGAAGG - Intronic
1040848141 8:51867797-51867819 TACCAGAGGCTGGGGCAGGAGGG + Intronic
1041480738 8:58317181-58317203 GAACAGAGGTTGAGTGAGGAAGG - Intergenic
1041515999 8:58699669-58699691 AGGAAGAGCCTGAGGCAGGAAGG + Intergenic
1042590546 8:70393676-70393698 AAGCAAAGGCTTGGGCAGGAAGG - Intronic
1044506045 8:93020733-93020755 AATCAGATGCTGACTGAGGAGGG + Intergenic
1044557449 8:93579090-93579112 AAGCAAAGGCCAAGGCAGGAAGG + Intergenic
1044701031 8:94965350-94965372 AAGAAGAGGCTGGGACAGGGTGG + Intronic
1045391393 8:101718536-101718558 ATGCAGACGCTGAGGCAGGGAGG - Intronic
1045964419 8:108007830-108007852 CTCCAGAGGCTGAGGCAGGAGGG + Intronic
1046820289 8:118627324-118627346 AAACAGAGGCTGGGCAAGGATGG + Intergenic
1047097883 8:121642964-121642986 AAACAAAGGCTGAAGCAGGAAGG - Intergenic
1047305220 8:123647443-123647465 AATCTGAGGCTAAGTGAGGAAGG + Intronic
1047447013 8:124928478-124928500 AGGCAGAGCCTGAGTCACAAAGG + Intergenic
1047473919 8:125206898-125206920 AAGAAGAGGCAGAGCCAGCAAGG + Intronic
1047570664 8:126095276-126095298 AACCAAACGATGAGTCAGGAAGG + Intergenic
1047744106 8:127831208-127831230 ATACAGAGGCTGAGGCAGGAGGG + Intergenic
1047793011 8:128224548-128224570 AGGCAGAGGCTGACACAGGTTGG - Intergenic
1048074176 8:131051179-131051201 AAGCAGAGTCAGAGTCTCGAAGG + Intergenic
1048427127 8:134333099-134333121 ATGCAGATGAAGAGTCAGGAAGG + Intergenic
1049179309 8:141212899-141212921 CAGCAGGGGCTGAGTGGGGAGGG + Intronic
1049306449 8:141906768-141906790 AAGCAGTGGATGGGTCTGGAGGG - Intergenic
1049397266 8:142406805-142406827 ACGCAGAGGCAGTGTCATGAGGG + Intergenic
1049521102 8:143091927-143091949 AGGCTGGGGCTGAGTCTGGAAGG + Intergenic
1049847746 8:144811431-144811453 AAGCAAAGGCTGAGACAGGGTGG + Intergenic
1049847756 8:144811501-144811523 AAGCAAAGGCTGAGACAGGGTGG + Intergenic
1049847766 8:144811571-144811593 AAGCAAAGGCTGAGACAGGGTGG + Intergenic
1049847773 8:144811641-144811663 AAGCAAAGGCTGAGACAGAGTGG + Intergenic
1049847782 8:144811711-144811733 AAGCAAAGGCTGAGACAGGGTGG + Intergenic
1049847792 8:144811780-144811802 AAGCAAAGGCTGAGACAGGGTGG + Intergenic
1049847801 8:144811850-144811872 AAGCAAAGGCTGAGACAGGGTGG + Intergenic
1049847811 8:144811920-144811942 AAGCAAAGGCTGAGACAGGGTGG + Intergenic
1049847818 8:144811990-144812012 AAGCAAAGGCTGAGACAGAGTGG + Intergenic
1049847827 8:144812060-144812082 AAGCAAAGGCTGAGACAGGGTGG + Intergenic
1049847837 8:144812130-144812152 AAGCAAAGGCTGAGACAGGGTGG + Intergenic
1049847845 8:144812200-144812222 AAGCAAAGGCTGAGACAGGGTGG + Intergenic
1049847855 8:144812270-144812292 AAGCAAAGGCTGAGACAGGGTGG + Intergenic
1049847865 8:144812340-144812362 AAGCAAAGGCTGAGACAGGGTGG + Intergenic
1049847875 8:144812410-144812432 AAGCAAAGGCTGAGACAGGGTGG + Intergenic
1049847884 8:144812480-144812502 AAGCAAAGGCTGAGACAGGGTGG + Intergenic
1051403482 9:16708699-16708721 AAGCAGAGAAGGAGTCAGTAGGG + Intronic
1051642449 9:19236473-19236495 AAGTAGAGGCTGTGTCATGAAGG + Intronic
1052180656 9:25522673-25522695 AAGCAAAGGATGAGTCAACAGGG - Intergenic
1052593686 9:30531424-30531446 AGGCATAGGATGAGGCAGGAGGG + Intergenic
1052857785 9:33417797-33417819 AAGCACAGGAGGAGCCAGGAGGG - Intergenic
1053248462 9:36554564-36554586 TTTCAGAGGCTGAGGCAGGAGGG - Intergenic
1053297100 9:36922933-36922955 AGGCAGAATCTGAGTCAAGAAGG - Intronic
1053802843 9:41775079-41775101 ATGCAGGGACTGAGTCAGGCAGG + Intergenic
1054142404 9:61539991-61540013 ATGCAGGGACTGAGTCAGGCAGG - Intergenic
1054191148 9:61986425-61986447 ATGCAGGGACTGAGTCAGGCAGG + Intergenic
1054462148 9:65471141-65471163 ATGCAGGGACTGAGTCAGGCAGG - Intergenic
1054647221 9:67601292-67601314 ATGCAGGGACTGAGTCAGGCAGG - Intergenic
1055790118 9:79914666-79914688 AAGCAGAGGCTGAGTCATACGGG + Intergenic
1055944006 9:81676586-81676608 AAGCAGTGGCCAAGACAGGAAGG + Intronic
1056479678 9:86988462-86988484 AGGCAGAGGCTGGATGAGGAGGG - Intergenic
1056766554 9:89447754-89447776 GGGCTGAGGCAGAGTCAGGAAGG - Intronic
1056844424 9:90025065-90025087 AAGCAGAAGCCGTGTCAGGAGGG + Intergenic
1057029908 9:91767728-91767750 AACCAGGGGCAGTGTCAGGAAGG + Intronic
1057373072 9:94491483-94491505 ATGGGGAGGCTGAGGCAGGAGGG + Intergenic
1057509144 9:95663275-95663297 ATGCAGACTCTCAGTCAGGAAGG - Intergenic
1057721582 9:97535946-97535968 GGGCAGAGGCTGTGTCTGGAGGG + Intronic
1057804575 9:98211120-98211142 TAGCAGTGGCTGAACCAGGATGG - Intronic
1057831231 9:98408893-98408915 AATCGCAGGCTGAGGCAGGAGGG - Intronic
1058957707 9:109964375-109964397 AGGCAGAGGCAGAGGCAGGAAGG + Intronic
1059218098 9:112585582-112585604 AAGTAGAGGCTGGGACAGGAGGG + Intronic
1059519067 9:114922845-114922867 AAGCAGATTCTGACTCAGTAGGG + Intronic
1059636077 9:116171883-116171905 AAGCAGAAGCTGATTGAAGAAGG + Intronic
1059808250 9:117827833-117827855 AAGCAGAGGATTATTCAGTAGGG + Intergenic
1060115317 9:120935648-120935670 AAGCAGAGACTGTGGCAGGCAGG + Intergenic
1060928626 9:127473689-127473711 GAGCAGTGGCTGAGTCAGGGTGG + Intronic
1061590826 9:131596546-131596568 AAGCACAAGGTGAGTCTGGAGGG - Intronic
1061779390 9:132986856-132986878 AAGAAGAGGCTGCTGCAGGAGGG - Intronic
1061877095 9:133549625-133549647 TATGAGAGGCTGAGGCAGGAGGG - Intronic
1062160003 9:135074952-135074974 AAACTGAGGCTGGGTCAGGAAGG - Intergenic
1062485915 9:136775575-136775597 GAGAGGAGGCTGAGTCAGGCGGG - Intergenic
1062754017 9:138278049-138278071 AGGCAGAGGCTGGGCCTGGAGGG - Intergenic
1203577329 Un_KI270745v1:19626-19648 AGGCAGAGGCTGGGCCTGGAGGG - Intergenic
1186072904 X:5842106-5842128 AAGCAGAAGCAGAAACAGGAGGG + Intronic
1186326315 X:8481155-8481177 ATGCAGATGCTGATTCAGCAGGG + Intergenic
1186367829 X:8913808-8913830 AAACAGAGGCTGAGTCTGGCAGG + Intergenic
1186556706 X:10567456-10567478 AAGCAGAGGCTGTGTGCGCAGGG + Exonic
1187305982 X:18095664-18095686 ATGCAGATTCTGAGTCAGTAGGG + Intergenic
1187521779 X:20020616-20020638 TAGCAGCAGCTGAGGCAGGAAGG - Intronic
1188314824 X:28660065-28660087 AAGCAGAAGCAGAGTGAGGATGG + Intronic
1189190487 X:39098342-39098364 AAGCATAGGCTGCTTTAGGATGG + Intergenic
1190385090 X:49877789-49877811 AAGCAAGAGCTGACTCAGGAAGG + Intergenic
1190918900 X:54831355-54831377 TACCAGAGGCTGAGGGAGGAGGG - Intergenic
1196495902 X:116324928-116324950 AACCACAGGCTGAGTCAGACTGG - Intergenic
1197777342 X:130127223-130127245 TAGCAGTGGTTGACTCAGGATGG + Intergenic
1198844813 X:140899663-140899685 AAGCATTGCCTGAGGCAGGATGG + Intergenic
1199170166 X:144726198-144726220 ATGAAGAGGCAAAGTCAGGAGGG - Intergenic
1199675146 X:150182322-150182344 AGCCAGAGGCAGAGTGAGGAAGG + Intergenic
1199687954 X:150281067-150281089 AAGCAGAGGCTGGGACATCATGG + Intergenic