ID: 1098043453

View in Genome Browser
Species Human (GRCh38)
Location 12:66376552-66376574
Sequence AAGTTAATACAGATGGAATC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 241
Summary {0: 1, 1: 0, 2: 2, 3: 26, 4: 212}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1098043450_1098043453 5 Left 1098043450 12:66376524-66376546 CCATCTCGTTCTTCCTTGAATTC 0: 1
1: 0
2: 1
3: 26
4: 382
Right 1098043453 12:66376552-66376574 AAGTTAATACAGATGGAATCAGG 0: 1
1: 0
2: 2
3: 26
4: 212
1098043451_1098043453 -8 Left 1098043451 12:66376537-66376559 CCTTGAATTCACACTAAGTTAAT 0: 1
1: 0
2: 1
3: 25
4: 205
Right 1098043453 12:66376552-66376574 AAGTTAATACAGATGGAATCAGG 0: 1
1: 0
2: 2
3: 26
4: 212
1098043449_1098043453 27 Left 1098043449 12:66376502-66376524 CCAGGAGTTCAGCTATTACATTC 0: 1
1: 0
2: 0
3: 6
4: 123
Right 1098043453 12:66376552-66376574 AAGTTAATACAGATGGAATCAGG 0: 1
1: 0
2: 2
3: 26
4: 212

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1098043453 Original CRISPR AAGTTAATACAGATGGAATC AGG Intronic
901927810 1:12578067-12578089 AACTTCATACAGGTGGAACCAGG + Intronic
902974399 1:20078508-20078530 AAGTAAACACAGATGGTGTCTGG - Intronic
903050998 1:20600986-20601008 CAGTTAATACAGTTGGAATATGG - Intronic
904146824 1:28399516-28399538 AAATTAATAGAAATGGAATTAGG - Intronic
904916685 1:33975574-33975596 ATCTTATTACAGAAGGAATCTGG - Intronic
906778801 1:48553925-48553947 AAGTTAATGCAGATGCACTCAGG - Intronic
908519681 1:64929464-64929486 AATTAAATCCAGATGGAACCTGG + Intronic
909103496 1:71380035-71380057 AAGTTACTACAGAGGAAATGTGG - Intergenic
909177169 1:72375704-72375726 AAATTAAAACAAATGGAATATGG - Intergenic
909704676 1:78567495-78567517 AAATTAATACTTATGTAATCAGG + Intergenic
910615382 1:89192063-89192085 AAGTTAATACAGATATAACTTGG + Intronic
911064596 1:93776938-93776960 GGGTTCTTACAGATGGAATCAGG + Intronic
911381243 1:97117518-97117540 AAGTTAATACAGAGACAATTAGG + Intronic
911765224 1:101666319-101666341 AAGATAATACAGATGTTAACAGG + Intergenic
911866534 1:103032213-103032235 AAGTTATTAAATATGGAGTCGGG - Intronic
915049960 1:153058165-153058187 AAGATAATACAGGTAAAATCTGG - Intergenic
915096017 1:153463022-153463044 AAAGTAATACAAAAGGAATCAGG + Intergenic
917707805 1:177652122-177652144 AAGTTAATGCTGGTGGAATCTGG + Intergenic
918125741 1:181581900-181581922 AGTTTTATACAGATAGAATCAGG - Intronic
918636556 1:186781593-186781615 AAATTATTAGAGATGGAGTCTGG + Intergenic
918703934 1:187638098-187638120 AAGTTTATATAGATGCCATCAGG + Intergenic
918756497 1:188344697-188344719 AAGTTAATACAGAAGATATACGG - Intergenic
919074903 1:192801143-192801165 ATGTTAATACAGATAGAAAGTGG - Intergenic
919155488 1:193760309-193760331 AATTTAATAAAGATGGGATTAGG + Intergenic
919664541 1:200279408-200279430 AAGTAAATAAAGATGAAATTTGG + Intergenic
922884670 1:229008888-229008910 TTTTTAATAGAGATGGAATCTGG - Intergenic
1064603056 10:17012674-17012696 AAGTTAATATGGATGGAATGAGG - Intronic
1064969328 10:21048341-21048363 ATGTAAATACAGATGCAGTCTGG + Intronic
1065421639 10:25551390-25551412 AAGGTAATACAGCTGAAATAAGG + Intronic
1068098023 10:52516377-52516399 AAATTAATACAGATTTATTCAGG - Intergenic
1068648030 10:59491633-59491655 AATTTAAAAAAGATTGAATCAGG - Intergenic
1070749372 10:78954930-78954952 CAGTTAACACAAATGGATTCTGG + Intergenic
1072029196 10:91501391-91501413 ATGATAATACATTTGGAATCAGG + Intronic
1074531202 10:114300148-114300170 TGACTAATACAGATGGAATCGGG + Intronic
1075783121 10:125029979-125030001 AAGTTGATAGAAATGGAAGCTGG - Intronic
1075937409 10:126354417-126354439 AAGTTACTGCACATGGTATCTGG + Intronic
1076073690 10:127514542-127514564 ATGTGAACACAGATGGACTCTGG + Intergenic
1076630687 10:131850224-131850246 AAGTTAATGCAGATGGACCTCGG + Intergenic
1079044187 11:17085157-17085179 TAGTTAATACAGATGGAACAAGG + Intronic
1079217858 11:18530515-18530537 AGGTTAATCCAGATGGAGTTAGG - Exonic
1081582262 11:44360431-44360453 AAGTCAATCATGATGGAATCCGG - Intergenic
1081819176 11:45975011-45975033 GATTTAAAACAGATGGACTCAGG + Intronic
1082625760 11:55483168-55483190 AAGTTAATACATATCCAATGTGG + Intergenic
1086155598 11:83662298-83662320 AAGTCAATACAGATTGAAAATGG + Intronic
1088773799 11:113062321-113062343 CATTTCATACAAATGGAATCAGG + Intronic
1088899676 11:114105854-114105876 ATGTTAATACAGAGGGATTGGGG + Intronic
1092858543 12:12698422-12698444 ATGTGGATACAGATGGCATCAGG - Intergenic
1093925511 12:24904497-24904519 CAGTTAATACAGATGGAGGCCGG - Intronic
1097622845 12:61962731-61962753 AATTTAATACAGATGAGACCGGG - Intronic
1098043453 12:66376552-66376574 AAGTTAATACAGATGGAATCAGG + Intronic
1098470676 12:70840017-70840039 AAATTAATACAGTGGCAATCAGG - Intronic
1099213603 12:79825181-79825203 AAATAAATTCAGATGGAATTAGG + Intronic
1099544074 12:83954543-83954565 AAGTAATTACAGATGAAATCAGG - Intergenic
1099927846 12:89039904-89039926 AATTTAAGCCAGATGGAATTTGG + Intergenic
1102661810 12:114535475-114535497 AACTAAATAAAGATGGAATGAGG - Intergenic
1106752910 13:32793499-32793521 ATGTTATTAGAGATTGAATCAGG - Intergenic
1106816133 13:33409262-33409284 AATTTTATACAGATGAAATGAGG - Intergenic
1107250448 13:38353502-38353524 AAGTTCATACAGATTGACCCTGG + Intronic
1107506391 13:41038187-41038209 TAGATAATAAAAATGGAATCAGG + Intronic
1107962189 13:45568322-45568344 AAGTGAAAACAGATGGAAACTGG - Exonic
1108008197 13:45974375-45974397 AAATTAATACAGAGGGAAACTGG + Intronic
1108045894 13:46384278-46384300 AAGTAAATACAGAGAGAATAGGG + Intronic
1108607412 13:52053458-52053480 AAGTTAATACAGAGGGCTGCAGG - Intronic
1110295556 13:73860208-73860230 AATTTAGAACAGGTGGAATCTGG - Intronic
1111199719 13:84918354-84918376 AAGTTTATGCAGATCTAATCAGG - Intergenic
1111306336 13:86417857-86417879 CAGTTCATTCAGATAGAATCAGG + Intergenic
1112578578 13:100659204-100659226 ACGTTAACCCAGAAGGAATCGGG - Intronic
1112926371 13:104679887-104679909 AAGTCTATTCTGATGGAATCAGG - Intergenic
1113441508 13:110332658-110332680 AAGTTAACACAGTAGAAATCTGG - Intronic
1113631126 13:111884781-111884803 AATTTAATAAAGATAGTATCAGG + Intergenic
1118357757 14:65029257-65029279 AAGTGAAAAATGATGGAATCGGG - Intronic
1118953005 14:70451998-70452020 AATTTAATACAATTGGAATTGGG - Intergenic
1119965734 14:78913759-78913781 AAGAGAAAACAGATGAAATCTGG + Intronic
1120380525 14:83773232-83773254 ATGTTAATACCTATGGAAACAGG + Intergenic
1121373473 14:93382760-93382782 AAGATAAAATGGATGGAATCTGG - Intronic
1122681892 14:103471163-103471185 AAGTTAAACCAGATGGTTTCAGG - Intronic
1202828253 14_GL000009v2_random:206-228 CAAGTAATACAGATGGATTCAGG + Intergenic
1124371034 15:29104786-29104808 AAGGAAATACAGATGGGGTCAGG + Intronic
1125072154 15:35567826-35567848 AATATAACACAGATGGAATACGG - Intergenic
1127853602 15:62936462-62936484 CAGTTAATACAAATGGAATATGG - Intergenic
1128173047 15:65530056-65530078 AAGTAATTACAGATGAAATGAGG - Intergenic
1129366458 15:75058596-75058618 CAGCTAATCCAGGTGGAATCTGG + Intronic
1130645103 15:85718538-85718560 AATTTAAGACTGATGGAATCCGG + Intronic
1131592695 15:93767039-93767061 CACTTAATAAAGATGGATTCGGG + Intergenic
1131902258 15:97100544-97100566 AAGTTAATAGAGATTGTATCTGG - Intergenic
1134691585 16:16194084-16194106 AAGTTGAGACCTATGGAATCAGG + Intronic
1135405953 16:22198074-22198096 AAGTCAATACAGATTAAATGTGG + Intergenic
1138216666 16:55210714-55210736 AGGTGAATACAGAAGGAATAAGG + Intergenic
1138775741 16:59722126-59722148 AATATAATACACATGTAATCTGG + Intronic
1140024951 16:71278951-71278973 CAGTTAATACAGAAGGAACCTGG + Intergenic
1140523210 16:75600069-75600091 TGTGTAATACAGATGGAATCTGG - Exonic
1140635072 16:76902665-76902687 AAGTTAATATAAATGGGAGCTGG - Intergenic
1140845709 16:78885266-78885288 AAGAAAATACAGATGGAAGAAGG - Intronic
1141285341 16:82666763-82666785 AAGGTCACACAGATGGAAGCTGG + Intronic
1145105078 17:20108556-20108578 AACTTAATACAAGTGGAATCAGG + Intronic
1150976904 17:70097730-70097752 GAGTGGATACAGATGCAATCAGG - Intronic
1152844186 17:82589537-82589559 CAGTGAATACAGAACGAATCAGG - Intronic
1154290763 18:13104144-13104166 AAGTTATTTCAGATAAAATCAGG - Intronic
1155279436 18:24223986-24224008 TAGTAACTACAGAGGGAATCGGG + Intronic
1155557677 18:27039062-27039084 AAGTAAATAATGATGAAATCTGG + Intronic
1156435310 18:37120867-37120889 AAATTAATATAAAAGGAATCTGG + Intronic
1157889173 18:51398238-51398260 AAGATTACACAGATGGAAACTGG - Intergenic
1158836748 18:61338401-61338423 AAGTTAATCCATATGTAATTAGG - Intronic
1160162538 18:76484729-76484751 AAGTTATTACAGTTAGAATTTGG - Intronic
1162579519 19:11520098-11520120 CATTTCATACAAATGGAATCTGG + Intronic
1164782360 19:30903247-30903269 TATTTAAGACAGATGGAGTCAGG - Intergenic
924963238 2:53259-53281 AAGAAAATCCATATGGAATCTGG + Intergenic
927162975 2:20286913-20286935 AAGATAATTCAGATGAGATCAGG - Intronic
927323920 2:21781088-21781110 AAGTTAACACAGGTGGACACAGG + Intergenic
928646782 2:33362624-33362646 AAGTTAACACAGATGGAAAATGG - Intronic
933787825 2:85858011-85858033 AGGATAATACCGATGGAATGTGG + Intronic
936774724 2:115959026-115959048 AAGCTAATCCAGATGTAAACTGG + Intergenic
938775594 2:134538742-134538764 CATTTCATACACATGGAATCAGG - Intronic
938805696 2:134805391-134805413 AAGTTAATATAGACTGAATGAGG - Intergenic
938846358 2:135213630-135213652 AAGTTATTACAATGGGAATCAGG - Intronic
940755987 2:157684033-157684055 AAGTAAATAAAGTAGGAATCAGG - Intergenic
942193761 2:173497018-173497040 AACTTAGGACAGAAGGAATCTGG - Intergenic
944365781 2:198917716-198917738 AACTAATAACAGATGGAATCAGG - Intergenic
945407120 2:209461928-209461950 AATTTAATCCAGATATAATCTGG + Intronic
946594092 2:221286756-221286778 CAGTTATTACATATGGAAACTGG + Intergenic
947227874 2:227857620-227857642 AAGTTAGAAAAGATGGAAACAGG + Intergenic
947558479 2:231121348-231121370 ATTTTAATAGAGATGGAGTCTGG - Intronic
947880016 2:233499887-233499909 AAGTTAATGCTGAAGAAATCTGG - Exonic
948743615 2:240067966-240067988 AAGTTAATACAGTTAGTTTCAGG + Intergenic
1168832976 20:857259-857281 GAGTTCATGCAAATGGAATCTGG + Intronic
1170166891 20:13368993-13369015 AAATTAATACAGATATATTCAGG + Intergenic
1172296141 20:33812194-33812216 AAGTGAATAGAGCAGGAATCGGG - Intronic
1172987808 20:39007071-39007093 AAGTGAATGCAGATGGATACTGG - Intronic
1174820337 20:53721381-53721403 AAGTTACTACAGAGGCCATCTGG - Intergenic
1176607435 21:8845040-8845062 CAAGTAATACAGATGGATTCAGG + Intergenic
1177015134 21:15777512-15777534 AATTTAATACGTATGTAATCGGG + Intronic
1177498774 21:21923041-21923063 AATTTAATACAGTTTGAGTCAGG - Intergenic
1177852316 21:26363334-26363356 AAGTAAATACAGATGAAAACAGG + Intergenic
1178299509 21:31440497-31440519 AAGTTAATACAGATGCTATCAGG + Intronic
1179437513 21:41372358-41372380 TTCTTAATAAAGATGGAATCTGG - Intronic
1180357521 22:11854827-11854849 CAAGTAATACAGATGGATTCAGG + Intergenic
1180380746 22:12137506-12137528 CAAGTAATACAGATGGATTCAGG - Intergenic
1182792658 22:32965992-32966014 GATTAAAAACAGATGGAATCTGG - Intronic
1184061349 22:42084016-42084038 AATCTAATACAGATGGAGTGGGG - Exonic
950383519 3:12637509-12637531 ATGTTAATAGAGATGGAGGCGGG - Intronic
951392538 3:22124135-22124157 AAATTAATACAGTTGAACTCGGG - Intronic
951701731 3:25503733-25503755 AAGTTGAAACAGAAGGAAGCAGG + Intronic
953753636 3:45628931-45628953 TAGTTTATATAAATGGAATCTGG - Intronic
954732748 3:52678436-52678458 ACTTTAATACACATGGACTCTGG + Intronic
955056093 3:55457362-55457384 AAATGAATGCAAATGGAATCTGG - Intergenic
956494901 3:69814618-69814640 AAGTTAAAAAAGATAGAATGGGG - Intronic
957618570 3:82566117-82566139 ATGTTAAAACAGATGGATACTGG + Intergenic
957900418 3:86481769-86481791 AAGTTCAGACTGCTGGAATCAGG + Intergenic
959987820 3:112596845-112596867 AAGAGAATACAGATGACATCGGG + Intergenic
960012769 3:112851221-112851243 AAGTAAATACAGAGAGAATCTGG + Intergenic
961248871 3:125482359-125482381 AAGGAAATACAGATGCACTCAGG - Intronic
962885834 3:139626831-139626853 AAGTAAATAGGGATGGATTCTGG + Intronic
963101698 3:141612922-141612944 AACTCAAGACAGAAGGAATCAGG + Exonic
965151425 3:164981804-164981826 CAGATAATACACAAGGAATCAGG - Intronic
965362822 3:167762533-167762555 AAGCCAATACAGGTGGAATGGGG - Intronic
970617109 4:17778567-17778589 AAGTAAAAACAGATTGAATGCGG + Intronic
972969212 4:44551533-44551555 AAGTTAATTAAGATGAAATGAGG - Intergenic
973370684 4:49246149-49246171 CAAGTAATACAGATGGATTCAGG - Intergenic
974306142 4:60142751-60142773 GAGTCCATACAGATGGAACCTGG + Intergenic
974409881 4:61526179-61526201 AAGTTCATACAGATGTAATAGGG + Intronic
974977311 4:68906676-68906698 AAGTTAGTTCAGAAGGAAACTGG - Intergenic
976144560 4:82029493-82029515 AAGTTAATACAGGAGGGACCAGG + Intronic
979832879 4:125322152-125322174 ATGTTAAGGCAGATGAAATCAGG - Intronic
980157997 4:129129901-129129923 AAGGAAATACAGATGGACTTAGG + Intergenic
981260960 4:142718215-142718237 AAGTTAAAACAGAGAGAATGGGG - Intronic
982806992 4:159778652-159778674 CAATTAAAACAGATGGAATGTGG - Intergenic
982877526 4:160666583-160666605 AAGTTAATATAGACTGAATGAGG + Intergenic
983723211 4:170884444-170884466 AATATAATACAAATGGAATATGG + Intergenic
988873080 5:35412432-35412454 AAATAAATACAGATGCTATCAGG - Intergenic
989769455 5:45126422-45126444 AAGGTAATTCAGATGAAATGAGG - Intergenic
990112283 5:52342030-52342052 AAGGACATACAGATGGAAACTGG + Intergenic
990549215 5:56856223-56856245 AAGTCAATACAGATAGAATCTGG - Intronic
990622607 5:57576951-57576973 ATGTTAATACATAAAGAATCTGG - Intergenic
991000268 5:61775756-61775778 AAGTTGATACAGATGGGAGTGGG - Intergenic
992604778 5:78444132-78444154 AAGTTACTAAAGAGGGAATATGG + Intronic
993728785 5:91398178-91398200 AAGTAAAGAGAGATGGAATCTGG + Intergenic
994615095 5:102093816-102093838 AAGTTAATAATGCTGGAGTCAGG - Intergenic
994765498 5:103911046-103911068 AAGTGGATACATAAGGAATCTGG + Intergenic
995070460 5:107915165-107915187 AATTTATTCCATATGGAATCTGG + Intronic
995259069 5:110080907-110080929 AAGTTAGTACTTATTGAATCTGG - Intergenic
1000022331 5:157328711-157328733 AAGTAAATAAAAATCGAATCGGG - Intronic
1000612575 5:163390918-163390940 AATTTAATACAGATGAGATCAGG - Intergenic
1001151405 5:169231433-169231455 AAGTTTACACAAATGGAATCAGG + Intronic
1004242465 6:13937392-13937414 AACTTTATACAAATGGAATCAGG + Intronic
1004278852 6:14262109-14262131 AAATTAATACAGAGAGAAACAGG + Intergenic
1005387180 6:25296719-25296741 GATTTAAGACAGATGGATTCAGG - Intronic
1006203013 6:32313739-32313761 AAGTTAAAACAGCTGAGATCTGG - Intronic
1009435815 6:63617182-63617204 AAGTTTGTCCAGATGGAAGCAGG - Intergenic
1009701868 6:67194562-67194584 AACATAATACATATGGAATCTGG - Intergenic
1010540775 6:77089374-77089396 AAGATTATACAACTGGAATCAGG + Intergenic
1014323450 6:119961645-119961667 AAGATAATAGAAATGGAATTTGG + Intergenic
1015140983 6:129931410-129931432 AAATTAATACAGATAAAATTTGG + Intergenic
1015316781 6:131825881-131825903 AAGTTAATAAAGATGAAAAATGG - Intronic
1017546243 6:155453550-155453572 AAGTTAAGAGAGTAGGAATCAGG + Intronic
1020757422 7:12220694-12220716 AAGTAAATGCAGATGTAATTTGG - Intronic
1027983714 7:85258467-85258489 AAGATAATACAGAAGGTATGCGG + Intergenic
1028924903 7:96347308-96347330 ATGTTAATAAAGATAAAATCTGG + Intergenic
1030706827 7:112701499-112701521 AAGTAACTTCACATGGAATCAGG + Intergenic
1030911216 7:115251671-115251693 AAGTTAGTTCACATGAAATCTGG + Intergenic
1031797014 7:126187309-126187331 AAGCTAATACAAATAGAATTGGG + Intergenic
1031845914 7:126805901-126805923 AAGTTTGTACAAATGGAAACTGG - Intronic
1032259134 7:130320707-130320729 AAGGAAATACAGATGGAAAATGG - Intronic
1034099932 7:148442351-148442373 CATATAACACAGATGGAATCCGG - Intergenic
1035114007 7:156507491-156507513 CAATCAATACAGAAGGAATCAGG + Intergenic
1035379681 7:158429748-158429770 ATCTTAATACAGATGGATGCAGG + Intronic
1037115385 8:15219678-15219700 AAGTGAATACAGAAGGAAACAGG + Intronic
1037257171 8:16968531-16968553 AGTTTAGTATAGATGGAATCAGG - Intergenic
1038472293 8:27835486-27835508 AAGATAACACAGATGGAAGAAGG - Intronic
1038652558 8:29418983-29419005 ATCTTAATAAAGATGGAATCTGG + Intergenic
1041243384 8:55868633-55868655 AGGTTACTACAGATGCCATCCGG + Intergenic
1042044947 8:64640058-64640080 AATTTCATATAAATGGAATCAGG - Intronic
1042534119 8:69841653-69841675 AACCTGATACAGAGGGAATCTGG - Intergenic
1045345719 8:101291774-101291796 AAGTAAAGACATATGAAATCTGG + Intergenic
1045579610 8:103464272-103464294 AAGTTAATATAGATGTATTTGGG + Intergenic
1046776991 8:118174785-118174807 ATGTTAATACTGATGGATTTGGG - Intergenic
1048339498 8:133527812-133527834 AAGTCAATCCAGATGGGCTCTGG + Intronic
1049066232 8:140317911-140317933 AAGTTCATAAAGATGAACTCAGG + Intronic
1049987297 9:963162-963184 AAGATCCTATAGATGGAATCAGG - Intronic
1054354245 9:64046227-64046249 CAAGTAATACAGATGGATTCAGG + Intergenic
1056207331 9:84333174-84333196 AAGATAATACAGACGAAATGGGG + Intronic
1058367479 9:104226457-104226479 AAGTTCATACAGGTGAACTCTGG + Intergenic
1058415605 9:104785485-104785507 AAGATAATGAAGATGGAAGCTGG + Exonic
1058422884 9:104849817-104849839 ATGTTGATACATGTGGAATCTGG - Intronic
1058772177 9:108246307-108246329 AACTTAATACACATACAATCTGG - Intergenic
1058996731 9:110306303-110306325 AAGGTAAAACATATGGAATTTGG - Intronic
1059596036 9:115721678-115721700 AAAATAATACAAATGGCATCTGG - Intergenic
1203695094 Un_GL000214v1:90976-90998 CAAGTAATACAGATGGATTCAGG - Intergenic
1203742577 Un_GL000218v1:15346-15368 CAAGTAATACAGATGGATTCAGG + Intergenic
1203702770 Un_KI270742v1:9928-9950 CAAGTAATACAGATGGATTCAGG + Intergenic
1203567522 Un_KI270744v1:104079-104101 CAAGTAATACAGATGGATTCAGG - Intergenic
1203641179 Un_KI270751v1:13087-13109 CAAGTAATACAGATGGATTCAGG + Intergenic
1185834746 X:3334873-3334895 GAGTTGAAACATATGGAATCAGG - Intronic
1187182042 X:16952062-16952084 AAATTAATACAGATGAGATCTGG - Intronic
1187982505 X:24773206-24773228 AACTGAATGCAGATAGAATCAGG + Intronic
1189087072 X:38036566-38036588 CAGTTAATGCAGATGGAACAAGG - Intronic
1189375176 X:40460940-40460962 CAATTAGTACAGCTGGAATCTGG - Intergenic
1195850693 X:109278887-109278909 AAGTTAATACAGACTGAACGAGG - Intergenic
1197165979 X:123378210-123378232 AACTTAATTCAGATGGAAGGTGG + Intronic
1198314489 X:135452257-135452279 CAGTTGTTACAGATGGACTCTGG - Intergenic
1200817004 Y:7543908-7543930 ATGTTAATATTGATGGTATCAGG + Intergenic
1201156106 Y:11132819-11132841 CAAGTAATACAGATGGATTCAGG + Intergenic